Ministério da SaúdeMinistério da Saúde
 
English Español Russo   Français
Comunidade Cadastro Mapa Dúvidas Endereços Fale

 Voltar para: Página principal > Área técnica > Pesquisa > Informe de C&T

Informe de C&T
Pesquisa
Projetos de Pesquisa - Busca pelo termo []    (330 projeto(s) encontrado(s))

Projeto: ESTUDO DE SOROPREVALENCIA DA INFECCAO PELO HIV, SIFILIS, HEPATITES B E C EM INSTITUICOES PUBLICAS
Coordenador: MARK DREW CROSLAND GUIMARÃES
Resumo:

Objetivo:

Metodologia:

Concorrência: Estratégico

População Alvo: População em Geral

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: PROJETO EMERGENCIAL DE ADEQUACAO DE AREA FISICA E INFRAESTRUTURA PARA IMPLANTACAO DE NOVA TECNOLOGIA
Coordenador: MARIA INÊS DE MOURA CAMPOS PARDINI
Resumo:

Objetivo:

Metodologia:

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: ESTUDO DA VARIBILIDADE ANTIGÊNICA DO HIV-1 CIRCULANTE NO DISTRITO FEDERAL - REGIÃO CENTRO-OESTE.
Coordenador: CLAUDIA RENATA FERNANDES MARTINS
Resumo: Desde a sua expansão na população humana. O HIV -1 tem se diversificado muito rapidamente e essa variabilidade esta aumentando continuamente. O grupo M do HIV-1 domina a pandemia de AIDS e diferentes subtipos e formas recombinantes circulantes podem ser identificadas dentro desse grupo. Em geral, linhagens virais pertencentes a um mesmo subtipo podem diferir entre si em ate 20% nas proteínas do envelope. Entre os subtipos, essa diferença pode ser dc ate 35%. Embora avanços consideráveis tenham sido alcançados nas pesquisas c no controle da pandemia de HIV-1 ainda há muito a ser aprendido sobre as implicações imunológicas da diversidade na seqüência do genoma do HIV-1. Uma das abordagens que vem sendo amplamente explorada na busca de um controle efetivo da infecção viral, e o desenvolvimento de vacinas anti-HIV-1. Ainda que exista a expectativa de que uma vacina contra uma única Iinhagem viral apresente proteção cruzada para os diversos subtipos de HIV-I do grupo M, há um interesse crescente na obtenção de vacinas que levem em consideração a diversidade viral. No Brasil, vários estudos tem sido conduzidos no sentido de se conhecer a diversidade do HIV-1 circulante em nosso País. Entretanto, na região Centro-Oeste, essa variabilidade ainda é muito pouco estudada e precisa ser melhor entendida. Recentemente, nosso grupo de pesquisa em virologia humana da Universidade de Brasília, iniciou estudos sobre a variabilidade do HIV-1, associada a resistência aos anti-retrovirais, no Distrito Federal. Os genes da protease e da transcirptase reversa de amostras de HIV-1 de indivíduos apresentando falha no tratamento estão sendo seqüenciados. Dados preliminares foram apresentados no Segundo Foro de VHI-SIDA e um manuscrito encontra-se em fase de preparação para divulgação dos resultados já obtidos ate o momento. O projeto de pesquisa ora apresentado tem como objetivo conhecer a diversidade antigênica do HIV-1 no Distrito Federal. Pretendemos dar continuidade ao estudo da diversidade do vírus nessa localidade, buscando minorar as disparidades regionais sobre o conhecimento da variabilidade genética do HIV-1 e gerar dados que nos permitam conhecer melhor o perfil da epidemia no Brasil. A proposta de trabalho apresentada pretende explorar o seqüenciamento de regiões do genoma viral em especial o segmento V3 do gene env e o gene nef considerados alvos de vacinas, por induzirem imunidade humoral e ceIuIar. Serão coletadas amostras de plasma de indivíduos HIV positivos e, após reações de transcrição reversa e PCR, será feito o seqüenciamento desses segmentos gênicos, seguido da análise das seqüências. Adicionalmente, os resultados a serem obtidos, juntamente com os dados que estamos gerando para os genes da protease e da transcriptase reversa, nos permitirão definir um perfil dos subtipos e das formas recombinantes que ocorrem na região central do País. Com esses resultados, esperamos contribuir para um melhor entendimento da variabilidade antigênica do HIV-1 no Distrito Federal, o que certamente tem implicações em futuros testes de vacinas no Brasil. Nosso grupo de pesquisa realiza colaborações com pesquisadores de outros estados do Centro-Oeste (Goiás, Tocantins e Mato-Grosso) o que facilitaria a expansão, em projetos futuros, de tais estudos para as outras localidades. Também já possuímos experiência nesse tipo de estudo, não só com o HIV-1, mas também com outros vírus de transmissão sexual e sanguínea como o HPV e o HCV. Já realizamos vários trabalhos de caracterização molecular dos HPVs e do HCV no Brasil central alguns já publicados e outros com manuscritos submetidos ou em preparação. Alem disso, a UnB dispõe de todos os equipamentos necessários para a realização do referido trabalho, incluindo: seqüenciador automático, termocicladores, fotodocumentadores. Nossas necessidades envolvem apenas a aquisição de material de consumo para os ensaios de biologia molecular previstos na metodologia.

Objetivo: Geral: Iniciar um estudo de caracterização da variabilidade antigênica do HIV-1 no Distrito Federal, analisando, por meio de seqüenciamento automático, regiões do genoma viral consideradas alvos de vacinas por induzirem imunidade humoral e celular. As regiões do genoma viral escolhidos para esse estudo correspondem ao segmento V3 de env e ao gene nef. Ambas são consideradas regiões de alta imunogenicidade e alvos de vacinas. Nesse primeiro momento, pretendemos iniciar a caracterização de amostras de HIV-1 de indivíduos do DF. Entretanto, como nosso grupo de pesquisa realiza colaborações com pesquisadores de outros estados do Centro-Oeste (Goiás, Tocantins e Mato-Grosso) estamos considerando a expansão, em projetos futuros, de tais estudos para essa outras localidades. Específicos: Definir a prevalência de subtipos de HIV -1 que circulam no Distrito Federal. Permitir a formação de recursos humanos, em nível de Mestrado, no âmbito da virologia humana molecular, mais especificamente da biologia molecular do HIV-1. Contribuir para minorar as disparidades regionais, nesse caso, da região Centro-Oeste em relação às regiões Sul e Sudeste.

Metodologia: Amostragem: A população alvo do estudo será de indivíduos de ambos os sexos, residentes no Distrito Federal com sorologia positiva para anti-HIV-1, encaminhados dos Centros de Referência para DST/AlDS ao LACEN-DF para a avaliação da carga viral antes de iniciarem tratamento com anti-retrovirais. Uma amostra de sangue total de cada indivíduo será coletada no mesmo momento da coleta para o exame da carga viral. Serão considerados os seguintes critérios de inclusão: a) Consentimento Livre e esclarecido (modelo em anexo) para participar do estudo, conforme as normas de pesquisa envolvendo seres humanos: b) idade superior a 13 anos: c) não ter sido ainda submetido a tratamento com anti-retrovirais. A amostragem de indivíduos incluídos no estuda será de, no mínimo, 60 indivíduos, num período de 6 meses. Esse tamanho da amostra foi calculado pelo Statcalc Epi-6, para um nível de confiança de 99.99%. Extração do RNA: O RNA total será extraído das amostras de plasma, usando-se kits adequados (QIA amp viral RNA kit - Qiagen). Caso haja problema de degradação do RNA viral adotaremos a extração de DNA de células do sangue total, também com o uso de kits (QIA blood kit - Qiagen). Amplificação por PCR: após a extração, será feita a transcrição reversa das amostras de RNA, quando pertinente, seguida da amplificação de regiões do genoma viral. Nossa proposta envolve a amplificação de duas regiões genômicas o fragmento C2V3 de env e nef. Para a amplificação do fragmento C2V3, serão utilizados os primers externos ED/EDl14 e internos ED5/ED12, conforme descrito por Price et al., 2003. Para nef, o procedimento de amplificação será feito de acordo com a descrição de Artenstein et a/., 1996. A análise dos produtos de PCR será feita por eletroforese de agarose, e os mesmos deverão ser purificados para o seqüenciamento. Seqüenciamento automático: 0 seqüenciamento das amostras será realizado em equipamento já disponível na UnB, Megabace System (Amersham-Pharmacia), e que vem sendo amplamente usado pelo nosso grupo de pesquisa.

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: PROPOSTA PARA MELHORIA DA INFRA-ESTRUTURA DA UNIDADE DE IMUNOLOGIA DO LABORATÓRIO AVANÇADO DE SAÚDE PUBLICA - LACEN PARA APOIO AOS LABORATÓRIOS PRIMÁRIOS NO PROCESAMENTO DE AMOSTRAS BIOLÓGICAS PARA ENSAIOS DE VACINAS ANTI-HIV/AIDS.
Coordenador: MARIA FERNANDA RIOS GRASSI
Resumo: O programa brasileiro de DST/AIDS, desenvolvido pelo Ministério da Saúde em 1985, foi importante para a prevenção da infecção e garantiu o acesso universal aos antiretrovirais em 1997. Atualmente, cerca de 135 mil pacientes recebem tratamento anti-retroviral gratuito. A sobrevida dos indivíduos infectados, em uso de tratamento, aumentou de cinco para cinqüenta e oito meses e a mortalidade da doençaa caiu em 50%, como observado em países desenvolvidos. Apesar de todo este esforço a epidemia no Brasil tem se expandido nos últimos cinco anos, principalmente nas regiões sul, norte e nordeste. O número estimado de indivíduos infectados pelo HIV e de 597000, o que representa 0,69% da população. Anualmente são notificados 21000 casos de AIDS em nosso país, com uma incidência de 15 casos/l00mil habitantes. A AIDS e ainda responsável por cerca de 10000 óbitos ao ano, constituindo a segunda causa de óbitos entre homens jovens e a quarta causa entre mulheres. A doença diminuiu a expectativa de vida do brasileiro em 3 meses. As características atuais da epidemia em nosso País de heterossexualização, feminilização, interiorização e pauperização podem somar para dificultar o controle da infecção. Assim, o desenvolvimento de uma vacina e de crucial importância para o controle da pandemia, especial mente em países em desenvolvimento. A Coordenação Nacional DST/AIDS tem investido no fortalecimento dos laborat6rios brasileiros capazes de estudar e avaliar a resposta imune aos produtos de vacinas tanto em indivíduos infectados pelo HIV, quanto em indivíduos não infectados. O Laboratório Avançado de Saúde Pública (LASP) no Centro de Pesquisas Gonçalo Moniz (CPqGM) em Salvador, Bahia, e um dos Centros de Referencia para 0 Isolamento e Caracterização do HIV no Brasil e para o diagnóstico das Retroviroses Humanas do Ministério da Saúde. A especialização de nosso laboratório na vigilância do polimorfismo do HIV e na caracterização fenotípica dos isolados brasileiros nos orienta para o estudo da resposta imune ao HIV em uma estratégia pré-vacina. Alem de possuir laboratórios de nível de segurança P2 e P3 equipado e contar com vários equipamentos disponíveis, realizamos uma serie de treinamentos na área de avaliação de vacinas anti-HIV/AIDS, a exemplo de workshops em Elispot organizados pela OMS/UNAIDS (Universidade de Duke-EUA e IOC/Fiocruz/RJ) e treinamento com a Dra Brigitte Autran, em Paris-França avaliação de vacinas anti-HIV/AIDS. Já realizamos nos dias 11 e 12 de setembro de 2003 em parceria com a CNIDST 0 "Workshop Congelamento/Descongelamento de células mononucleares do sangue periférico (pBMC), para avaliação de vacinas anti-HIV/AIDS do Programa de Vacinas HIV/AIDS do Ministério da Saúde", que contou com a participação de 8 laboratórios em sítios potenciais de testes de vacinas. No entanto, para transferir estas metodologias permitindo alcançar as metas do programa de Avaliação de Vacinas faz-se necessário ampliar a estrutura existente em nosso laboratório. O objetivo do presente projeto e consolidar o núcleo de Imunologia do LASP. Este núcleo dará apoio ao programa Nacional de Vacinas Anti/HIV/AIDS do Ministério da Saúde: a) através do treinamento dos laboratórios primários nos sítios de ensaios vacinais, para obtenção de amostras biológicas e técnicas de criopreservação; b) através do treinamento de laboratórios secundários nos testes de avaliação da resposta imune aos produtos vacinais. Para tais serviços realizadas oficinas de treinamento em biossegurança, obtenção e criopreservação de células mononucleares do sangue periférico e de ELISPOT no LASP/CPQGM/FIOCRUZ com participantes selecionados contemplando critérios pré-estabelecidos, como competência, região geográfica, e comprometimento futuro em participar na Rede a ser implantada.

Objetivo: Consolidar O núcleo de Imunologia do LASP. Este núcleo da apoio ao programa Nacional de Vacinas anti-HlV/AIDS do Ministério da Saúde através do treinamento dos laboratórios primários nos sítios de ensaios vacinais, para obtenção de amostras biológicas e técnicas de criopreservação, através do treinamento de laboratórios secundários nos testes de avaliação da resposta imune aos produtos vacinais.

Metodologia: Realização de oficinas de treinamento em biossegurança, obtenção e criopreservação de células mononucleares do sangue periférico e de ELlS POT no LASP/CPQGM/FIOCRUZ com participantes selecionados contemplando critérios preestabelecidos, como competência, região geográfica, e comprometimento futuro em participar na Rede a ser implantada.

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: AVALIACAO DE UMA POPULACAO DE MENORES EM SITUACAO DE RISCO: DIAGNOSTICO SITUACIONAL DE DST/HIV/AIDS.
Coordenador: MARGARET AMORIM FIALHO
Resumo: O adolescente esta na linha de frente da pandemia da Aids, uma ameaça a sua saúde e sua sobrevivência. Diariamente mais de 7.000 jovens são infectados pelo HIV, no total de 2.6 milhões por ano, o que representa a metade de todos os casos registrados. Este projeto objetiva avaliar a prevalência das principais DSTs numa população de menores em situação de risco (menores cumprindo medidas sócio educativas), Será utilizada a ficha do adolescente (CLAPP OPS/OMS). exame físico e a avaliação sorológica para HIV, HTLV, Sífilis e Hepatites B e C. As informações obtidas serão armazenadas em banco de dados analisadas utilizando-se o programa Epi-info, o acesso ao banco de dados será protegido por senha para garantir confidencialidade das informações. A intervenção será limitada a duas instituições. envolvendo aproximadamente 600 menores ( 100% dos internos e 20 (1% da população flutuante). E esperado que: 1- Seja determinada a prevalência de DST/AIDS nessa população (os casos diagnosticados serão encaminhados para atendimento especializado); 2- Seja caracterizado o perfil biopsicossocial: 3- Seja estimulado os fatores de proteção (incluindo boa auto-imagem e auto-estima. modelos de referencia e projeto de vida: 4- Seja possibilitado o surgimento de proposta de intervenção de modo a contemplar as necessidades desta população. Os resultados obtidos serão comunicados aos órgãos estatais competentes para embasar medidas de prevenção e divulgadas também junto a comunidade científica através de eventos científicos de grande impacto e publicação em revistas de circulação nacional e internacional.

Objetivo: Geral: Determinar a prevalência de DST/HIV/AIDS e caracterizar biopsicossocialmente 600 adolescentes da FUNDAC (CAM - Casa de Acolhimento ao Menor e CASE - Comunidade de Atendimento Sócio Educativo em Salvador) Especifico: Estabelecer medidas profiláticas e terapêuticas para os adolescentes em situação de risco, nas instituições envolvidas.

Metodologia: Instrumento de Avaliação: Será utilizada a ficha do adolescente (CLAPP/OPS/OMS) que permite uma avaliação biopsicossocial contemplando inclusive questões da sexualidade e Interrogatório ginecológico. A avaliação do estagio puberal será feita segundo os critérios de TAER. Exames laboratoriais: Dada a situação de extremo risco para aquisição de DSTs, por parte desta população, será realizada avaliação sorológica para HIV, HTLV, Sífilis, e Hepatites B e C. A sorologia para HIV, HTL V e Hepatites virais será realizada por testes imunoenzimáticos (ELISA). As amostras reativas serão retestadas em duplicata, e os resultados repetidamente positivos serão submetidos a testes confirmatórios (Western blot para HIV e HTLV. PCR para Hepatite C). Alem disso, será realizado exame físico em todos os internos, visando determinar suas condições de saúde. Conduta para os casos de infecção identificados: Todos os casos positivos serão referenciados para os diversos serviços especializados da rede pública, a exceção dos casos de sífilis, que serão tratados na própria instituição, de acordo com as recomendações do Ministério da Saúde. Os infectologistas envolvidos no projeto (Drs. Brites Sampaio. e Espinheira) de ampla experiência em pesquisa clinica, treinamento, assistência e prevenção das DSTs. Os pacientes com sorologia positiva para HTL serão encaminhados para o ambulatório de referencia do HUPES (coordenado pelo Dr. Carlos Brites). Os casos positivos para HIV serão atendidos no CREAIDS, sob a supervisão de Dra. Diana Sampaio e Ledivia e Espinheira. Os casos de infecção pelos vírus das Hepatites B e C serão encaminhados ao serviço de referência para estas infecções, também no HUPES. Os dados de prevalência para os diversos agentes serão encaminhado Divisão Epidemiológica da SESAB. Assim como a diretoria medica das instituições onde será conduzida a avaliação, para que embasar medidas e programas de controle e prevenção das DSTs nestes locais. A Coordenação de Apoio a Rede (CREAIDS) participara ativamente deste processo, no senti do de prover treinamento dos profissionais de saúde, e auxiliar no desenvolvimento de estratégias e na implantação destas medidas. A Coordenação de Apoio a Rede esta desenvolvendo projeto com vistas a treinamento de educadores e formação de monitores na própria população estudada, com vistas a implantação de um projeto de prevenção, através da educação, conhecimento do corpo e cuidados. Pessoal Envolvido: A coordenação geral do projeto, e do processo de avaliação dos adolescentes será realizada pela Dra. Margaret Fialho, pediatra do CREAIDS, e responsável pelo Núcleo de Atenção ao Adolescente, daquela instituição. Alem disso, participarão da avaliação a Dra. Diana Pedral Sampaio, infectologista do Hospital Universitário Professor Edgard Santos, da UFBA, e também Coordenadora de Assistência do CREAIDS. A Dra. Diana será responsável pela orientação clinica e referencia especializada aos internos que necessitarem cuidados médicos em infectologia. Os demais membros da equipe serão a Dra. Ledivia Espinheira, infectologista do CREAIDS, Dra. Márcia Messias., pediatra do OST/COAS. Psicóloga Márcia Schmalb, do CREAIDS, e a assistente social, foselice Menezes, da Coordenação de Apoio á Rede. Todos os profissionais participantes tem larga experiência em pesquisa, assistência e prevenção na área abordada pelo estudo. Esperamos envolver na avaliação as assistentes sociais da FUNDAC. assim como os médicos daquela instituição e supervisão dos aspectos jurídicos ficara a cargo da 2º Vara da Infância e da Juventude. A supervisão das etapas do processo de coleta e analise de dados finais a cargo do Dr. Carlos Brites, infectologista, e Coordenador de Apoio a Rede, do CREAlDS.

Concorrência: Estratégico

População Alvo: Crianças e Adolescentes vivendo/portadoras do HIV

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: FATORES DE RISCO PARA AIDS E INFECCAO PELO HIV EM MULHERES DE FORTALEZA - CE.
Coordenador: LIGIA REGINA FRANCO SANSIGOLO KERR
Resumo: A epidemia da aids e um grande problema de saúde publica no Brasil e embora venha apresentando uma certa estabilidade nos anos mais recentes, entre a população acima de 12 anos, observa-se o aumento do número de casos da categoria heterossexual, especialmente, nas mulheres. Estudar esta categoria em relação a seus aspectos comportamentais e de fundamental importância Jm3 elaborar estratégias de prevenção de forma mais adequada. Um estudo caso-controle entre mulheres soronegativas, soropositivas para o HIV e mulheres vivendo com aids será realizado em três instituições de Fortaleza-CE, a saber: O Hospital São José de Doenças infecciosas. O Hemocentro do Ceara (HEMOCE) e a Maternidade Escola Assis Chateaubriand (MEAC). Casos de aids e de sorologia positiva assintomáticos, que atendam as definições preconizadas pelo Ministério da Saúde, compõe os casos analisados separadamente, versus os controles, Após consentimento escrito, será aplicado um questionário semi-estruturado contendo perguntas referentes aos aspectos socioeconômico, comportamento sexual, uso de drogas, conhecimento sobre aids, entre outras. Além disso, será colhida uma amostra de sangue para realização do teste rápido para o HIV nas mulheres da MEAC e da Emergência do hospital São Jose de Doenças Infecciosas. A partir de um modelo hierarquizado de determinação da aids e da infecção pelo HIV, empregar-se-á uma analise multivariada hierarquizada onde cada bloco explicativo será analisado separadamente através de uma análise univariada. Em seguida serão analisados todos os blocos de forma descendente, ou seja, das várias explicativas mais distais para as mais proximais, até que todos os blocos sejam estudados de forma multivariada, utilizando apenas as variáveis significativas de cada bloco.

Objetivo: Geral: Conhecer os fatores de risco associados a Aids e a infecção pelo HIV em mulheres de Fortaleza-CE. Específicos: Identificar características sócio-demográficas, econômicas, associadas a Aids e a infecção pelo HIV em mulheres de Fortaleza-CE. Identificar a percepção de risco que essas diferentes categorias de mulheres em relação à transmissão do HIV/Aids. Identificar as características psicossociais associadas ao comportamento sexual dessas diferentes categorias de mulheres. Identificar concepções gênero associadas ao comportamento sexual dessas diferentes categorias de mulheres. Identificar consumo de drogas e de álcool das mulheres assim de suas parcerias que impliquem em maior risco de infecção pelo HIVI Aids.

Metodologia: Os casos serão abordados em duas circunstâncias diferentes, a saber: casos de aids confirmado clinicamente e casos HIV positivos.1) Será considerado um caso de aids toda mulher com 18 anos ou mais que atenda aos críticos da norma do Ministério da Saúde (1998), seguida no ambulatório do Hospital São Jose de Doenças Infecciosas (HSJDI) ou internada nas suas enfermarias, que concorde em participar e que esteja em condições físicas e psicológicas de responder a um questionário; 2) Será considerado um caso de mv toda mulher com exame de Elisa para HIV positivo, que atenda aos critérios do organograma exposto no Guia de Vigilância Epidemiol6gica (Ministério da Saúde, 2002), que concorde em participar da pesquisa e que for seguida no ambulatório do HSJDI; 3) Será considerado um controle toda mulher com 18 anos ou mais, com HIV negativo detectada no HEMOCE ou com teste rápido para HIV negativo (Determine) atendida na unidade de emergência do HSJDI ou no ambulatório da MEAC. Todas as participantes do grupo controle serão encaminhadas ao ambulatório de AIDS do HSJDI para receber o resultado do exame para HIV, através de senhas. As participantes também deverão assinar um Termo de Consentimento para responder o questionário e autorizar o exame para HI\V. Será garantido total sigilo das informações coletadas. Tamanho amostral: O tamanho amostral foi calculado considerando-se 1 caso de AIDS e 1 caso de HIV positivo para cada 2 controles. Utilizando-se como parâmetro uma confiança de 95%, poder do teste de 80% probabilidade de exposição do grupo controle de 40% para uma probabilidade do grupo de casos de 60% encontrando-se uma tamanho amostral de 80 casos de aids: 80 casos de HIV positivo e 160 controles.

Concorrência: Estratégico

População Alvo: Mulheres

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: IDENTIFICACAO DE POLIMORFISMOS EM EPITOPOS RELEVANTES PARA VACINAS CONTRA O HIV/AIDS EM INFECCOES INCIDENTES PELO VÍRUS DA IMUNODEFICIÊNCIA HUMANA TIPO 1.
Coordenador: ROSANGELA RODRIGUES
Resumo: A resposta imunológica a epitopos de um agente infeccioso e central no desenho de vacinas. Vírus com elevada diversidade podem evoluir rapidamente. A caracterização do HIV-1 durante a fase inicial da infecção é fundamental para a melhor compreensão das características do vírus incidente na população em estudo. Estas variantes virais incidentes são as responsáveis pela expansão da epidemia, e, portanto, importantes para estudos de desenvolvimento de uma vacina profilática. Este estudo propoe-se a analisar as características moleculares de vírus incidentes em três sítios clínicos da região metropolitana de São Paulo. Voluntários serão identificados e consultados sobre a participação no estudo nos serviços clínicos colaboradores; i)Pronto Socorro, CCA e Ambulatório de vulneráveis do Instituto de Infectologia Hospital Emilio Ribas; ii)Centro de Referencia de Sapopemba da Prefeitura Municipal de São Paulo e, iii)Pronto Socorro, COA e Ambulat6rio de HIV do Município de Itapecerica da Serra. O primeiro atende a população geral da área metropolitana, enquanto que o segundo e o terceiro em sua maioria servem a população local. O seguimento de pacientes nestes sítios clínicos, dentro da rotina estabelecida, associado à caracterização preliminar do HIV isolado de voluntários destes serviços, permitirá estudar alguns parâmetros da fase inicial da infecção. Nosso objetivo é determinar a prevalência, e a eventual evolução, de polimorfismos em regiões genomicas virais que codificam para epitopos utilizados em produtos vacinais candidatos existentes, assim como estimar a prevalência de modificações nas consideradas mais relevantes para a resposta imunológica. Alem de subsidiar o desenho de novos produtos vacinais, estas informações contribuem no entendimento da evolução molecular em epitopos, que pode indicar estruturas de maior relevância ao reconhecimento imunológico, e indicando sitos preferenciais de resposta eficaz contra o HIV. O estudo contribuirá secundariamente para a vigilância epidemiológica, para a compreensão da patogênese viral e para construção de linhas de base para futuros testes com microbicidas ou vacinas.

Objetivo: Geral: O objetivo deste projeto e analisar moleculamente isolados de pacientes com infecção recente pelo HIV para determinação de polimorfismos em epitopos virais para subsidiar o desenvolvimento de microbicidas e vacinas contra o HIV/AIDS. Específicos: Contribuir na vigilância epidemiológica do HIV-1 em serviços da região metropolitana e interior do Estado de São Paulo, com a caracterização do HIV em pacientes recentemente infectados, com vistas a compreensão dos eventos clínicos, virológicos e imunológicos associados à infecção, como parte da preparação para estudos de vacinas contra o HIV/Aids no Pais; Contribuir na construção de linhas de base para o estudo dos eventos associados à infecção recente pelo HIV, através da análise de parâmetros de indivíduos recentemente infectados na população geral ou participantes de ensaios com vacinas para HIV/AIDS, favorecendo o entendimento da história natural da Infecção Recente; Contribuir na monitorizarão da introdução e circulação de variantes virais resistentes aos anti-retrovirais em uso; Associar as características do HIV e seu padrão de evolução com os diferentes determinantes da transmissão sexual e parenteral da infecção; Analisar parâmetros imunológicos como a análise do número e das sub-populações de linfócitos TCD4+ / TCD8+ e o grau de ativação destas células; Obter isolados do HIV a partir de indivíduos soropositivos conversores recentes (isolados precoces) e em especial de isolados pre-imunes de indivíduos com evidencias de infecção aguda, porem sem evidencias de resposta imunológica pelo hospedeiro; Seqüenciar regiões do genoma viral com vistas à monitoração da evolução da diversidade genética de regiões do gene envelope, gag e polimerase; Determinação de mutações associadas à resistência aos ARV (polimerase) anterior a exposição de medicação e em falência terapêutica, estimando a prevalência de mutações associadas à resistência aos anti-retrovirais, visando contribuir no delineamento de opções terapêuticas mais adequadas a esta população, alem de avaliar a evolução da diversidade viral devido à pressão terapêutica; Determinar a presença de recombinantes e/ ou novos dados entre os isolados, e de contribuir na monitoração dos testes diagnósticos e de seguimento que podem ser alterados por esta diversidade; Dar suporte ao acompanhamento clínico de indivíduos soroconvertores, subsidiando o manejo clínico destes pacientes em suas unidades de saúde; Determinar as associações entre eventos virológicos e parâmetros clínico-Iaboratoriais associados à soroconversão recente e seu papel na modulação da evolução clínica destes indivíduos; Promover cooperação entre área técnica-Iaboratorial e serviços de atendimento clinico visando aprimoramento científico dos profissionais de saúde; Promover capacitação de profissionais de saúde através da integração e aprimoramento científico entre as Unidades participantes; Promover aprimoramento no conhecimento da bioinformática como instrumento de suporte as análises dos dados moleculares; Promover a sistematização de informações possibilitando a compatibilidade de dados e gerenciamento analítico.

Metodologia:

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: UMA NOVA VACINA ORAL CONTRA HIV-1 BASEADA NO ADENOVIRUS DE ORIGEM SIMIA.
Coordenador: AGUINALDO ROBERTO PINTO
Resumo: Vacinas baseadas em vetores adenovirais deletados da região El derivados de adenovirus humanos tem se mostrado bastante eficazes na indução de resposta imune humoral e celular contra o produto transgênico, incluindo-se antígenos de HIV-l. A maioria dos seres humanos são expostos aos sorotipos comuns de adenovirus humanos, incluindo o sorotipo 5, que e o vetor mais freqüentemente utilizado no estudo de vacinas ate o momento, primeiro durante a infância e então periodicamente depois disto. Anticorpos neutralizantes contra antígenos de superfície do adenovirus humano, principalmente contra as proteínas hexon, diminuem a resposta imune contra o produto transgênico quando se utiliza como vetores vacinais adenovirus de origem humana. Para evitar este problema, foi desenvolvido um vetor adenoviral recombinante alternativo baseado num sorotipo derivado de chimpanzé, denominado C6. Este sorotipo não circula em populações humanas e anticorpos contra sorotipos humanos de adenovirus não tem a capacidade de neutralizar C6. O vetor C6 recombinante, expressando a forma truncada de gag de HIV-l, codon-optimizada e rev-independente, induz forte resposta de células T CD8+ gag-especificas quando administrado em camundongos BALB/c através da via intramuscular. Se propõe aqui o estudo da resposta imune induzida por este vírus recombinante, denominado AdC6gag37, quando administrado pelas vias oral ou nasal. Estas rotas de imunização permitem o desenvolvimento de resposta imune específica contra o produto transgênico tanto no compartimento central quanta em sítios de mucosa periféricos. A presença de resposta imune que possa induzir proteção contra infecção pelo HIV -1 em sítios mucosos e de extrema importância, uma vez que esta e a principal porta de entrada do vírus no organismo humano nos dias de hoje.

Objetivo: Geral: Criar um grupo de pesquisa em vacinas anti-HIV na Universidade Federal de Santa Catarina, que permita o envolvimento desta instituição em eventuais ensaios clínicos nacionais de vacinas anti-HIV. Implementação de tecnologias que permitam no futuro o desenvolvimento de vacinas recombinantes utilizando cepas nacionais de HIV, vindo ao encontro das necessidades nacionais. Estimular o desenvolvimento científico e tecnológico da região sul do país, contribuindo desta forma para a diminuição das disparidades regionais. Dar continuidade à linha de pesquisa iniciada durante o pós-doutoramento do coordenador do projeto e desta maneira criar vínculos de colaboração entre a Universidade Federal de Santa Catarina e o Wistar Institute, Philadelphia, EUA, de tal maneira que permita o intercambio de tecnologias e visitas de pesquisadores entre a instituição americana e a UFSC. Específicos: Avaliar a imunogenicidade do vetor adenoviral de origem simia recombinante expressando o gene gag de HIV-l, denominado AdC6gag37, através da imunização por vias oral e intranasal em modelo murino. Avaliar o papel de populações celulares presentes em diferentes mucosas na imunidade por AdC6gag37. Avaliar a interferência da imunidade pre-existente contra adenovirus de origem humana sobre a possível utilização desta vacina por via oral ou intranasal. Avaliar a memória imunológica induzida por AdC6gag37.

Metodologia: Avaliação da eficácia da imunização oral e nasal com AdC6gag37. Como descrito na seção anterior, AdC6gag37 administrado i.m. foi capaz de induzir alta freqüência de células T CD8+ gag-especificas em camundongos BALB/c. A resposta imune induzida por AdC6gag37 através da imunização oral e nasal será avaliada neste projeto. Para isto serão realizados ensaios de dose-resposta e cinética para se determinar qual a melhor dose de vacina a ser utilizada nestas vias de imunização, bem como quando se atinge o pico da resposta imune apos a imunização. Para tanto, grupos de 5 camundongos BALB/c serão imunizados oralmente ou intranasalmente com diferentes doses de AdC6gag37 (104, 105, 106, 107 e 108 ufp/camundongo). Diferentes dias ap6s a imunização (3, 5, 7, 10, 14 e 21 dias) os camundongos serão sacrificados e a freqüência esplênica de células T CD8+ especificas para gag será determinada através da marcação intracelular de INF-y em cédulas T CD8+ cultivadas por 5 horas com 1 ~g/ml do peptídeo AMQMLKETI em presença de Brefeldina A. As células serão avaliadas por citometria de fluxo, utilizando-se anticorpos monoclonais anti-CD8-FITC e anti-INF-y-PE. Avaliação do papel de populações celulares de diferentes regiões apos imunização oral e nasal com AdC6gag37. Uma vez conhecida a dose ótima, bem como o pico da resposta imune induzida por AdC6gag37 através da imunização por via oral e nasal, o papel de células de diferentes regiões associados a mucosas será avaliado. Grupos de 5 camundongos BALB/c serão imunizados oralmente ou intranasal mente com a dose ótima de AdC6gag37 e a resposta gag-específica será determinada em linfonodos mesentéricos, Placas de Peyer, populações de linfócitos intraepiteliais, baço, sangue e lavado peritoneal. Foram escolhidos as populações celulares destas regi5es por estarem intimamente associadas, ou fazerem parte, de tecidos linf6ides de mucosas. A resposta imune nestas populações celulares será avaliada através de diferentes ensaios, que serão previamente padronizados. Dentre estes ensaios, incluem-se: ELI SPOT, marcação intracelular de INF-y e o usa de tetrâmeros. Os ensaios de ELI SPOT serão realizados para se quantificar as células produtoras de INF-y. As células serão adicionadas em placas em 96 cavidades revestidas por anticorpos anti-INFy. Estas células serão estimuladas por 24 horas a 37°C com 1 ug/ml de AMQMLKETI. Cavidades controles conterão células não-estimuladas. Após esta incubação as células serão incubadas com um anticorpo anti-INF-y conjugado com peroxidase, determinando-se desta maneira o número de células T produtoras de INF-y. Também serão realizados ensaios com 0 usa de tetrâmeros. Um tetrâmero contendo AMQMLKETI, conjugado com PE foi preparado pelo AIDS Research and Reference Reagent Program, NIH, MD. Os linfócitos isolados serão incubados por 30 minutos a 4 °C com anticorpo anti-CD8-FITC e o tetrâmero e feita a análise por citometria de fluxo. A marcação intracelular de INF -y será feita como descrito anteriormente. Através do usa destas metodologias, serão identificadas quais as populações celulares estão envolvidas na indução da resposta imune gag-especifica quando utilizando vias de imunização que tem por objetivos a indução de imunidade de mucosas. Avaliação de memória imunológica induzida pela imunização com AdC6gag37 e o efeito da interferência da imunidade pre-existente contra adenovirus humanos. A resposta imune gag-especifica induzida por AdC6gag37 será avaliada após 2 semanas a imunização e em intervalos regulares de um mês, totalizando um ano após a imunização, com o objetivo de se determinar se a resposta imune induzida por AdC6gag37 através das vias intranasal ou oral e duradoura, requisito essencial em qualquer vacina. Esta avaliação imunológica será feito através da marcação intracelular de INF-y, como descrito anteriormente. Também será avaliada a interferência devida a anticorpos neutralizantes contra AdHu5, semelhante ao que foi descrito na serão de resultados preliminares. Camundongos BALB/c serão imunizados i.n. com AdHu5 selvagem. Esta via mimetiza a rota de aquisição natural de adenovirus. Após duas semanas, estes mesmos animais serão imunizados i.n. ou oralmente e duas semanas mais tarde a resposta imune gag-especifica será avaliada através de marcação intracelular de INF-y. Embora esta abordagem já tenha sido realizada quando da administração desta vacina por via i.m., acreditamos ser importante repetir tal ensaio, uma vez que estamos avaliando diferentes vias de imunização neste projeto.

Concorrência: Concorrência Sítio de Vacinas

População Alvo: População em Geral

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: VULNERABILIDADE A INFECCAO PELO VIRUS HIV NAS GESTANTES NO MUNICIPIO DE SAO JOSE DO RIO PRETO.
Coordenador: MARIA SILVIA DE MORAES
Resumo: As mulheres tem se caracterizado como um grupo populacional de alta vulnerabilidade a AIDS no mundo inteiro, o mesmo ocorrendo no Brasil e, em particular, em São Jose do Rio Preto. Tal situação ao reflete a necessidade de compreender aspectos comportamentais e de práticas sexuais das mulheres para que estratégias de intervenção possam ser propostas. Este estudo busca apreender a situação de vulnerabilidade das mulheres gestantes do município de São Jose do Rio Preto e identificar a prevalência do HIV nesse segmento da população para contribuir no desenvolvimento de novos estudos e na proposição de estratégias de intervenção tanto para a prevenção como para o controle.

Objetivo: Geral: o presente estudo tem como objetivo caracterizar gestantes que residem no município de São Jose do Rio Preto. Específicos: Estimar a prevalência da infecção pelo HIV na população gestante; caracterizar os fatores socio-demográficos e de comportamento; caracterizar, nesta população, o nível de informação relativo a infecção pelo HIV; caracterizar práticas e comportamentos de maior risco, os quais as tomam mais vulneráveis a infecção pelo HIV; comparar nas diferentes faixas etária no grupo estudado, as práticas e comportamentos de maior risco, os quais as tomam mais vulneráveis a infecção pelo HIV; detectar se houve ou não a intervenção oportuna dos serviços de saúde na redução da vulnerabilidade desta população à infecçao ao HIV.

Metodologia: É proposto um desenho de pesquisa não experimental transversal, baseado em entrevistas quantitativa, com questionários estruturado, aplicados as gestantes estudadas, realizadas por entrevistadores previamente treinados e supervisionados pelos pesquisadores responsáveis pelo estudo. As variáveis pesquisadas permitirão identificar o perfil sócio econômico, comportamentos de maior risco para a infecçao pelo HIV, práticas sexuais e alguns aspectos do cuidado recebido nos serviços de saúde. Critérios de inclusão: serão incluídas na pesquisa as gestantes residentes no município de São Jose do Rio Preto no período de maio de 2003 a abril de 2004.

Concorrência: Concorrência Sítio de Vacinas

População Alvo: Mulher - Criança (TV)

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: ESTUDO DE CARACTERIZACAO SOCIO- COMPORTAMENTAL JO CTA DE RIBEIRAO PRETO COMO INICIATIVA DE PREPARAC
Coordenador: DARIO HENRIQUE TEOFILO SCHEZZI
Resumo:

Objetivo:

Metodologia:

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: AVALIACAO E CORRELACAO DAS DOENCAS PARASITARIAS E INFECTO-CONTAGIOSAS COM AIDS/DST EM UMA POPULACAO DE MORADORES E/OU SITUAÇÃO DE RUA EM GOIÂNIA - GOIÁS.
Coordenador: CLECILDO BARRETO BEZERRA
Resumo: A pandemia HIV tem características próprias principalmente relacionadas ao comportamento social-cultural das populações atingidas, 18 milhões de adultos e 1,5 mil são de crianças estão infectadas pelo HIV atualmente. No Brasil a epidemia da AIDS tem apresentado uma enorme variação no perfil da população atingida, abrangendo grupos e formas de infecção bastante heterogênea, além do HIV possuir caráter facilitador na transmissão para infecções sexualmente ·transmissíveis e oportunistas. Em 2000 foram notificados a Secretaria do Estado da Saúde de Goiás, 3359 novos casos de HIV, sendo que 65% destes se originam de contaminação por relação sexual.

Objetivo: Geral: Estimativa da prevalência do HIV/DST em um grupo de 500 indivíduos moradores de rua e/ou em situação de rua com as principais doenças infecto-contagiosas e parasitoses oportunistas. Específicos: Caracterizar práticas de risco para infecçao HIV/DST frente à triagem socio-comportamental do grupo, estimando-se 0 risco da população alvo descrita; Diagnosticar a principais doenças parasitárias e infecto-contagiosas (HIV/DST, toxoplasmose, hepatite e tuberculose, parasitoses entéricas oportunistas) desta população; Assegurar 0 diagnóstico laboratorial com padronização e qualidade; Fornecer parâmetros para políticas públicas de saúde, através do estudo socio-comportamental, com base nas cadeias de transmissão e comportamento de risco; Buscar, através de encaminhamento, a inclusão social da população alvo, em programas de assistência.

Metodologia: A triagem dos participantes deste projeto serão realizadas pelas assistentes social da FUMDEC/Prefeitura Municipal de Goiânia, após abordagem que será realizada na rua e/ou na casa Ser Cidadão através do atendimento dos indivíduos que procuram espontaneamente a casa. A entrevista será realizada com enfoque nos dados sócio-comportamental. Após o esclarecimento dos objetivos do projeto os indivíduos serão direcionados ao Lab. Profa. M. Dobler Komma para Coleta do material biológico. Serão coletados de todos os indivíduos amostras de sangue, fezes, escarro e secreção urogenital para análise. As amostras do material biológico será realizada no Laboratório Profa. M. Dobler Komma-IPTSP/UFG. O sangue será coletado e submetido a centrifugação, o plasma retirado e aliquotado para ser subrnetido as reações imunológicas pertinentes: Teste Imunoenzimático (ELlSA) para HIV Teste Imunoenzimático (ELISA) para Hepatite B e C (HBs-Ag: HCV-Ag) lmunofluorescência Indireta (FTA-.AJ3S) para Sífilis (IgM e IgG) lmunofluorescência Indireta (IFI) para Toxoplasmose (lgM e IgG) As secreções do trata genito-urinário e o escarro serão coletados com suab estéril e/ou em frascos apropriados para realização da pesquisa de trichomoniase e do bacilo da tuberculose através de: Baciloscopia - coloração especial para identificação de bacilos álcool-ácido-resistente (BAAR) Coloração especial em esfregaços fixados corados pelos corantes de Leishman e/ou Giensa para identificação do Trichomonas vaginalis. Para levantamento de prevalência dos parasitos entéricos oportunistas (Cryptosporidium sp: Isospora sp: Cyelspora sp: Microsporídeos) serão coletadas três amostras de fezes que serão submetidas a análise através dos exames: Exame parasitológico das fezes pelos métodos dc Hoffman. Baermann e Faust. Colorações especiais pelo método de Kinyoun modificado. Colorações especiais pelo método de Ziehl Neelsen modificado. Os resultados obtidos serão tabulados e digitados em um banco de dados utilizando um programa epidemiológico (EPI-Info) para correlação dos dados e resultados obtidos.

Concorrência: Concorrência Sítio de Vacinas

População Alvo: População de moradores de rua (adultos)

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: MANIPULACAO GENETICA DA PROTEINA DE MATRIZ (GAG P17) DO HIV-1: UMA NOVA ROTA PARA A GERACAO DE ANTIG
Coordenador: Rodrigo de Moraes Brindeiro
Resumo: Estudos sobre indivíduos infectados pelo HIV e não-progressores de longo tempo (LTNPs) têm contribuido para o entendimento da imunidade protetora inata existindo para a infecção pelo HIV. Fatores anti-virais solúveis tem papel importante na não progressão da infecção. A atividade CAF, por exemplo, correlaciona-se com o estagiamento da doença, e foi descrita como uma resposta anti-viral solúvel derivadas de células T CD8+ não -citolíticas, sendo mais potentes em LTNPs se comparada aos progressores normais. Mais intrigantes são os achados de poliformismos na proteína da matriz viral p17 relacionadas aos LTNPs com diferenças significantes nas sequências de aminoácidos entre isolados virais de progressores normais e não- progressores. Nossa hipótese principal baseada no quanto estas substituições secundárias da sequência da p17 são capazes de desestabilizar ou enfraquecer a capacidade de montagem/acoplamento da protéina, ainda mantendo uma competência replicativa viral, com a capacidade de desencadear a atividade protetora CAF pela apresentação profissional ás células CD8+ pelo HLA-I das células APC dendríticas (DCs), considerando a vantagem da baixa capacidade destes variantes polimórficos da p17 em manter os epítopos ocultos através da ligação á membrana ou pela montagem da matriz. O objetivo deste trabalho é a avaliação do papel dos variantes da p17 encontrados em LTNPs na ativação de CAF e das atividades protetoras CTL nas diferentes sub-populações de células T CD8+. Estes clones em DNA carreando as mutações em p17 serão transfectados para células DCs para apresentação subsequente a células CD8+ autólogas. Serão testadas a atividade CTL induzida, a proliferação de células CD8+, a apresentação por ensaio de tetrâmero, a produção de IFN-y por células CD8+ em ensaio ELISPOT, tudo isto no intuito de caracterizar a resposta celular específica à proteina mutante. Ainda mais importante, um ensaio de atividade CAF será estabelecido a fim de avaliar o envolvimento dos epítopos gerados na ativação desta resposta nos linfócitos T CD8+ e como novo marcador imunológico para avaliação dos candidatos vacinais contra o HIV.

Objetivo: Para testar nossa hipótese, nós propomos exucutar mutações sítio-dirigidas no clone molecular de uma sequência prototípica de cDNA da p17. Estas mutações serão criadas com o intuíto de reproduzir os resíduos polimórficos normalmente encontrados na p17 dos isolados virais de LTNPs, bem como outros baseados nas sequências polimórficas do SIVagm. Estes clones moleculares serão também modificados para comportar-se geneticamente como genes funcionais isolados (com códons de início e fim da tradução) antes de serem sub-clonados em plasmídeo de expressão eucariótica (pVAX), já aprovado pelo FDA ("Food and Drug Administration" - USA) para uso como vetor vacinal de DNA. As sequências mutadas também serão inseridas em clone genômico de um cDNA "full length" do HIV (pNL4-3). Estes clones em DNA carreando as mutações em p17 serão transfectados - alternativamente usando seus transcritos em mRNA expressos em vitro- para células DCs derivadas a partir de cultura primária de monócitos de sangue periférico (PBMC) para apresentação subsequente a células CD8+ autólogas. Como controle, serão transfectados clones pVAX e pNL4-3 carreando a sequência original de p17, sem nenhuma modificação. Serão testadas a atividade CLT induzida, a proliferação de células CD8+, a apresentação por ensaio de tetrâmico, a produção de IFN-y por células CD8+ em ensaio ELISPOT, tudo isto no intuíto de caracterizar a resposta celular específica á proteina mutante. Ainda mais importante , um ensaio de atividade CAF será estabelecido a fim de avaliiar o envolvimento dos epítopos gerados na ativação desta resposta nos linfócitos T CD8+. O rationale deste trabalho é a avaliação do papel dos variantes da p17 encontrados em LTNPs na ativação de CAF e das atividades protetoras CTL nas diferentes sub-populações de células T CD8+. O estabelecimento de um ensaio de atividade CAF servirá como um novo marcador substituto para a seleção eficiente de variantes da p17 e de outras proteínas virais como candidatos a epítopos vacinais em estudos de fase pré-clínica e fase I de desenvolvimento. De fato, esta tentativa de expor os epítopos ocultos através de variantes da p17 traz á luz um novo modelo de mutagênese de peptídeos imunogênicos naturais para aumentar a eficiência de apresentação antígena e, através disto, a resposta imune específica. Em paralelo, acreditamos que o uso de um ensaio CAF como novo marcador imunológico para avaliação de candidatos vacinais contra HIV será, no futuro próximo, de grande importância para a compreensão da capacidade de resposta celular contra a infecção pelo HIV, conjuntamente com os ensaios já estabelecidos de atividade CTL, antígeno complexado a tetrâmetro apresentador e ELISPOT.

Metodologia: Descrição detalhada, incluindo processo de amostragem e tamanho da amostra Plasmídeos; Oligonucleotídeos iniciadores a serem utilizados; Preparação de plasmídios, mutagênese sítio-dirigida e sequenciamento; Amplificação e clonagem da região codificadora da proteína gag-p17; Contrução de um gene de p17 mutado, contendo polimorfismos identificados em isolados virais de pacientes LTNPs; Construção do clone pNL4-3 com o gene de matriz p17 mutado; Reversão das sequências inibitórias (INS) da proteína p17 de matriz; Clonagem de gap-pro (Pr55gag) e reversão das sequencias INS na proteína p24 de capsídeo; Clonagem de p17 em vetor para humano de expressão transiente (vacinal) pVAX1; Clonagem da Pr55gap em vetor para humano de expressão transiente (vacinal) pVAX1.

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: DESENVOLVIMENTO TECNOLÓGICO

Subnatureza: BÁSICA OU FUNDAMENTAL

Produção Científica


Projeto: ASPECTOS EPIDEMIOLOGICOS E SOCIO-COMPORTAMENTAIS DE PESSOAS QUE CONVIVEM COM HIV/AIDS: FATORES RELAC
Coordenador: BETINA HORNER SCHLINDWEIN MEIRELES
Resumo: Objetivo Geral Determinar os aspectos epidemiológicos e sócio- comportamentais de pessoas que convivem com HIV/Aids, atendidas em um Centro de Referência para tratamento de AIDS do estado de Santa Catarina, com ênfase aos fatores relacionados á transmissão do HIV no núcleo familiar. Objetivos Específicos Caracterizar o perfil epidemiológico dos portadores de HIV/Aids atendidos nos serviços de ambulatório, hospital-dia e unidades de internação; Identificar na população estudada, os núcleos familiares com mais de um portador do HIV/Aids entre os seus membros; Caracterizar os modos de transmissão do HIV nos núcleos familiares identificados; Definir/identificar os fatores que interferem na vulnerabilidade à infecção pelo HIV nos indivíduos soropositivos que compõem estes núcleos; Relevância do Estudo A pesquisa justifica-se por se tratar de abordagem inovadora, com poucos estudos no Brasil e no mundo. Sua relevância firma-se no fato de que o estudo aconteceu entre clientes de um Centro de Referência em HIV/AIDS para o estado de Santa Catarina, onde os coeficientes de incidência da infecção mantêm-se altos em todos esses anos de epidemia, evidenciando baixa responsividade às medidas de prevenção até então instituídas. Alguns fatores relacionados a vulnerabiliadade à infecção pelo HIV já estão claramente determinados, entretanto, poucos são os estudos voltados à vulnerabilidade em família. Vivenciamos, hoje, o que já era esperado em termos de progressão da epidemia, ou seja, para cada família pelo menos um ente ou conhecido que seja portador do HIV. Pela investigação dos fatores predisponentes à infecção do HIV na família, pode-se traçar um perfil sócio-comportamental dos que convivem com o HIV/AIDS, observa-se o impacto imprimido à vivência famiiar, e o perfil epidemiológico atual no estado. Os estudos relacionados a aids junto às famílias deve ser enfatizado, pois os relatos demonstrando a incidência de diversos casos de infecção pelo HIV num mesmo núcleo familiar são preocupantes até porque a mudança do perfil epidemiológico nos mostra a necessidade de maiores investimentos na prevenção em grupos sociais como mulheres, jovens e nos casais estáveis, que, de certa forma, abrangem o íntimo da família (MEIRELLES, 2003). Sintese do Estado da Arte Desde o início da epidemia de Aids no Brasil, o estado de Santa Catarina vem despontando com várias de suas cidades nos primeiros lugares do lamentável ranking de incidência da doença. A cidade portuária de Itajaí há vários anos mantém-se em 1º lugar no ranking nacional (BRASIL, 2003). Múltiplos são os fatores que configuram a epidemia no estado, ressaltando-se, dentre eles, o uso de drogas intravenosas. Sendo assim, grande é o número de portadores do HIV/Aids cujo modo de transmissão deu-se através do compartimento de seringas e agulhas contaminadas, entre usuários de drogas injetáveis. Aliado a este fator está a transmissão viral desses indivíduos às sua parceiras sexuais, aumentando enormemente a incidência no gênero feminino e configurando, com isso, a feminização da epidemia através da transmissão sexual/heterossexual. O aumento de casos entre mulheres era uma das tendências do curso da epidemia para o Brasil e o mundo, entretanto, Santa Catarina, vem apresentando um perfil alarmante. Pesquisas em andamento vêm apontando para uma outra pecularidade de epidemia no estado - o perfil virológico. Sabe-se que no estado de Santa Catarina é a maior a prevalência do subtipo C do HIV-1, igual ao perfil encontrado na África do Sul e Índia, e diferente do subtipo encontrado nos outros estados do Brasil - subtipo B. Atribui-se a esse sub-tipo viral, maiores taxas de morbi-mortalidade, e o que pode ser uma das explicações sobre a tendência da epidemia no estado. Questões relacionadas aos modos de transmissão de HIV, bem como as questões sócio-comportamentais pareciam ter-se esgotado no final dos anos 90, entretanto, após mais de 20 anos de epidemia, uma nova geração vem se formando e, com ela, novos valores e hábitos. Assim, é enfocada a necessidade de atingir o contexto familiar, com propostas de ações de prevenção neste sentido, buscando atingir os vários sujeitos do núcleo familiar, seja pai e a mãe no setor produtivo, a criança e o adolescente na escola, entrando na discussão na cultura familiar (MEIRELLES, 2003). Guerriero et al (2002) alertam que estudos voltados para o conhecimento de concepções acerca da masculinidade também são importantes para apontar caminhos mais efetivos para a prevenção. Citam, como exemplo, o fato que homens que se sentem provedores da família podem levar consigo o sentimento de preservação, constituindo um aspecto favorável à diminuição da vulnerabilidade de sua infecção e, consequentemente de sua parceira e filhos. A questão da fidelidade conjugal, como embargo a medidas de prevenção a transmissão sexual entre parceiros fixos, também é outro fator que aumenta não só a vulnerabilidade de mulheres e homens, como também da família (SILVA, 2002). Além da vulnerabilidade para a infecção pelo HIV em âmbito familiar, é importante se obter conhecimento sobre o impacto sócio-econômico imprimindo a famílias, nas quais convivem um ou mais portadores do HIV/Aids. As condutas, bem como as relações entre pessoas que convivem em núcleos familiares com o HIV inserido entre elas, são fatores também a ser melhor estudados. Segundo Castro et al (1997), muito dos conflitos familiares pré-existentes de forma latente, convertem-se em fatores detonantes, durante o processo de enfermidade, agudizando, de forma ainda mais significativa nas fases mais críticas do processo mórbido. Questões relacionadas à sexualidade não poderiam estar alheias à relação existente entre pessoas que convivem com o HIV/Aids no âmbito familiar, por se tratar de uma doença sexualmente transmissível, dente outras formas de transmissibilidade. Temas como preferências sexuais, infedelidade conjugal e culpa, fazem parte do cotidiano dessas pessoas. Ainda, segundo os referidos autores, quando o HIV afeta um casal, esta situação constitui-se no detonador de crise conjugal, quando ambos recriminam mutuamente suas atitudes passadas e, portanto, seu grau de responsabilidade no acontecimento. O ambiente onde se insere a família ( em seus diversos conceitos), não raramente também pode ser considerado ambiente propício ao cuidado para seus integrantes durante o processo de adoecimento. Entretanto, nem todas as famílias dispõem de condições físicas, financeiras, técnicas e/ou psicológicas para este tipo de atividade. Há as que dispõem de toda uma infra-estrutura, porém seus integrantes não demonstram vaontade para que o processo cuidativo ocorra. Muitos são os estudos que correlacionam o ato de cuidar ao gênero feminino. Daher (1998) salienta que em sociedades ocidentais modernas, a mulher foi adestrada, desde a infância, a desenvolver papéis e atitudes tradicionalmente conehcidos como femininos e, dentre estas ações, estão as referentes ao cuidado. Gonzafa e Arruda (1998) encontram a figura materna como responsável por 80% dos acompanhamentos de filhos em internações hospitalares. Chrisman (apud HELMAN, 1994) refere que a família é a sede primeira de assistência à saúde em qualquer sociedade, sendo que os principais responsáveis por assistência são as mulheres, geralmente mães e avós. A feminização da epidemia pode vir a mudar este perfil, no qual mulheres, comumente relacionadas à função de cuidar, estão deixando de fazê-lo, por estarem elas próprias adoecendo, graças à sua maior vulnerabiliadade. Ainda, com relação ao cuidado de pessoas com HIV/Aids no âmbito familiar, observa-se maior facilidade para o ato de cuidar quando o modo de transmissão não "feriu" os preceitos de fidelidade conjugal. Não obstante, deparamo-nos, também, com situações inversas, principalmente entre mulheres, as quais foram contaminadas por seus parceiros conjugais por ocasiões de infidelidade, mas que sentem prazer em cuidar de seus parceiros adoecidos. Diante de tanta diversidade de reações humanas com relação à problemática, é que se evidencia a necessidade de aprofundamento do tema "AIDS em família". Em sua pesquisa, Meirelles (2003) identificou que o trabalho inadequado a respeito do risco e da vulnerabilidade junto às famílias tem levado à disseminação do HIV entre seus membros, fato que foi lembrado pelos entrevistados, mas que não pode ser visualizado nas estatísticas oficiais, onde aparecem como mais um caso. A questão do trabalho com a família envolve desde a prevenção primária a fim de evitar que algum membro se contamine, até a prevenção secundária e terciária. Nas famílias que têm algum membro contaminado, devemos trabalhar a prevenção junto aos parceiiros, as formas de se cuidar, os sofrimentos, os sentimentos de aceitação, as perdas e todas as questões que envolvem conviver com HIV/Aids. Tivemos, como proposta inicial, a identificação de famílias com mais de um portador do HIV/Aids, no meio estudado, a fim de traçarmos um perfil sócio-comportamental e epidemiológico dessas famílias, caracterizando os modos de transmissão e identificando fatores de vulnerabilidade intra-familiares, que possam contribuir nestes trabalhos de prevenção.

Objetivo: Determinar os aspectos epidemiológicos e sócio-comportamentais de pessoas que convivem com HIV/AIDS atendidas em um Centro de Referência para tratamento de AIDS do estado de Santa Catarina, com ênfase aos fatores relacionados á transmissão do HIV no núcleo familiar.

Metodologia: Trata-se de um estudo epidemiológico e sócio-comportamental, de abordagem quanti-qualitativa. A pesquisa foi realizada no período de maio de 2004 a julho de 2005, em um Centro de Referência para tratamento de Aids da região da Grande Florianópolis, no estado de Santa Catarina, nos serviços de Ambulatório, Hospital - Dia e Internação. O estudo teve como população-alvo os portadores de HIV/Aids atendidos no Centro de Referência estadual para o tratamento, o Hospital Nereu Ramos, em seus serviços: ambulatorial, de hospital - dia e unidades de internação, durante o período de coleta de dados. A coleta de dados ocorreu no período de agosto a dezembro de 2004. Os dados foram coletados por meio de questionários auto-aplicáveis, previamente testados em uma amosytra aleatória, com o objetivo de conseguir maior indededignidade ás respostas dos entrevistados. Foi avaliado o nível de alfabetização e compreensão dos indivíduos, porém na maioria dos casos o questionário foi aplicado pelos pesquisadores, considerando também a realização de questões abertas na discussão do tema. Na etapa inicial do estudo foi elaborado o instrumento de pesquisa, à luz de extensão revisão bibliográfica, seguida de treinamento de duas estagiárias (acadêmicas de enfermagem) na aplicação do mesmo. Posteriormente foi realizado um estudo-piloto com o intuito de avaliar a aplicabilidade do instrumento e sua abrangência. Após a realização do estudo-piloto e adequação do instrumento de pesquisa, elaborou-se um banco de dados com o auxílio do software Epidata. Foram avaliados consequentemente 197 sujeitos, com relação ás seguintes variáveis: registro hospitalar, gênero, idade, naturalidade, procedência, estado, bairro, grau de instrução, profissão, renda familiar, estado civil, cor, religião, ano de diagnóstico do HIV, comportamento de risco, comportamento sexual, uso de drogas injetáveis, existência de outros familiares com HIV e compreensão da forma de contaminação dos mesmos. Os dados foram sumarizados como percentagem ou média, conforme indicado e a análise estatística descritiva foi realizada com o auxílio do software Epiinfo. As questões abertas foram analisadas posteriormente através da análise de conteúdo segundo Bardin (1995), com discussão a partir das categorias temáticas. Ao iniciar a coleta de dados, os objetivos da pesquisa foram apresentados, no sentido de que os sujeitos pudessem decidir pela participação ou não na pesquisa. Em caso afirmativo, foi solicitado o consentimento livre e esclarecido dos participantes e garantindo o anonimato e o sigilo dos dados. O projeto foi submetido e aprovado pela Comissão de Etica do referido Serviço. Por se tratar de pesquisa realizada em um Centro de Referência, e, portanto com o atendimento de um número significativo de pacientes, a amostra torna-se fidedigna do universo desta população, bem como estará representada por sub-segmentos populacionais tais como usuários de drogas intra-venosas, trabalhadores do sexo, gestantes e comunidade em geral. Os questionários auto-aplicáveis, quando assim realizados, também diminuiram os vieses de informação tão frequentes neste tipo de estudo.

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: COMPORTAMENTAL

Produção Científica


Projeto: VIGILANCIA DE INFECCAO RECENTE PELO HIV NO INSTITUTO DE INFECTOLOGIA EMILIO RIBAS
Coordenador: JOSE ANGELO LAULETTA LINDOSO
Resumo: Objetivo Geral: O objetivo geral deste projeto foi de prestar assistência diferenciada e multidisciplinar ás pessoas que por qualquer razão apresentassem um maior risco de infecção/adoecimento pelo vírus da imunodeficiência humana(HIV), com realização sempre que possível de diagnóstico precoce e orientação continuada para prevenção. Objetivos Específicos: a) Acompanhamento sorológico de pares discordantes e profissionais do sexo; b) Distribuição de material educativo institucional (folders e cartilhas); c) Distribuição de preservativos com orientação para o uso correto; d) Profilaxia pós-exposição sempre que indicada para o HIV, o virus da Hepatite B (HBV) e outras DSTs; e) Monitoramento Laboratorial de pessoas com evidências de infecção aguda pelo HIV (através da realização de quantificação de viremia plasmática, contagem de linfócitos CD4 e Genotipagem para o HIV-1), com propósito de avaliar a indicação de terapia anti-retroviral (HAART). Relevância do Estudo: A relevância desta pesquisa está essencialmente vinculada á possibilidade do grupo multidisciplinar de trabalho na área de vulnerabilidade ao HIV poder fornecer aos individuos que procuram sua assistência individualizada uma prática de pensar e agir em termos coletivos e preventivos. com implantação de estratégias e ações de intervenção mais abertas e dinâmicas que sejam adequadas e específicos estilos de vida. Além disto, os dados oriundos deste estudo podem contribuir com informações relevantes para estudos com vacinas. Sintese do Estado da Arte: A testagem para o HIV é um procedimento para o diagnóstico ou exclusão da infecção pelo vírus HIV baseado na detecção de anticorpos HIV-específicos e/ou proteínas virais específicas e/ou RNA/DNA viral em um indivíduo, usualmente de uma mostra de sangue. Os objetivos primários da testagem para o HIV em ambulatórios de DST/Aids são os seguintes: a) fornecer aconselhamento pré e pós-teste para indivíduos HIV-negativos em risco de transmissão da infecção pelo HIV; b) Reduzir a transmissão do HIV e outras DSTs para outros indivíduos após diagnóstico da infecção pelo HIV; c) Identificar indivíduos com infecção pelo HIV o mais rápido possível e encaminhá-los imediatamente para o seguimento clinico; d) Iniciar a notificação do (a) parceiro (a) com aconselhamento, testagem e encaminhamento para ambulatórios de pares discordantes. O conceito de vulnerabilidade em HIV/Aids foi introduzido no final da década de 1980, referindo-se ao risco de adquirir a infecção pelo vírus HIV, estando este risco vinculado ás estruturas sociais, políticas de saúde e conduta individual. A avaliação da vulnerabilidade tem o objetivo de aos indivíduos subsídios para a construção de um planejamento de ações preventivas junto ao profissional que o assiste. Estas ações preventivas devem ser norteadas por indicadores precisos e previamente determinados, tais como perfil socioeconômico e cultural dos grupos mais acometidos, como também por suas práticas sexuais e uso de preservativos. Os pares discordantes têm merecido uma atenção especial em ambulatórios de vulnerabilidade, tendo em vista que há uma perda significativa no acompanhamento rotineiro destas pessoas. O atendimento específico e particularizado destes casais que buscam a testagem sorológica para o HIV é fundamental, principalmente para aqueles que convivem há muitos anos, com testes periódicos apresentado resultados negativos. A infecção aguda pelo HIV está presente em 40-90% dos casos como uma doença sintomática transitória que dura semanas ou poucos meses, associada com altos níveis de replicação do HIV e uma resposta imune virus-específica. O diagnóstico precoce da infecção aguda pelo HIV tem importantes implicações clínicas, tendo em vista que vários autores apontam para os benefícios da terapia anti-retroviral na infecção aguda, quando a carga viral atinge seus níveis mais elevados, a imunossupressão pode ser severa e a taxa de infecção entre parceiros sexuais pode ser prevenida. Indivíduos que apresentam um risco maior de infecção pelo virus HIV devem ter prioridade na testagem ( principalmente em locais com resursos assistenciais limitados) - embora esta deva ser oferecida a todos os indivíduos que procuram avaliação e tratamento em serviços de DSTs. Se por um lado indivíduos diagnosticados com infecção pelo HIV parecem reduzir sua atividade sexual desprotegida com parceiros não-infectados, por outro podem aumentar atividade sexual desprotegida com parceiros soropositivos ocasionais, tendo em vista que o principal incentivo para o uso do preservativo não existe mais, ou seja, a prevenção da infecção pelo HIV. Dentre os indivíduos que apresentam maior vulnerabilidade é infecção pelo HIV podemos citar: Aqueles que acreditam fortemente numa determinada exposição ao vírus; Indivíduos com sintomas de sindrome retroviral aguda ou imunossupressão; Pessoas com prática de sexo não-seguro (múltiplos parceiros ou sexo anal/vaginal não protegido); Histórico atual ou passado de DSTs; Pessoas vítimas de violência sexual; Indivíduos com contato sexual conhecido com pacientes HIV-Positivos; Usuários de drogas injetáveis que compartilham agulhas ou seringas; Pessoas com exposição sexual em países de alta prevalência da infecção pelo HIV; Indivíduos que tenham recebido transfusão de sangue ou hemoderivados antes ds introdução da rotina de screening do HIV; Qualquer gestante, independente dos fatores de risco. A frequência da testagem deve ser ajustada a história de cada indivíduo, mas usualmente não deve exceder três a quatro vezes ao ano. Testes de screening de HIV de 4ª geração (ELISA), que testam simultaneamente anticorpos anti-HIV-1 e antígeno p-24, também testam anticorpos anti-HIV 2. Estes testes disponíveis na Europa e nos EUA tem excelente sensibilidade (99.78% - 100%) e especificidade (99.5% - 99.93%). Se o teste de screening de 4ª geração é positivo mas o teste de screening de 3ª geração e/ou teste confirmatório (western-blott/imunofluorescência indireta é negativo, então uma alta possibilidade de soroconversão existe.

Objetivo: O objetivo geral deste projeto foi de prestar assistência diferenciada e multidisciplinar ás pessoas que por qualquer razão apresentassem um maior risco de infecção/adoecimento pelo vírus da imunodeficiência humana (HIV), com realização sempre que possível de diagnóstico precoce e orientação continuada para prevenção.

Metodologia: Desenvolvemos um estudo observacional e prospectivo de indivíduos com maior susceptibilidade á infecção pelo HIV que voluntariamente procuram ou são encaminhados ao ambulatório do Instituto de Infectologia Emílo Ribas para testagem sorológica (CSA- Central Sorológica Alternativa), além dos casos suspeitos de infecção aguda pelo HIV. Estes pacientes são triados no ambulatório de testagem sorológica (CSA) e encaminhados ao ambulatório de vulnerabilidade, onde são seguidos com periodicidade semestral ou em consultas extras sempre que necessário. Todos os pacientes vulneráveis são submetidos á ficha de coleta de dados para avaliação de risco de infecção pelo HIV, e recebem preservativos e materiais educativo-institucionais. São realizadas as seguintes sorologias: HIV; Hepatite B e Sífilis. Durante o período do estudo, realizamos também ELISA de 4ª geração para todos os pacientes que tinham critérios de maior vulnerabilidade á infecção pelo HIV, e desenvolvemos um banco de dados de pacientes vulneráveis em epidata. Vacinação para Hepatite B foi oferecida sempre que indicada. Pacientes que apresentaram soroconversão para o HIV foram encaminhados para acompanhamento ambulatorial em HIV/Aids. Pacientes com suspeita de infecção aguda pelo HIV, foram submetidos á avaliação laboratorial que descrevemos a seguir: 1- ELISA de 4ª geração (no IIER) 2- CD4/CD8 E Carga Viral para o HIV-1 (no IIER) 3- Genotipagem para o HIV- 1(no Instituto Adolfo Lutz)

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: EPIDEMIOLÓGICA

Produção Científica


Projeto: EXPRESSÃO DA GP120 E DA GP41 DO VÍRUS DA IMUNODEFICIÊNCIA HUMANA 1(HIV-1)NA SUPERFÍCIE DE CÉLULAS DE OVÁRIO DE HAMSTER (CHO)
Coordenador: MÁRCIO JOSÉ POÇAS FONSECA
Resumo:

Objetivo:

Metodologia:

Concorrência: Estratégico

População Alvo: População em Geral

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: IMPLANTACAO E CAPACITACAO DE SERVICOS DE SAUDE PARA SITIO DE PESQUISA EM HIV/AIDS NA REGIAO DA GRAND
Coordenador: LUIZ GUSTAVO ESCADA FERREIRA
Resumo: Objetivo Geral: Estudar os parâmetros clínico-epidemiológicos dos portadores de HIV/AIDS atendidos em serviços ambulatoriais, de internação, CTA e hospital-dia, localizados nos Municípios de São José e Palhoça da Grande Florianópolis - SC. Objetivos Específicos: Integrar serviços de referência e contra-referência em assistência com característica multidiscipilinar, que prestam atendimento a portadores de HIV/AIDS na Grande Florianópolis - SC; Elaborar ficha padrão de coleta de dados epidemiológicos, sócio-comportamentais, demográficos, clínicos, terapêuticos e laboratoriais para assistência e pesquisa, contemplando as características multidisciplinares do grupo; Implantar a ficha nos serviços envolvidos, permitindo utilização para fins de assistência e pesquisa de forma rotineira; implantar um programa informatizado que permita a criação de um banco de dados, disponível para todos os serviços; Garantir a inserção regular dos dados provenientes das fichas padrões no programa de banco de dados em todos os serviços e Promover a análise estatística periódica dos dados compilados nos diversos serviços. Relevância do Estudo: A infecção pelo virus da imunodeficiência humana (HIV) e sua progressão á sindrome da imunodeficiência adquirida (SIDA/AIDS) continua sendo um problema de saúde de importância global. Desta forma, trabalhos que permitam conhecer a realidade das populações atingidas ou em maior risco para HIV/AIDS, e orientem ações de intervenção, assistência e apoio para melhorar a qualidade de vida dos que convivem com essa pandemia assumem uma especial importância. As ações dos serviços de saúde são potencializadas quando estes dispõem de equipe multidisciplinar, e se viabiliza a troca e integração entre os diferentes serviços que atendem uma determinada região. Em nosso país, apesar de todos os esforços empreendidos pelos gestores e funcionários da saúde isso ainda é uma realidade distante, como também é grande a distância entre os serviços que promovem a assistência e os que realizam a pesquisa sobre o mesmo tema. Este projeto tinha como objetivo, a implantação e capacitação de sítios de pesquisa, em serviços de saúde HIV/AIDS, nos municípios de São José e Palhoça, da Grande Florianópolis, possibilitando, conhecer e analisar a realidade da população assistida, elaborar intervenções e condutas nas diferentes áreas de assistência e pesquisa. Por ocasião da elaboração deste projeto, a epidemia de AIDS em Santa Catarina possuía pecularidades que justificavam a realização de estudos clínicos- epidemiológicos, pois no estado 32,4% dos indivíduos haviam adquirido o vírus através do uso de drogas injetáveis (UDI). Messa mesma época, entre os 20 municípios com maior incidência de AIDS (por 100.000 hab.) no país, quatro eram do estado de Santa Catarina, sendo dois da Grande Florianópolis: São José e Florianópolis. Logo, a situação epidemiológica da região demonstrava elavada incidência e transmissão por uso de drogas injetáveis. Um dos objetivos do projeto era integrar os serviços de assistência aos pacientes com HIV dos municípios de São José e Palhoça com foco na prevenção, assistência e pesquisa clínica e epidemiológica, reconhecendo a limitação dos recursos existentes na época e a complexidade da epidemia em nossa região. A descrição pormenorizada dos serviços já foi feita por ocasião da aprovação e elaboração do projeto inicial, outras considerações serão feitas nos tópicos subsequentes.

Objetivo: Apresentar a implantação e a capacitação de serviços de saúde para sítio de Pesquisa em HIV/AIDS, e os parâmetros Clínicos - Epidemiológicos dos portadores de HIV/AIDS atendidos em Serviços Ambulatoriais, de Internação, CTA e Hospital -Dia, localizados nos Municípios de São José e Palhoça da Grande Florianópolis, SC.

Metodologia: Originalmente, o projeto consistia em dois componentes: a) Estruturação e Integração de serviços de referência e contra-referência para assistência e pesquisa, visando possibilitar o atendimento por equipe multidiscipinar dos portadores de HIV/AIDS. Para a estruturação e integração da rede de referência e contra-referência em assistência e pesquisa, seriam realizadas reuniões periódicas com todos os integrantes dos serviços envolvidos, chefias e coordenadores dos programas estaduais e municipais de DST/AIDS, conseguindo estabelecer um protocolo de intenções e compromissos nos diversos níveis, visando com isso: Estabelecer as normas e rotinas comuns na assistência e pesquisa, que permitissem aperfeiçoar e integrar o atendimento e a pesquisa nos pacientes no nível municipal e estadual, respeitando sempre o grau de complexidade de cada caso e a capacidade de resolução de cada unidade de serviço da rede e minimizar as possíveis carências de recursos materiais e humanos existentes nos diferentes serviços. b) Elaboração e implantação de uma metodologia comum para a coleta, inserção e análise periódica de dados provenientes dos atendimentos dos usuários, utilizando um programa de banco de dados. Na elaboração e implantação da metodologia de coleta, inserção e análise de dados obtidos dos atendimentos dos usuários, seria necessário dispor de recursos materiais e humanos específicos que permitissem o funcionamento rotineiro, integrado e independente da linha de assistência com a linha de pesquisa nos serviços. Isso possibilitaria obter um conhecimento da população assistida, tendências e orientar novas condutas, intervenções e normas nas diversas áreas de assistência ou pesquisa. Com o objetivo de padronizar a coleta de dados clínicos, epidemiológicos, sócio-comportamental e laboratorial nos três serviços (Hospital Regional de São José, Posto de Saúde da Bela Vista e Posto de Saude da Palhoça) envolvidos no projeto, e respeitando a modalidade de atendimento disponível (ambulatório, hospital-dia, enfermaria e emergência, CTA), seriam criadas fichas de coletas de dados que permitiriam a transcrição dos mesmos para um banco de dados comum a todos os serviços. Para isso, seriam realizadas reuniões periódicas com profissionais de saúde e da administração diretamente envolvidos no projeto e no atendimento dos pacientes. Esta etapa estava prevista para ocorrer nos dois primeiros meses, após o qual, o emprego da ficha de atendimento e coleta de dados seria reavaliado periodicamente pelos membros das equipes envolvidas, até a conclusão do projeto. Um levantamento prévio das necessidades de recursos materiais e humano, para a realização deste projeto, visando equipar e adequar os centros de atendimento para a nova situação de pesquisa seria realizado e revisto durante a execução do projeto. Seriam realizados encontros e treinamemtos, contando com a participação das equipes de saúde e administração envolvidas e novas parcerias que se fizessem, visando orientar o emprego das melhores ferramentas que garantissem a digitação, a análise de dados, a segurança dos sistemas e a manutenção dos preceitos da ética na assistência e na pesquisa clínica, e atender outras demandas e oportunidades que pudessem aparecer. Ao término do projeto, estava prevista uma reunião final com os profissionais da área de assistência, administração e pesquisa dos serviços envolvidos no decurso do projeto, visando apresentar e analisar os resultados obtidos, discutir e elaborar ações de intervenção na população estudada e avaliar outras propostas na área de pesquisa e assistência.

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: TRANSMISSÃO MATERNO INFANTIL DO HIV, MORBIDADE E MORTALIDADE MATERNA SEGUNDO A VIA DE PARTO EM MULHERES HIV POSITIVO ASSISTIDAS EM MATERNIDADES DE REFERÊNCIA NO RIO DE JANEIRO, PORTO ALEGRE, RECIFE E CAMPO GRANDE
Coordenador: EDGAR MERCHAN HAMANN
Resumo: O projeto em questão é continuidade das ações o Projeto - CFA 030/02. A continuidade das ações foram necessárias devido ao ajuste do tamanho estimado da amostra permitindo maior abrangência para efeito de comparação, exigindo com isso a inclusão de três novos locais na pesquisa (Porto Alegre/RS, Recife/PE e Campo Grande/MS). O CFA 030/02 objetivava apenas a coleta e análise de dados no RIo de Janeiro/RJ.

Objetivo: GERAL: Analisar os fatores de risco para a morbidade e mortalidade materna em mulheres HIV+, segundo a via de parto, e a incidência de soroconversão em seus filhos. ESPECÍFICOS: Descrever a frequência e distribuição da morbidade e mortalidade materna, em mulheres HIV+, segundo a via de parto; Descrever a frequência e distribuição de soroconversão nas crianças produto das mulheres HIV+, incluídas no estudo; Analisar os determinantes da morbidade e mortalidade em mulheres HIV+; Analisar os determinantes da transmissão vertical do HIV; Avaliar a qualidade dos serviços de pré-natal e maternidades, onde ocorreu à assistência das mulheres participantes do estudo.

Metodologia: SELEÇÃO DA POPULAÇÃO DE ESTUDO A amostra será composta por parturientes portadoras do HIV assistidas de janeiro de 1997 a dezembro de 2003, em maternidades referência no RIo de Janeiro, Porto Alegre, Recife e Campo Grande. Serão revisados os prontuários das parturientes HIV+ assistidas durante esse período, se constituindo a partir de então a população de estudo aquelas parturientes, e seus filhos, em cujos prontuários forem encontradas as informações necessárias aos objetivos deste estudo. Com o objetivo de nos permitir uma melhor análise dos dados coletados nos prontuários, durante o período de seis meses, será realizada em cada maternidade selecionada, uma entrevista nas puérperas assistidas nesses serviços. CÁLCULO DO TAMANHO DA AMOSTRA: Será usado o Epi-Info. O tamanho estimado da amostra será de no mínimo 357 parturientes HIV+ (coorte prospectiva), sendo esperado encontra 274 partos por operação cesariana (grupo das expostas) e 83 partos normasi (grupo das não expostas) - estes números foram calculados para o IC de 95%; erro tipo 1 de 5%; P < 0,05; potência de 80%; coeficiente de incidência de 15% relação expostas/não expostas de 0,3; e RR de 2:1. No Rio de Janeiro, foram coletadas informações de 955 mães HIV+ e suas crianças (C. Retrospectivo) e informações de 108 mães HIV+ e suas crianças (C. Prospectivo) em nove serviços de saúde que participam do estudo. A necessidade de ajuste do tamanho estimado da amostra permitindo maior abrangências para efeito de comparação, que resulta em conseqüência a necessidade deste projeto de continuidade em virtude da inclusão de três novos locais na pesquisa, prevê alcançar ao final da coleta de informações que ocorrerá em 31/12/2003, informações coletadas, por cada uma das três localidades, segundo as seguintes estimativas: Em Campo Grande/MS: informações de 70 mães HIV+ e suas crianças (C. Retrospectivo) e informações de 37 mães HIV+ e suas crianças (C. Prospectivo). Em Recife/PE: informações de 244 mães HIV+ e suas crianças (C. Retrospectivo) e informações de 80 mães HIV+ e suas crianças (C. Prospectivo). Em Porto Alegre/RS: informações de 350 mães HIV+ e suas crianças (C. Retrospectivo) e informações de 160 mães HIV+ e suas crianças (C. Prospectivo). Pelo exposto acima, o estudo terá ao final com a inclusão das três localidades, um banco de dados para análise de 1.619 mães HIV+ e suas crianças (C. Retrospectivo) e de 385 mães HIV+ e suas crianças (C. Prospectivo). Além do ganho representado pelo aumento da amostra, teremos informações de quatro regiões brasileiras, não tendo sido incluída a região norte pelas dificuldades operacionais peculiares a essa região, o que resultaria em maior atraso no cronograma físico e maior necessidade orçamentária. MÉTODO / TIPO DE ESTUDO: a) Avaliação epidemiológica Repetindo projeto inicial (CFA 030/02) será este um estudo análitico, observacional, de coorte. Tendo, portanto o coeficiente de incidência como medida de freqüência e o risco relativo como medida de associação. A Coorte retrospectiva se fará a partir dos dados registrados nos prontuários das parturientes portadoras do HIV assistidas nos serviços selecionados de cada uma das cidades selecionadas. A Coorte prospectiva observará parturientes HIV+ assistidas, durante o período preestabelecido de 6(seis) meses, nos mesmos serviços selecionados para a Coorte retrospectiva, coletando informações nos prontuários das parturientes portadoras do HIV através do Instrumento de coleta mencionado, e de urna entrevista As informações coletadas serão analisadas tendo como parâmetro os avanços científicos consagrados mundialmente e, como referência para a assistência dispensada à mãe e seu bebe, as normas e diretrizes do documento de consenso do Ministério da Saúde/PN-DST/AlDS - "Recomendações para Profilaxia da Transmissão Vertical do HIV e Terapia Anti-Retroviral em Gestantes", do ano vigente durante a análise dos dados (Ano 2004). E importante mencionar que o processo de análise, não resultará em custos para o PN-DST/AlDS, acontecendo com participação da UnB (Departamento de Saude Coletiva - Disciplina de Epidemiologia) e a UDAT - PN DST/AlDS. b) Avaliação operacional dos serviços No projeto inicial mencionamos que as maternidades selecionadas seriam avaliadas por um instrumento de avaliação elaborado a partir das normas e diretrizes do documento de consenso mencionado, e de dois outros utilizados pela Área Técnica de Saúde da Mulher do MS (o 'Questionário de Avaliação do Projeto Maternidade Segura' e o 'Questionário de avaliação da Atenção Humanizada ao Parto - Prêmio Galba Araújo'), ambos de circulação interna e de conhecimento restrito dos avaliadores da Área Técnica de Saúde da Mulher, e que por esse motivo não seria anexado neste Plano de Pesquisa. Hoje, a Secretaria de Atenção à Saúde do Ministério da Saúde, preocupada em unificar os vários instrumentos de avaliação de maternidades existentes, ora analisando as ações da área técnica de saúde da muher, ora analisando as ações da área técnica de saúde da criança, ora analisando as ações de outras áreas técnicas, esta com uma proposta de instrumento de avaliação em andamento, elaborado em conjunto com todas as áreas técnicas do MS envolvidas com a proteção da saúde de mães e bebes, incluindo o PN-DST/AlDS. Quando finalizado este instrumento será o utilizado para a avaliação dos 17 serviços participantes desse estudo.

Concorrência: Cont. - Descentralizado

População Alvo: Mulher - Criança (TV)

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: ESTUDO DA PREVALÊNCIA DE ALTERACOES ANATÔMICAS E/OU METABÓLICAS EM PORTADORES DO HIV/AIDS EM 5 CENTRROS BRASILEIROS, GRUPO MULTIDISCIPLINAR PARA O ESTUDO DAS ALTERAÇÕES METABÓLICAS E/OU ANATÔMICAS EM PORTADORES DE HIV/AIDS - GEAM
Coordenador: OLAVO HENRIQUE MUNHOZ LEITE
Resumo: Serão incluídos no estudo 1.700 portadores de HIV/Aids, selecionados aleatoriamente entre a população em acompanhamento nos 5 centros de pesquisa. Todos os centros atendem adultos (maiores de 18 anos), homens e mulheres. Os resultados da pesquisa e o banco de dados pertencem aos responsáveis/proprietários, que são os investigadores das 5 instituições envolvidas na pesquisa (abaixo relacionadas) e o Programa Brasileiro de DST/Aids. Informações adicionais que não constem da pesquisa e possam ser obtidas no banco de dados e pesquisas adicionais poderão ser feitas desde que respeitados os preceitos éticos e haja concordância dos proprietários/responsáveis já citados. Casa da Aids - São Paulo/SP - Brasil; a) Centro de Infectologia Emilio Ribas - São Paulo/SP - Brasil; b) Centro de Referencia em DST/Aids - São Paulo/SP - Brasil; c) Universidade Federal do RJ - Rio de Janeiro/RJ - Brasil; d) FIOCRUZ - Rio de Janeiro/RJ - Brasil. Deverá ser apresentado como produto final a pesquisa, todas as alterações detectadas em mais que 5% dos pacientes serão fornecidas na forma de prevalência (número total de pessoas com a alteração sobre o número total de pacientes incluídos). Após estes resultados, serão feitas análises de associação (univariada) e depois destas determinações será realizada uma análise multivariada para determinação final das correlações.

Objetivo: Geral: Esta coerente e visa avaliar a prevalência de alterações metabólicas e/ou anatômicas em pacientes infectados pelo HIV/Aids atendidos em 5 centros brasileiros especializados de São Paulo/SP e Rio de Janeiro/RJ. Específicos: Identificar as variáveis associadas à presença das alterações anatômicas e metabólicas em nosso mew; Avaliar o papel dos métodos gráficos e de imagem no diagnóstico das alterações anatômicas e metabólicas; Identificar as complicações decorrentes das alterações anatômicas e metabólicas. .

Metodologia: O estudo será realizado nos municípios de São Paulo e Rio de Janeiro, cidades com alta prevalência de infecção pelo HIV, envolvendo centros especializados no atendimento de portadores de HIV/AIDS, pelos de referência nacional. Os cinco serviços onde a pesquisa será realizada atendem um universo com cerca de 15.000 pacientes infectados pelo HIV/Aids. Os cinco centros de pesquisa estão estabelecidos há vários anos e são referencia para o acompanhamento de portadores do HIV. Todas as avaliações descritas no estudo serão realizadas nos cinco centros participantes (Casa da AIDS, CRT DST/Aids e Instituto de Infectologia Emilio Ribas São Paulo e Ambulatório de AIDS da Fiocruz e UFRJ - Rio de Janeiro). Cada serviço estabelecem contato com outras especialidades médicas para a realização dos exames especializados descritos no projeto de pesquisa. Os pesquisadores possuem vínculo empregatício com as instituições e dedicarão tempo da sua carga horária habitual para a realização da pesquisa. A avaliação nutricional exigida pelo estudo será realizada por nutricionistas especialmente contratadas para o período da pesquisa. A coordenação do projeto será feita pela Casa da AIDS, representada pelo seu coordenador técnico, Dr. Olavo Henrique Munhoz Leite, que disporá de cerca de 40 horas semanais para esse fim. O monitoramento da pesquisa será feito por uma monitora contratada pelo período de duração do estudo, por 30 horas semanais. Os efeitos estéticos, psicológicos e sociais das alterações anatômicas e as conseqüências das alterações metabólicas nos sistemas cardiovascular e ósseo, entre outros, justificam um estudo de prevalência destas alterações em nosso meio. O conhecimento desta prevalência será fundamental no planejamento de intervenções preventivas e terapêuticas para essas alterações. As informações obtidas nesse estudo poderão ser utilizadas em avaliações dessas intervenções e no estudo de fatores de risco, métodos de diagnóstico e taxas de complicações.

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: EPIDEMIOLÓGICA

Produção Científica


Projeto: PREPARAÇÃO DE SÍTIOS PARA TESTES COM MICROBICIDAS OU PRODUTOS VACINAIS CONTRA O HIV/AIDS: AVALIAÇÃO DA EVOLUÇÃO DA PATOGÊNESE VIRAL ATRAVÉS DO SEGUIMENTO DE POPULAÇÕES INFECTADA PELO HIV.
Coordenador: CYNARA CARVALHO NUNES
Resumo: O projeto se propõe a preparar unidades do SUS da região para participar de testes de eficácia com produtos vacinais ou microbicidas contra a AIDS. Este projeto pretende contribuir na obtenção de dados preliminares sobre a evolução da infecção pelo vírus HIV 1 (aspectos clínicos, imunológicos, virológicos) e favorecer a identificação e a organização da infra-estrutura necessária a esta atividade. Ainda, acompanhar a evolução dos infectados em estudos e tanto um compromisso com os voluntários destes estudos como uma necessidade vigilância em saúde pública. Tanto a avaliação da patogenicidade dos diferentes subtipos do vírus HIV I(B,C e B/C) como 0 seguimento destes voluntários implica na preparação desta rede de suporte. Este projeto deverá atuar nesta área através da caracterização e geração de infraestrutura de pesquisa em unidades locais que atuam junto a uma população de voluntários HIV positivos. A padronização do monitoramento clínico-laboratorial, que será base de estudos clínicos assim como com produtos vacinais, será irnplementadas e avaliada. Serão recrutados 200 indivíduos da população que apresente testes sorológicos positivos para o HIV em serviços públicos (CTA,Unidades básicas, PSF) em especial em serviços participantes do esforço estadual de preparação para vacinas contra HIV/Aids. Estes indivíduos, que são rotineiramente encaminhados a serviços de saúde para seguimento clínico usual, serão convidados a participar de um seguimento monitorado. Os voluntários que concordarem a assinarem consentimento esclarecido, terão este seguimento clínico que envolverá, adicionalmente aos testes laboratoriais visitas e eventuais tratamentos padrões; investigação através de questionários, avaliações laboratoriais e retornos extras que possibilitarão responder as diferentes questões deste estudo

Objetivo: OBJETIVO GERAL: O objetivo principal deste estudo é estruturar o seguimento de voluntários em serviços do SUS, e testar a hipótese de que existe um impacto imunológico, definido aqui como o percentual de queda anual do número de linfócitos T CD4+ durante a infecção, distinta entre indivíduos infectados por variantes HIV-l subtipo C com relação a indivíduos infectados com variantes HIV-I subtipo B. OBJETIVOS ESPECÍFICOS: - Avaliar o set point viral durante a fase pré - tratamento. - Avaliar a resposta (queda de Carga viral e nível CD4) ao tratamento em sua fase precoce (primeiras semanas-12 s) e posterior (24 e 48 semanas), dos indivíduos que iniciem tratamento por indicação clínica ou laboratorial de acordo com os critérios vigentes. - Avaliar possíveis fatores de confusão que interferem na resposta imunológica nos pacientes que iniciarão ARV, como: adesão a terapia, eventos clínicos que podem aparecer com a restauração imunológica.

Metodologia: O estudo envolve os seguintes componentes: - Supervisão Técnica e de gerenciamento do sítio; - Metodologias de laboratório de rotina e especificas; - Aprimoramento de técnicas de documentação de dados; - Estruturação de núcleo psicossocial de apoio aos voluntários e de estudo das características dos potenciais voluntários, com seguimento padronizado; - Criação e manutenção de banco amostras para posteriores estudos biomoleculares; Análises da epidemiologia geral e molecular; - Análises de bancos de dados. Será utilizado o Consentimento Esclarecido em sua versão final após aprovação pelo Comitê de Bioética das instituições participantes. Esses voluntários, caso consintam por consentimento obtido durante o seguimento, deverão ter também material bio1ógico mantido em unidades públicas participantes para uso em confirmação de testes laboratoriais previstos estudo Critério de inclusão: - Indivíduos infectados pelo HIV-1, maiores de 18 anos que após lerem o consentimento esclarecido concordarem em participar do estudo e que sejam naive em relação à terapia antiretroviral. Critérios de exclusão: - Gestantes - Voluntários anti-HTLV reagentes pela metodologia de ELISA - Voluntários que já estejam em uso de Terapia ARV Viremia total (Carga Viral): Plasma separado em tempo real menor que 6 h deverá ser clareado em microspin refrigerada a 10.000 rpm por 3 min e aliquotado. Alíquotas de 500 uL a 1 mL serão armazenadas para posterior detecção de número de moléculas de RNA por amplificação isotérmica (Nasba, OT, Holanda) quando for necessária complementar ou confirmar as quantificações da rotina de seguimento. O método de tipificação utilizado será o estabelecido para a região do sítio clínico disponível na rede pública, podendo ser baseado em metodologia de DNA ramificado (Bayer); PCR quantitativo ( Roche) ou Nuclisens ( Organon Tecknika). Este último envolve a amplificação isotérmica de RNA viral obtido por lise de proteínas do plasma com meio caotrópico (tiocianato de guanidina). A amplificação isotérmica será realizada após a adição de três espécies de RNA que atuam como controles internos da reação. A leitura, realizada em aparelho do mesmo fabricante, permitirá, ao comparar a quantidade de RNA amplificado presente na amostra em relação a quantidade final dos três controles, inferir a quantidade de RNA viral inicialmente presente no plasma do paciente, com resultado expressado em Log 10 cópias/mL. As amostras abaixo do limite de detectabilidade são definidas por testes com resultado negativo, que e determinado para cada reação, em torno inferior a 50. cópias/ml. Isolamento e seqüenciamento viral: RNA será extraído do plasma a partir de centrifugação seguida de amplificação isotérmica para a formação de DNA. O RNA será extraído de 500 uL plasma criopreservado (alternativamente 1 mL de plasma será utilizado para pacientes com viremia inferior a 4 Log10). A partir de centrifugação sob refrigeração, 18.000 g por 90 min a 4°C, o pellet da centrifugação, contendo o material genético viral presente no plasma, será recuperado por tratamento por solução de trizol e submetido à amplificação isotérmica (42°C) por 1 h na presença de solução tamponada que inclui iniciadores, constituídos de hexâmetros randômicos, dNTPs e enzima MuLV. A enzima é inativada por calor (99°C) por 5 min e o produto da reação (cDNA) será armazenado a -70°C ate uso posterior ou submetido diretamente amplificação por ciclos térmicos (PCR). Alternativamente, lisado celular (DNA) equivalente a 1 milhão de células mononucleares será utilizado como fonte de DNA genomico após digestão com Proteinase K e purificação. Cada mistura de reagentes incluirá 10 pmol de cada oligonucleotídeo iniciador (primers). Os primers utilizados incluirão: Fl (gttgactcagattggttgcac), F2 (gtatgtcattgacagtccagc), F3 (tatcaggatggag ttcataac), F4 (ggatggcccaaaagttaaac), Kl (cagagccaacagccccacca), K2 ( ttccccactaacttctgtatgtcattgaca), K3 (ggggcatccattcctggctttaattt), DP 10 ( taactccctctcagaagcaggagccg), DP 11 (ccattcctggctttaatttt actggta), DP 16 ( cctcaaatcactctttggcaac), DP 17 ( aaaatttaaagtgcagccaat), os quatro nucleotídeos trifosfatados, MgC12, enzima termoestável e tampão da reação. A reações de amplificação serão realizadas em um volume final de 20-100 uL. Três ambientes fisicamente separados serão utilizados para minimizar contaminação. A etapa de seqüenciamento e interpretação será a preconizada pelo sistema adotado. O seqüenciamento das regiões env serão realizadas com um par de primers, selecionados a partir dos seguintes: ED5 (atgggatcaaagcctaaagaaatgtg), ED 12 ( agtgcttcctgctgctcccaagaacccaag), ES7 (tgtaaaacgacggccagtctgttaaatggcagtctagc), ES8 ( aggaaacagctatga cccacttctccaattgtccctca), Um dos primers internos aos utilizados na reação de PCR será adicionado ao produto purificado por etanol e isopropanol em conjunto com reagentes (big dye) com dideoxinucleotídeos validados para uso com equipamento de seqüenciamento disponibilizado ao IAL, ABI 377. A corrida de até 7 horas permitirá a obtenção de seqüências nas duas orientações (3' e 5') a serem editadas em programa específico do aparelho (Navigator) ou disponibilizados no IAL (DNA Star) e analisadas em programas públicos disponibilizados na Internet, incluindo o programa BLAST disponibilizado no site da HIVNET do Laboratório Nacional Americano de Los Alamos para determinação de eventuais contaminações (http://hiv-web.1anl.gov), e em programas específicos para mutações associadas a resistência aos anti-retrovirais, HIV-Seq (http://hiv-4.stanford.edu/cgi-bin/hrp-asap-web.pl ).

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: APOIO À ESTRUT. DE SÍTIOS PARA TESTES COM INSUMOS ESTRATÉGIC

Produção Científica


Projeto: IMPLEMENTACAO DO LABORATÓRIO DE ANÁLISES CLÍNICAS DO COMPLEXO HOSPITALAR DE DOENÇAS INFECTO-CONTAGIOSAS - DR. CLEMENTINO FRAGA REFERÊNCIA ESTADUAL NO TRATAMENTO DE PACIENTES COM HIV/AIDS
Coordenador: RAUL DA CAMARA COSTA FILHO
Resumo: O Complexo Hospitalar de Doenças Infecto-Contagiosas - Dr. Clementino Fraga - CHCF destaca-se dentre as demais instituições de saúde por ser referência no Estado da Paraíva e cidades circunvizinhas dos estados de Pernambuco, Rio Grande do Norte e Ceará no tratamento aos pacientes portadores do HIV/AIDS, tanto a nível de intervenção como ambulatorial através de equipes multiprofissionais (Infectologistas, Pneumologistas, Pediatra, Dermatologistas, Nutricionistas, Psicólogos, Assistentes Sociais, Fisioterpeutas, Engenheiro Químico no tratamento de água, Educador Físico, etc) devidamente treinadas e distribuídas nos diversos serviços deste Complexo (SAE, ADT, HD e INTERNAÇÕES), sendo o pioneiro no Diagnóstico e Tratamento do HIV/AIDS no estado da Paraíba. Está localizado na Rua Ester Borges Bastos, S/Nº - Jaguaribe - João Pessoa/PB, próximo à Secretaria de Estado da Saúde, Hemocentro e Unidades Hospitalares como por exemplo: Hospital do Câncer Napoleão Laureano, Hospital São Vicente de Paula, etc. O CHCF foi criado na década de 1950 pelo Ministério da Saúde através do Programa Nacional de Tuberculose no atendimento aos portadores de Tuberculose, denominado "SANATÓRIO CLEMENTINO FRAGA", constituído de uma clientela carente. Posteriormente passou a ser proporcionando campo de estágio para os Universitários. No Final da década de 1980, o CHCF passou a ser mantido pela Secretaria de Saúde do Estado da Paraíba, denominando-se Complexo Hospitalar de Doenças Infecto-Contagiosas - Dr. Clementino Fraga, abrangendo o atendimento a Pneumologia Sanitária, Dermatologia Sanitária e HIV/AIDS. A Paraíba destaca-se no setor econômico nas atividades agro-pecuárias, na transformação de produtos minerais e metálicos, têxtil e alimentar. O município de João Pessoa compreende uma população aproximada de 600 mil habitantes, com um média de crescimento anual de 6%, destacando uma população ativa entre 14 a 50 anos. Considerando o CHCF com suas atividades voltadas principalmente para o atendimento HIV/AIDS, com qualidade e eficiência, aspira-se poru uma Implementação do Laboratório de Análises Clínicas deste Complexo, proporcionando assim resultados mais rápidos e mais confiáveis, facilitando assim a propedêutica e tratamento deta patologia. Todos os exames laboratoriais são realizados por Bioquímicos treinados e qualificados, realiza-se em média 400 exames diários de forma manual, o que acarreta uma grande demora na objtenção dos resultados, prejudicando a propedêutica e tratamento dos pacientes HIV/AIDS. Também é sabido que os procedimentos de análise laboratorial manual pode acarretar diversos erros que são inerentes ao manuseio, como por exemplo: titulação, leitura, etc... Outro fator que deve ser levado em consideração é a biosegurança dos profissionais, pois quanto mais exposto a materiais biológicos, maior a probabilidade de contaminação, mesmo utilizando os EPI's necessários. O pleito também justifica-se com o advento do Programa FIQUE SABENDO, cujo objetivo principal é a conscientização da população para a testagem sorológica para o HIV o que aumentará o número de exames, com o diagnóstico precoce dos soropositivos, proporcionando acompanhamento clínico com melhor qualidade de vida.

Objetivo: OBJETIVO GERAL: Promover ao paciente portador do HIVI/AIDS uma melhor qualidade de vida, com melhor resolutividade diagnóstica, resgatando a Cidadania e a Dignidade desta população alvo OBJETIVOS ESPECÍFICOS: - Proporcionar melhor assistência na propedêutica e terapêutica aos pacientes de HIV/AIDS do SAE, ADT, HD e INTERNAÇÕES do CHCF, com base na qualidade e eficácia dos resultados laboratoriais; - Promover a rapidez do diagnóstico precoce do HIV; - Promover o diagnóstico precoce das Co-Infecções AIDS; - Implantar um serviço de DSTs.

Metodologia: No escopo do projeto não detalha a metodologia.

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: APOIO À ESTRUT. DE NÚCLEOS DE PESQUISA CLÍNICA

Produção Científica


Projeto: COMPORTAMENTO SEXUAL DA POPULACAO BRASILEIRA E PERCEPCAO DO HIV/AIDS 2004-2005.
Coordenador: ELZA BERQUO
Resumo: A presente proposta visa identificar e comparar eventuais mudanças nas representações, comportamento, atitudes e pratica sexuais da população brasi1eira, e conhecimento sobre HIV/Aids, ocorridas nos últimos cinco anos, a partir de 1998. A comparação dos resultados a serem obtidos em 2004 com aqueles registrados na pesquisa Comportamento Sexual da População Brasileira e Percepções do HIV/Aids, realizada em 1998-99 pela Coordenação Nacional de DST/Aids do Ministério da Saúde, dará subsídios a Coordenação para avaliar estratégias de intervenções preventivas das DST/Aids.

Objetivo: Geral: Identificar mudanças ou permanências nas representações, comportamentos, atitudes e práticas sexuais da população brasileira, e conhecimento sobre HIV/Aids, ocorridas nos últimos cinco anos, com vistas a estabelecer e/ou reorientar estratégias de intervenções preventivas das DST's e HIV. Específicos: Estudar possíveis alterações na prevalência das práticas sexuais e relaciona-Ias aos contextos sociais específicos; Verificar se alteraram as representações, orientações, atitudes e práticas sexuais de grupos específicos; Avaliar permanências e possíveis mudanças nos determinantes socioeconômicos, culturais, raciais/étnicos e psicológicos do usa do preservativo; Pesquisar a interação sexo-uso de drogas e suas implicações no comportamento sexual; Avaliar se houve modificações nos níveis de conhecimento sobre HIVIAids e percepção de risco a infecção; Verificar se houve aumento na proporção de pessoas que fazem o teste do HIV, bem como modificação ou persistência nas razoes que levam a essa conduta; Estabelecer as interações entre fatores estruturais, relacionais e individuais que intervém no comportamento sexual frente às formas de transmissão e prevenção do HIV/Aids e compará-Ias com as verificadas em 1998/99; Gerar indicadores de comportamento que permitam comparações espaciais e temporais; Construir modelos estatísticos explicativos de comportamentos para segrnentos específicos que permitam projeções probabilísticas.

Metodologia: Os moradores com idades entre 16 e 65 anos, em cada domicílio sorteado, serão ordenados segundo sexo e idade com o seguinte critério: em primeiro lugar, o homern mais velho recebendo o número 1, seguido pelo homem imediatamente mais velho, o número 2, e assim por diante, até a mulher mais jovem. A partir desta ordenação a pessoa a ser entrevistada no domicílio será selecionada através de tabelas de sorteios, previstas para domicílios com tamanhos variáveis. Em principio o questionário conterá os mesrnos capítulos da Pesquisa de 1998-99, ou seja, Identificação Pessoal; Opiniões sobre Sexualidade e Normas Sexuais; Iniciação Sexual e Experiências Sexuais; Comportamento Sexual; Praticas Sexual; Conhecimento/Prevenção do HIV/Aids; Reprodução e Saúde; Uso de Drogas; Violência, Adaptações, inserções e cortes poderão ser introduzidas pelo Comitê Científico Assessor. Perguntas fechadas e abertas compondo o elenco das questões. A entrevista será do tipo face-a-face e precedida de um esclarecimento lido pelo entrevistador informando sobre o objetivo do projeto. A entrevista será realizada em condições de privacidade e mediante assinatura, pelo entrevistado, de um termo de "Consentimento Informado". Planilhas poderão ser especialmente delineadas em relação a certas perguntas que possam vir a ser consideradas constrangedoras na relação entrevistador/entrevistado. Outros instrumentos que visem facilitar esta relação poderão ser utilizados, tais como técnicas probabilísticas de respostas da questão em causa com outras questões de fácil resposta para o entrevistado. Durante o processo de treinamento todos os entrevistadores envolvidos no projeto receberão um manual contendo orientações sobre os procedimentos de campo, orientações sobre as formas de abordagem das questões e esclarecimentos sobre os conceitos relacionados ao tema. Da mesma forma, os critérios para listagem e substituição dos domicílios, serão orientados pela equipe técnica do projeto.

Concorrência: Concorrência Sítio de Vacinas

População Alvo: População em Geral

Natureza: ESTUDOS E PESQUISAS

Subnatureza: COMPORTAMENTAL

Produção Científica


Projeto: PROTOCOLO COLABORATIVO MULTICENTRICO BRASILEIRO PARA AVALIAR AS TAXAS DE TRANSMISSAO MATERNO INFANTI.
Coordenador: Regina Celia Menezes Succi
Resumo: Trata-se de um estudo prospectivo de coorte para o acompanhamento de crianças nascidas de mães infectadas pelo HIV antes, durante ou ate seis meses apos o parto. O estudo visa agrupar dados de serviços representativos das cinco macro-regiões brasileiras para estimar a taxa de transmissão vertical do HIV no pais, entre crianças nascidas no período compreendido entre os meses de janeiro de 2004 a dezembro de 2007. Estamos solicitando recursos para a primeira etapa do projeto referente ao período de abril a dezembro de 2004. Considerando-se que o estudo anterior analisou dados de crianças nascidas no período compreendido entre janeiro de 2000 e dezembro de 2002, o período compreendido entre janeiro e dezembro de 2003, será analisado de forma retrospectiva (nos serviços que já participaram do estudo anterior e continuarão no estudo prospectivo) para não haver descontinuidade na coleta da informação referente à taxa de transmissão vertical do HIV no país. A amostra deverá ser representativa do que ocorre no país e deverá permitir comparação com os dados obtidos no estudo anterior. Para isso, pretendemos incluir parte dos serviços que participaram do estudo anterior e que sejam representativos das cinco macro-regiões do país. Os serviços selecionados devem responder por pelo menos 50% dos casos incluídos no estudo anterior. Da região Norte serão incluídos nos serviços (estados do Para e Amazonas); os casos enviados por esses dois serviços para o estudo anterior representaram 84% dos casos incluídos na região. Da região Nordeste serão incluídos quatro serviços (Pernambuco, Ceará, Maranhão e Rio Grande do Norte) que contribuíram com 75% dos casos incluídos na região. Da região centro-oeste serão incluídos dois serviços (Distrito Federal e Goiás) que contribuíram com 77,5% dos casos incluídos na região. Da região Sul serão incluídos três serviços (Paraná, Santa Catarina e Rio Grande do Sul) que contribuíram com 68% dos casos incluídos na região. Da região Sudeste serão incluídos seis serviços (dois do Rio de Janeiro, três de São Paulo e um do Espírito Santo) que contribuíram com 68% dos casos incluídos na região. Estima-se que pelo menos 800 pares mães - bebes sejam incluídos no estudo a cada ano. Uma ficha de registro padronizada será utilizada para a coleta de dados em todos os centros envolvidos. Espera-se que cada centro designe uma pessoa que ficara responsável pelo registro dos dados e pela comunicação com o coordenador do projeto, alem do envio de to do o material via e-mail, fax e via correio regular. Um relatório com o número de casos incluídos no período e as fichas preenchidas devera ser enviado para a coordenação do projeto ao final de cada meso mesmo na eventualidade de não haver casos novos incluídos no período, cada unidade participante devera enviar o relatório mensal ao coordenador do projeto.

Objetivo: OBJETIVO GERAL: Avaliar a taxa de transmissão vertical do HIV em serviços brasileiros que atendem crianças nascidas de mulheres infectadas pelo HIV, cujo diagnostico da infecçao (na mãe) ocorreu antes, durante ou nos primeiros seis meses após o parto; Avaliar os métodos utilizados para prevenir a transmissão do HIV da mãe para o filho nos diferentes serviços, aplicação do teste para HIV no pré-natal, incluindo terapia antiretroviral, tipo de parto, aleitamento materno; Comparar os dados obtidos nesse estudo com os dados obtidos no estudo anterior. . Manter vigilância das taxas de transmissão vertical do HIV no país, com a finalidade de controlar essa transmissão ate o ano de 2007. OBJETIVOS SECUNDARIOS: Avaliar as características das mães infectadas: idade, risco, tipo de parto, pré-natal, paridade, etc. Descrever os diferentes serviços envolvidos no atendimento deste grupo de pacientes Avaliar fatores associados com a transmissão materno-infantil do HIV Identificar regiões onde será necessário implementar as medidas que diminuem o risco da transmissão vertical do HIV.

Metodologia: Trata-se de um estudo prospectivo de coorte para o acompanhamento de crianças nascidas de mães infectadas pelo HIV antes, durante ou ate seis meses após o parto. O estudo visa agrupar dados de serviços representativos das cinco macro-regiões brasileiras para estimar a taxa de transmissão vertical do HIV no país, entre crianças nascidas no período compreendido entre os meses de janeiro de 2004 a dezembro de 2007. Considerando-se que o estudo anterior analisou dados de crianças nascidas no período compreendido entre janeiro de 2000 e dezembro de 2002, o período compreendido entre janeiro e dezembro de 2003, será analisado de forma retrospectiva (nos serviços que já participaram do estudo anterior e continuarão no estudo prospectivo) para não haver descontinuidade na coleta da informação referente a taxa de transmissão vertical do HIV no pais. Considerando-se a penetração da Sociedade Brasileira de Pediatria (SBP) em todo o pais, utilizaremos as sedes regionais da SBP como fonte de informação para os serviços e pediatras envolvidos no estudo. O Grupo que se constituirá para realizar o estudo será denominado: GRUPO DE ESTUDO DA SBP PARA A VALIAR AS TAXAS DE TRANSMISSÃO VERTICAL DO HIV. DURAÇÃO DO ESTUDO: 48 meses a partir do seu inicio, previsto para abril de 2004. Com 0 encerramento da coleta de dados em dezembro de 2008, espera-se obter dados definitivos sobre a transmissão vertical do HIV em um número significante das crianças incluídas no estudo (nascidas ate dezembro de 2007). Dados preliminares do estudo, entretanto, deverão estar disponíveis após os primeiros 9 meses do seu início janeiro de 2005, visto que para esta análise inicial poderão ser obtidas as taxas de transmissão das crianças nascidas no período compreendido entre janeiro de 2003 a julho de 2004. TAMANHO DA AMOSTRA: A amostra devera ser representativa do que ocorre no país e devera permitir comparação com os dados obtidos no estudo anterior. Para isso, pretendemos incluir parte dos serviços que participaram do estudo anterior e que sejam representativos das cinco macro-regiões do país. Os serviços selecionados devem responder por pelo menos 50% dos casos incluídos no estudo anterior. CRITERIOS DE INCLUSAO DOS SERVIÇOS: Serão incluídos no estudo alguns dos serviços que participaram do estudo anterior e alem de serem representativos das regiões geográficas em que estão inseridos, atendem um numero significante de casos, demonstraram ter registro adequado das variáveis que serão analisadas e condições de enviarem esses dados em tempo hábil para análise. Entende-se por atendimento: acompanhar bebes nascidos de mães infectadas pelo HIV até a sua completa definição de infecção pelo HIV (infectado ou não infectado/ soro-revertido). É necessário, para participação no projeto, ter o registro do maior número possível de dados matemos: idade, pré-natal, risco para o HIV, aleitamento materno, uso de terapia antiretroviral para prevenir a transmissão (tipo de droga, período, dose, etc), tipo de parto (incluindo tempo de bolsa rota, procedimentos, etc). CRITÉRIOS DE EXCLUSÃO DOS SERVIÇOS: Acompanhamento de crianças infectadas pelo HIV, porem sem registro adequado desse atendimento. CRITÉRIOS DE INCLUSÃO DOS CASOS PARA ACOMPANHAMENTO: Nascer de mãe infectada pelo HIV e realizar acompanhamento no serviço até que a simavao de infecção pelo HIV seja definida. Registro do maior número possível de dados matemos referentes ao pré-natal, parto, uso de terapia antiretroviral, aleitamento materno, etc. Crianças nascidas no período compreendido entre janeiro de 2003 ate dezembro de 2006. CRITERIOS DE EXCLUSÃO DOS CASOS PARA ACOMPANHAMENTO: Abandono do seguimento antes da definição de infecção pelo HIV. Data do nascimento fora do período previamente estipulado. SELEÇÃO DOS PACIENTE: Considerando-se a experiência obtida com o estudo anterior, este estudo será prospectivo para crianças nascidas a partir de 2004. Os dados da transmissão vertical do HIV para o ano de 2003 serão obtidos retrospectivamente da mesma forma que o estudo anterior. Para o estudo prospectivo, cada serviço enviará para a coordenadora do estudo uma lista mensal das crianças matriculadas com critérios de inclusão. A partir do momenta que os exames permitirem a definição da situação de infecção, as fichas serão preenchidas e os dados enviados para serem colocados em banco de dados adequado. CRITERIOS DE INCLUSÃO PARA AS CRIANÇAS FILHAS DE MAES INFECTADAS PELO HIV: As mães deverão apresentar documentação da infecção pelo HIV, definida por: pelo menos dois testes de anticorpos reagentes (incluído um teste rápido), ou um teste de anticorpo mais um teste PCR DNA ou Quantificação do RNA viral (carga viral) detectável realizados antes ou durante a gestação, no momenta da admissão para o parto ou nos seis primeiros meses após o parto e/ou diagnóstico de doença definidora de AIDS. As crianças cujas mães preencherem os critérios acima e que se apresentarem para seguimento nos serviços cadastrados poderão ser incluídas no estudo. A inclusão será feita no momento da primeira consulta e concluído quando a situação de infecção pelo HIV estiver definida. Será considerada não infectada a criança que não apresentar manifestações clínicas de doença indicativa de AIDS e tiver dois testes de Elisa para o HIV não reagentes realizados a partir do 6° mês de vida, ou duas quantificações de RNA viral com resultado abaixo do nível de detecção sendo pelo menos uma delas realizada após o 4° mês de vida ou dois testes de PCR DNA negativos realizados após a 2ª semana de vida. Será considerada infectada a criança que apresentar manifestações clínicas de doença indicativa de AIDS e/ou tiver dois dos seguintes testes positivo-reagentes, colhidos em duas ocasiões diferentes: testes de Elisa para o HIV realizados a partir do 15 ° mês de vida, ou quantificações de RNA viral com resultado acima do nível de detecção sendo pelo menos uma delas realizada após o 1 ° mês de vida ou PCR DNA positivos realizados após a 2ª semana de vida. Todas as crianças acompanhadas no serviço e que preencherem os critérios de inclusão deverão ser incluídas, a fim de evitar erros na observação e cálculo da taxa de transmissão. PLANO DE COLETA E ANÁLISE DE DADOS: Uma ficha de registro padronizada será utilizada para a coleta de dados em todos os centros envolvidos. Espera-se que cada centro designe uma pessoa que ficará responsável pelo registro dos dados e pela comunicação com o coordenador do projeto, além do envio de todo o material via e-mail, fax e via correio regular. Um relatório com o número de casos incluídos no período e as fichas preenchidas deverá ser enviado para a coordenação do projeto ao final de cada mês mesmo na eventualidade de não haver casos novos incluídos no período, cada unidade participante deverá enviar o relatório mensal ao coordenador do projeto.

Concorrência: Estratégico

População Alvo: Mulher - Criança (TV)

Natureza: ESTUDOS E PESQUISAS

Subnatureza: EPIDEMIOLÓGICA

Produção Científica


Projeto: PROGRAMA REGIONAL DE CAPACITAÇÃO, ENSINO E PESQUISA EM CUIDADOS MATERNO-INFANTIS, ESPECIALMENTE AOS PORTADORES/DOENTESHIV/AIDS
Coordenador: SUZETE MARCHETO CLAUS
Resumo: A Universidade Comunitária de Caxias do Sul (UCS) é uma instituição de ensino superior, comunitária e regional, com atuação na região nordeste do estado do Rio Grande do Sul. Sua atuação se estende para 70 municípios, compreendendo uma população de mais de um milhão de habitantes. Com mais de 31 mil alunos, denter os 55 cursos de graduação oferecidos pela UCS, temos os cursos de medicina, enfermagem, farmácia, biologia, fisioterapia e educação física. Como universidade comunitária, a UCS procura manter-se em permanente diálogo com a sociedade. O presente projeto, pela sensibilização e capacitação dos profissionais de saúde da graduação e pós-graduação, incluindo seu staff no primeiro momento, tem por principal objetivo ampliar a oferta de profissionais de saúde de outros serviços de saúde da área de abrangência da UCS. Este projeto se estende aos profissionais do serviço de diagnóstico, previsto na implementação do laboratório que será também um centro de treinamento para profissionais da área, e os profissionais das Unidades Básicas de Saúde (coleta e aconselhamento).

Objetivo: OBJETIVO GERAL: Contribuir de forma significativa para a qualificação de ações de promoção, prevenção e assistência a saúde de gestantes e recém-nascidos, especialmente os acometidos por HIV / AIDS, bem como para a qualificação do ensino e da pesquisa nesta área. OBJETIVO ESPECÍFICO - Definir e capacitar (técnica e pedagogicamente) a equipe instrutora do programa. - Criar infra-estrutura necessária para a realização das atividades do programa treinamento, pesquisas e qualificação do ensino. - Capacitar profissionais de saúde em âmbito regional para o cuidado materno-infantil com ênfase na prevenção e detecção da HIV/AIDS. - Qualificar a estrutura dos campos de estagio de alunos de graduação e pós-graduação dos cursos da área da saúde bem como os cuidados realizados pela equipe dos serviços de saúde. - Produzir conhecimentos na área materno-infantil de forma a subsidiar o ensino e os serviços de saúde.

Metodologia: - Constituir equipe de docentes e de apoio para o desenvolvimento de atividades do programa Definir coordenador Definir pessoal de apoio Definir docentes para realizar capacitações - Adequar estrutura física e ambiental para a realização de capacitações, pesquisas e qualificação do ensino Equipar e mobiliar área para apoio administrativo do programa no Bloco S - Centro de Ciências Bio1ógicas e da Saúde Equipar e mobiliar sala de aula para realização de capacitações nas dependências do Bloco S - Centro de Ciências Bio1ógicas e da Saúde Equipar e mobiliar gabinetes médicos nas Unidades Básicas de Saúde de Galópolis e Vila Ipê Equipar e mobiliar sala contígua ao gabinete médico para treinamento e ensino (Unidade Básica de Saúde de Galópolis e Vila Ipê) Equipar e mobiliar sala de suporte para pesquisa no Centro de Ciência Biológicas e da Saúde - Realizar treinamento técnico e pedagógico da equipe do programa - Implantar Projeto Piloto de capacitação das equipes de profissionais e alunos que atuam nas duas Unidades Básicas de Saúde da rede de serviços públicos da Secretaria Municipal de Caxias do Sul, (onde já são desenvolvidas além da assistência materno-infantil, atividades de ensino e pesquisa de alunos de vários cursos da área de saúde) - UBS Galópolis e UBS Vila Ipê. - Ampliar a realização de capacitações para as equipes dos serviços de saúde do SUS em âmbito regional

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: APOIO À ESTRUT. DE NÚCLEOS DE PESQUISA CLÍNICA

Produção Científica


Projeto: Prospecção Nacional de Competências e Parcerias para Consolidação de Plataforma Tecnológica de P&D em Novos Medicamentos para HIV/AIDS no Brasil.
Coordenador: CELIO LOPES SILVA
Resumo: O Brasil produz 9 medicamentos ARV (empresas públicas e privadas nacionais) para o tratamento de pessoas com HIV/AIDS, mas estes produtos são quase todos da primeira geração, fazendo com que seu consumo seja cada vez maior face a sua utilização nesses últimos 8 anos. Dispomos de 15 medicamentos ARV com gasto estimado de R$ 516 milhões. Quase 60% desses gastos são com medicamentos importados, pois são os produtores de segunda e última geração. O compromisso governamental com o tratamento dos pacientes com AIDS faz com que cada ano, 2 a 3 novas moléculas estejam sendo lançadas no mercado internacional para ser utilizadas, em conjunto, com as já existentes ou em substituição de alguma que já não e mais eficaz. O país possui vários laboratórios farmacêuticos que só desenvolvem a Farmacotécnica e poucos a Farmo-Química mantendo a dependência internacional da matéria prima para a confecção do medicamento. Temos um pequeno numero de laboratórios qualificados para validação de farmoquímicos e medicamentos prontos. Por outro lado, é fato que o país dispõe hoje de uma infraestrutura de produção de medicamentos de importante impacto na saúde publica e que, embora tenha pesquisa de alta relevância na área, ela esta concentrada na Academia e Institutos de Pesquisas e esta dispersa em todo o território nacional e não consegue transformar os resultados destas pesquisas em inovações e disponibilizar os respectivos resultados e benefícios para a sociedade. Alem do mais, o Brasil precisa de planejamento estratégico para viabilizar a inovação na área de P&D de novos medicamentos para suprir o mercado nacional e exportar para outros países. A nossa percepção e que existe uma lacuna entre o setor de pesquisa e o setor produtivo. Este elo da cadeia, responsável pelo desenvolvimento tecnológico de produtos em fase pre-comercial e de estudos c1fnicos, e de fundamental importância e necessita preencher todos os requisitos necessários de exigências regulatórias para produtos que pretendam chegar ao mercado farmacêutico mundial. E consenso que a pesquisa na área de novos fármacos no Brasil esta limitada aos muros das universidades e centros de pesquisas que, pela sua natureza institucional não fazem estudos pré-clínicos de maneira adequada e desenvolvimento de escala e produção. Por outro lado, a indústria do setor, embora em fase de crescimento e contando com pouca disponibilidade de recursos humanos qualificados, investe muito pouco em P&D. Alem disso, e de conhecimento notório os problemas de desenho institucional e de estrutura jurídica e legal que impedem instrumentos de gestão mais adequados a transferência de tecnologia, tanto nas instituições publicas como na privada. Apesar de já contarmos com varias instituições preocupadas com os problemas expostos acima e originado documentos consolidados, eles contemplam principal mente o setor produtivo estatal. Neste contexto, uma ação prioritária e a elaboração de estudos prospectivos sobre as atividades de P&D, ensaios pré-clínicos e clínicos, arranjo institucional e estrutura jurídica que norteiam a matéria e aspectos regulatórios, estudos estes que possam subsidiar políticas publicas e privadas para preencher a lacuna hoje existente entre o setor de pesquisa e o setor produtivo. Numa primeira etapa, a proposta do presente projeto e a constituição de um grupo de trabalho para elaborar um documento que sintetize as necessidades e oportunidades de diferentes atores envolvidos ao tema. As reflexões produzidas serão divulgadas nos meios acadêmicos, governamentais e empresariais e disponibilizadas a sociedade para uma discussão mais ampla do tema e tomada de decisões. Serão realizados estudos circunstanciados, envolvendo especialistas da academia, governo, empresas e sociedade civil, visando a elaboração de documento, sob a coordenação do Programa Nacional de DST/AIDS, REDE TB e empresa NANOCORE, para fornecer subsídios na formulação de políticas multisetoriais e definição de prioridades e critérios para alocação de recursos e definição de estratégias para desenvolvimento tecnológico de novos medicamentos para HIV/AIDS no Brasil.

Objetivo: Identificar as competências instaladas (infra-estrutura, equipamentos, capacitações e RH); Apontar as deficiências e os setores a serem implementados; Sugerir sobre formas de investimentos necessários para implantação de um programa nacional de P&D de medicamentos ARV; Fornecer subsídios para implementação de redes de P&D e de Centros de Referência; Disponibilizar um banco de dados dos grupos de pesquisa e principais líderes.

Metodologia: Para a elaboração desse projeto serão considerados pontos fundamentais como: (i) a situação atual nas áreas internacionais e nacionais quanta ao impacto dos avanços na área de novos fármacos, a aquisição de tecnologia desenvolvida no exterior; a caracterização do parque industrial de medicamentos, a legislação acerca das atividades governamentais na área de medicamentos e a política de investimentos em P&D; (ii) a capacitação técnica e científica nacional para P&D e os gargalos existentes para transferência de tecnologia; (iii) a legislação vigente e os impasses que dificultam a interação entre academia e empresa; (iv) os problemas relacionados com a gestão da propriedade intelectual no setor; (v) 0 fato das empresas nacionais não aderirem as atividades de P&D na área de medicamentos; (vi) estratégias para formação de redes de pesquisa, formação de recursos humanos, infraestrutura, plataformas de desenvolvimento tecnol6gico e ensaios clínicos. Os coordenadores devem identificar e detectar consultores e montar equipes de trabalho que seja representativa de todos os setores envolvidos na área de P&D de novos medicamentos. Áreas: P&D, gestão, legislação, RH, empreendedores e produção. Realizar reuniões de trabalho e um seminário técnico envolvendo as partes interessadas na busca de resultados elou proposições do Programa de DST/AIDS e REDE TB para a definição de novas estratégias para a sociedade e governo na área de novos medicamentos. Os consultores deverão pertencer aos diferentes setores envolvidos no processo de P&D, gestão, legislação, RH, produção e responsáveis por políticas públicas e empresariais nessa área. Elaborar um documento final consolidando o conjunto de proposições de P&D e de política governamental e empresarial para os setores envolvidos. Organizar evento para divulgação do documento junto à comunidade acadêmica, empresarial, sociedade e governo, e contando com a mídia no processo de divulgação. Estrategia: Estabelecer parceria entre a REDE TB e a Empresa NANOCORE para análise e emissão de relatórios e pareceres sobre processos, capacidade instalada, exigências regulatórias, P&D de produtos e processos e transferência de tecnologia na área farmacêutica. Identificar e contratar parceiros externos (nacionais e internacionais) para suprir necessidades existentes ate a total adequação do projeto. Visita aos locais prospectando as capacidades e os gargalos em cada uma das áreas importantes para o projeto. Visita aos órgãos reguladores e entidades envolvidas com TT e fomento a pesquisa.

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: DESENVOLVIMENTO TECNOLÓGICO

Subnatureza: AVALIATIVA/OPERACIONAL

Produção Científica


Projeto: ESTUDO DE REVALIDACAO DA ABORDAGEM SINDRÔMICA E DE PREVALÊNCIAS DAS DST NO RIO DE JANEIRO
Coordenador: LUIZA MARIA FIGUEIRA CROMACK
Resumo: Este será um estudo transversal com componentes descritivos e analíticos. - Serão identificados dois serviços de referência que atendam regularmente casos de DST segundo as normas do Ministério da Saúde, para que se possa alcançar o total de amostras previstas e para o atendimento, em referência, dos eventuais casos de DST detectados nas outras populações investigadas. Esses serviços deverão ter capacidade para a realização de alguns exames de laboratório simples, como a fresco e Gram. - Serão identificadas duas clínicas de pré-natal. - Serão selecionadas tantas indústrias quantas forem necessárias para o alcance da amostra. As empresas devem ser de pequeno porte, não podem ter serviço médico no local, nem tampouco programas permanentes de prevenção de qualquer tipo e devem pertencer aos seguintes setores da indústria de transformação: metalúrgicas, têxteis, calçadistas, eletro/eletrônicas, alimentícias, bebidas e gráficas Será identificado e implementado um laboratório de saúde pública que seja referência da rede, para o processamento das amostras coletadas;

Objetivo: OBJETIVOS GERAIS: - Determinar, em gestantes, a prevalência de sífilis, gonorréia, clamídia, tricomoníase, hepatites B e C, herpes simples 2 e HPV (segundo as normas estabelecidas, será oferecido o teste anti-HIV, porém os resultados não se prestarão à determinação da prevalência do HIV nessa população). - Determinar em industriários do sexo masculino, a prevalência de sífilis, gonorréia, clamídia, tricomoníase, hepatites Be C e herpes simples 2 - Revalidar o método de manejo sindrômico das DST por meio da determinação da sensibilidade e valor preditivo positivo dos fluxogramas desenvolvidos e já validados. - Determinar, em homens e mulheres com sintomas e/ou sinais de DST, nas respectivas síndromes, as freqüências relativas de gonorréia, clamídia, sífilis, herpes simples, cancro mole, tricomoníase, vaginose bacteriana, candidíase e os principais subtipos de HPV de alto e baixo risco de câncer. - Determinar, em homens e mulheres com sintomas e/ou sinais de DST, as prevalências de HIV, sífilis, gonorréia, clamídia, tricomoníase, herpes simples 2, HPV, hepatites B e C

Metodologia: Coleta de amostras e testes de laboratório: Sangue: de todos os homens e mulheres, independente da queixa ou do motivo da consulta; devera ser centrifugado; com uma parte do soro será feito 0 RPR no local. O soro restante será armazenado a 20°C negativos e depois transportado para o laboratório de referencia, onde será feito a titulação e o Elisa confirmatório para sífilis (apenas nos RPR positivos), as sorologias especificas para hepatites B e C, HSV2 e HIV. Urina: de todos os homens, independente da queixa ou do motivo da consulta; devera ser armazenada a 20°C negativos e depois transportada para o laboratório de referencia, onde será feito o LCR para Neisseria gonorrhoeae e Chlamydia trachomatis e o PCR para Thricomonas vagina/is. Material cervico-vaginal (ectocervix, fundo de saco posterior e lateral): de todas as mulheres, independente da queixa ou do motivo da consulta; deverá ser coletado com escovas e espátulas especificas para a realização de LCR para gonorréia e clamídia, PCR para tricomonas e Papanicolaou. Material vaginal (fundo de saco lateral e posterior) de todas as mulheres portadoras de corrimento vaginal também será coletado para a realização dos testes habituais de Gram e a fresco para vaginose bacteriana (escore de Nugent) e candidiase, teste da amina (KOH) e pH; Material de ulceração: de todos os pacientes, homens e mulheres, portadores de ulcera genital; devera ser coletado com escova ou espátula especial para a realização do PCR Multiplex (para detectar Treponema pallidum, Haemophi/us ducreyi e Herpes Simplex Vírus 2); Material de verrugas anogenitais: de todos os portadores, homens e mulheres; será coletado raspado para realização da captura hibrida para o HPV; se a lesão estiver queratinizada, biopsiar. Material genital: de alguns pacientes selecionados por amostragem sistemática, homens (sulco balanoprepucial) e mulheres (ectocervix, fundo de saco posterior e vulva), que tenham sintomas elou sinais compatíveis com DST, com exceção de verrugas anogenitais; será coletado raspado para realização da captura hibrida para o HPV, com o objetivo de se determinar a prevalência dessa infecção nos portadores de outras DST. Sistemática: Em cada serviço participante haverá profissionais treinados para: o acolhimento, realização da triagem, realização de entrevista para as orientações e esclarecimentos sobre as características do estudo, assinatura dos termos de consentimento (encontrados no Anexo F) e inicio do preenchimento dos questionários (encontrados nos Anexo G). Estarão disponíveis também médicos, enfermeiros e auxiliares para o atendimento clinico e coleta dos materiais biológicos que serão encaminhados para os testes de laboratórios previstos. TRIAGEM: realizada por um profissional de saúde treinado que identificara o motivo da consulta, a síndrome apresentada e avaliara os critérios de inclusão e exclusão. ENTREVISTA: realizada por profissional de saúde especialmente treinado. Neste momenta o paciente que aceitar participar do estudo assinara um termo de consentimento livre e esclarecido especifico, conforme Resolução 196 do CNS. A seguir o profissional iniciara o preenchimento de um questionário especifico. CONSULTA E COLETA DE AMOSTRAS: realizada por medico ou enfermeiro que, ao mesmo tempo em que realiza a consulta, Ira completando os dados do questionário. Neste momento serão coletadas amostras para os exames laboratoriais. A coleta de sangue devera ocorrer em local especifico existente em cada centro. TRATAMENTO: será feito imediatamente, segundo as normas do Ministério da Saúde, de acordo com os critérios estabelecidos pela abordagem sindromica de casos de DST (Manual de Controle das DST - MS, 3a edição, 1999). Os parceiros (as) dos portadores de corrimento uretral, ulceração genital deverão ser comunicados pelo (a) próprio (a) paciente para comparecerem ao serviço. Nos casos de corrimento vaginal, os parceiros serão comunicados somente apos confirmados a caso como sendo de cervicite ou tricomoniase. RETORNO: será agendado para acompanhamento clínico, comunicação dos resultados dos exames, orientação e adequação do tratamento (se necessária) Laboratórios: O laboratório de saúde publica de referencia para a rede identificada se encarregara de receber, processar e emitir em formulário especifica as resultados de todas as amostras coletadas nos centros participantes do estudo. O controle de qualidade externa dos testes e procedimentos será realizado par meio da avaliação, em amostragem aleatória, de 20% das amostras de cada centro, durante a execução do estudo. Havendo mais de 5% de discordância, a laboratório recebera uma visita de inspeção para solucionar a problema, alem do que todas as outras amostras do centro em questão serão reavaliadas no L1CM/NDI/UFES. Atividades preparatórias: Será feito um treinamento para os profissionais de saúde dos serviços visando a padronização de procedimentos e critérios para coleta e acondicionamento de materiais, alem da execução dos testes do pH vaginal e das aminas (KOH, ao teste do cheiro). Também serão feitos treinamentos de padronização para os profissionais de laboratório dos serviços em: exame a fresco, coloração de Gram e outras colorações, para identificação de "clue cells" da vaginose bacteriana, tricomoniase, candidiase, bastonetes intracelulares (Haemophilus ducreyi) e corpúsculos de Tzank (HSV). A pesquisa será precedida par um estudo pilato que incluirá um reduzido número de pacientes. Durante sua execução serão identificadas e corrigidas as dificuldades não previstas neste protocolo ou nos manuais de campo. Coordenação do projeto: A coordenação geral do estudo estará a cargo da Unidade de Epidemiologia da CN-DST/Aids, do Ministério da Saúde, que terá a responsabilidade de preparar e organizar a infra-estrutura e logística, supervisionar a coleta e realizar a entrada de dados, analisar os dados e preparar um documento final a ser apresentado e discutido em um seminário com todos as participantes e outros interessados. Um coordenador local que, em articulação com o coordenador nacional, terá a responsabilidade de selecionar os serviços, selecionar os profissionais participantes, preparar e organizar a infra-estrutura e logística, supervisionar a coleta dos dados e dos materiais biológicos, garantir o transporte das amostras para o laboratório de referencia, alem de checar toda a informação e garantir seu envio ao coordenador nacional do estudo. Um coordenador de laboratório que, em articulação com o coordenador local, será responsável pelos procedimentos no laboratório de saúde publica de referencia local (recepção das amostras, execução das provas, emissão dos resultados em formulário especifico e envio de amostras para o laboratório de referencia nacional do estudo) alem de supervisionar a qualidade da coleta nos serviços participantes. Poderá ser identificado um auxiliar para as tarefas em cada laboratório. Um coordenador de unidade, que será o responsável pelas atividades relacionadas ao estudo em cada serviço participante. Poderá ser identificado um técnico do laboratório ou outro profissional do serviço para auxiliar na coleta, identificação e transporte das amostras, alem da realização das provas mais simples, que serão executadas no local. As informações coletadas nos questionários serão concentradas na coordenação nacional do projeto e terão dupla entrada num banco de dados elaborado em Epiinfo 6.04c. Para comparar as proporções encontradas serão utilizados as testes Qui quadrado e Exato de Fischer. Proporções simples serão utilizadas para determinar as prevalências. Para associação dos fatores de risco e infecções, analise multivariada por regressão logística. Homens e mulheres com sintomas e/ou sinais de OST, de qualquer faixa etária, em primeira consulta para o problema atual, que não tenham recebido tratamento ou utilizado par conta própria qualquer antibi6tico ou tratamento t6pico nos últimos 15 dias. Serão excluídos aqueles que conhecerem sua soro positividade para o HIV ou, por esse motivo, estiverem em acompanhamento pelo serviço. Homens com sintomas de uretrite: n = 100 Homens e mulheres com ulceração genital no Maximo 100 homens e, no mínimo, 20 mulheres Mulheres com corrimento vaginal: 420 Homens e mulheres com verrugas anogenitais: 60 homens e 60 mulheres Gestantes: 600 Por sua dimensão e ineditismo em termas de alcance dos objetivos, alem da enorme complexidade operacional, este estudo certamente apresenta alguns riscos. Ao ser envolvido um coordenador geral, quatro serviços de saúde publicam com pelo menos seis profissionais de saúde dedicados em cada, um laboratório de referencia, com dais profissionais envolvidos na execução dos testes, pode-se ter uma idéia das dificuldades que serão encontradas. Entretanto, com um adequado planejamento das ações e a realização dos treinamentos para padronização de métodos e procedimentos alem da disponibilização de recursos materiais em quantidades meticulosamente calculadas, pode-se dizer com alguma segurança que os riscos de falhas e problemas serão reduzidos significativamente. A revalidação da abordagem sindrômica e a estabelecimento de uma linha de base de freqüências relativas das principais DST permitira que seja implantado um sistema de monitoramento o que, par sua vez garantira um adequado planejamento das ações de intervenção. Ao mesmo tempo, a introdução dos mais modernos métodos diagnósticos Ira necessariamente qualificar a rede de laborat6rios de saúde publica e serviços de referencia. Será elaborado um documento final a ser apresentado e discutido em um seminário com todos os participantes e outros interessados. Esse documento também será objeto de uma publicação especifica a ser editada pela Coordenação Nacional de DST e Aids, alem de originar artigos específicos a serem publicados em periódicos especializados. O coordenador geral do estudo figurara como investigador e autor principal em todas as publicações; serão co-autores os coordenadores locais e o coordenador geral das atividades de laboratório; todos os demais figurarão como colaboradores e serão citados nominalmente. Será solicitado o termo de consentimento livre e esclarecido (Anexos 1, 3 e 5) a todos as participantes do estudo, conforme Resolução 196 do CNS, bem como será garantida a total confidencialidade das informações. Os participantes menores de 18 anos desacompanhados de seus responsáveis assinarão 0 consentimento juntamente com uma testemunha. No caso de ser gestante, 0 marido ou a parceiro (união consensual) poderá assinar a documento. Todos os portadores de sintomas ou sinais de DST passarão par uma avaliação clinica completa; receberão, assim como seus parceiros(as), tratamento apropriado e gratuito, orientações e aconselhamento relacionados as DST e a infecção pelo HIV; receberão, também, preservativos e instrução para o seu uso. Ha riscos físicos mínimos de hemorragia e equimoses durante a coleta de sangue. Também pode haver desconforto nos exames ginecológicos com especulo. Para os indivíduos positivos para sífilis que concordarem em receber a tratamento, ha um risco pequeno de ocorrência de reações de alergia a penicilina. Serão providos medicamentos alternativos para essas situações. Ha um risco psicol6gico relacionado a natureza de algumas das perguntas constantes do questionário, que será aplicado em locais adequados, por profissionais de saúde treinados e, sempre que possível, do mesmo sexo do paciente.

Concorrência: Estratégico

População Alvo: Portadores de DST

Natureza: ESTUDOS E PESQUISAS

Subnatureza: EPIDEMIOLÓGICA

Produção Científica


Projeto: PREVALÊNCIA DE INFECÇÃO POR CHLAMYDIA TRACHOMATIS EM CASAIS ATENDIDOS EM AMBULATÓRIO DE ESTERILIDADE CONJUGAL.
Coordenador: CARLOS ALBERTO DE SA MARQUES
Resumo: A incidência das diversas DST em nosso país é desconhecida A Coordenação Nacional de DST/AIDS estima uma existência de 1.967.200 casos novos a cada ano de infecção por Clamidia, sendo 3,5% no sexo feminino e 2,32% no sexo masculino. Em 1999, segundo a Organização Mundial de Saúde (OMS) foram estimados 92 milhões de casos novos de infecção por C. trachomalis, sendo que 9,5 milhões ocorreriam na América Latina e Caribe. Nos EUA estima-se entre 3 a 4 milhões de casos novos a cada ano. Em virtude de ser a infecção por c1amidia, na maioria das vezes, assintomática, o CDC e a Associação Americana de Saúde Social recomenda o rastreamento rotineiro em todas as mulheres sexualmente ativas, visando prevenir os danos causados à saude reprodutiva dessas mulheres. Os estudos que mostram a prevalência de doença c1amidiana indicam um enorme intervalo (0,6% a 20,2%) demonstrando que foram realizados em populações variadas e por diversas metodologias, não oferecendo um valor médio confiável. Conhecer a real prevalência de infecção genital por C. trachomatis em casais que procuram tratamento para esterilidade, será um estudo com um elevado grau de confiabilidade, podendo servir como parâmetro para a investigação rotineira do casal infértil, caso sejam identificados fatores epidemiológicos específicos; além de propiciar o tratamento de uma patologia que cursa insidiosamente, que pode estar interferindo negativamente no tratamento da esterilidade conjugal e, que, ainda, pode culminar com o acometimento de uma DlPA. Os danos ocasionados à saude reprodutiva decorrente de uma DlPA são, por vezes, irreversíveis, determinando esterilidade permanente; Sem contar o enorme custo financeiro envolvido no tratamento desta patologia e das suas seqüelas.

Objetivo: OBJETIVO GERAL: Estabe1ecer a prevalência de infecção genital por Chlamydia trachomatis em casais que procuram tratamento para esterilidade. OBJETIVOS ESPECÍFICOS: - Verificar a correlação de doença clamidiana e a causa básica de esterilidade que acomete o casal; - Determinar a presença ou não de sintomatologia associada aos casos positivos; - Identificar dados epidemiológicos; - Investigar se há concordância de positividade entre parceiros.

Metodologia: Realizar-se-á um estudo descritivo no qual será investigada a infecção genital por Chlamydia trachomatis em 100 casais que comparecerem espontaneamente ao ambulatório de Esterilidade. A pesquisa laboratorial será realizada por Polimerase Chain Reaction (PCR) em amostra de primeiro jato urinário nos homens, e em material da cérvix uterina nas mulheres. Serão exc1uídos os casais em que um dos cônjuges esteja usando, ou tenha usado nos últimos 15 dias: antibióticos, corticosteróides, imunossupressores e creme vaginais. PLANO DE COLETA E ANÁLISE DE DADOS: As informações serão colhidas através de uma ficha elaborada especificamente para registro dos dados dos casais pesquisados, bem como através de dados obtidos no prontuário médico do Hospital Agamenon Magalhães. Os dados coletados serão introduzidos em um arquivo de banco de dados do programa Epi Inf06, versão 6.04b, permitindo a análise das variáveis de interesse.

Concorrência: Estratégico

População Alvo: População em Geral

Natureza: ESTUDOS E PESQUISAS

Subnatureza: EPIDEMIOLÓGICA

Produção Científica


Projeto: AVALIAÇÃO NACIONAL DA DISPENSAÇÃO DE MEDICAMENTOS PARA AS PVHA.
Coordenador: MARIA AUXILIADORA OLIVEIRA
Resumo: A formulação do projeto contempla as orientações presentes na Resolução CNS 196/96 (Brasil, 1996), e será submetido ao Comitê de Ética em Pesquisa da Escola Nacional de Saúde Pública para apreciação.

Objetivo: Geral: Avaliar a qualidade da dispensarão de medicamentos anti-retrovirais (ARV) e medicamentos para infecções oportunistas (MIO) no Brasil, focalizando os aspectos de estrutura e processo, bem como os resultados relativos à satisfação dos usuários, considerando os principais fatores do contexto organizacional que influenciam estas relações. Específicos: Identificar, por tipo, número e situação geográfica, as unidades dispensadoras de medicamentos ARV no Brasil; Descrever os componentes da Assistência Farmacêutica, executados nestas unidades relacionados ao abastecimento, focalizando especificamente gerenciamento, armazenamento, prescrição de antiretrovirais, distribuição/dispensação, uso e sua adequação a parâmetros de Boas Práticas; Analisar a satisfação dos usuários quanto ao processo de dispensação; Caracterizar o perfil de alguns atores participantes no processo de cuidado a PVHA, quanto a sua formação e qualificação para a atividade desempenhada e opinião quanto a Assistência Farmacêutica ao publico alvo, quais sejam: prescritores, dispensadores e gestores. Caracterizar as diversidades locais dentro de diferentes contextos organizacionais e sua influencia nos componentes da AF mensurados e sobre a satisfação dos usuários e opinião dos atores institucionais re1evantes; Propor instrumento de monitoração da dispensação de medicamentos as PVHA para uso dentro da prática gerencial de rotina; Fornecer subsídios para os tomadores de decisão quanto à formulação de propostas de intervenção para a adequação do atendimento as necessidades dos clientes.

Metodologia: A realização do estudo prevê a determinação de dados relativos a estrutura disponível (recursos materiais e humanos), aos processos (serviços e atividades) pertinentes a produção dos efeitos esperados e aos principais resultados da dispensação de ARV e MIO, assim como dos fatores de contexto mais diretamente relacionados ao elementos estudados. O projeto tem por objetivo descrever, explicar ou desenvolver uma intervenção (Contandriopoulos et al., 1997). O marco conceitual do projeto tem origem no trabalho de Avaliação da Farmácia Básica no Brasil, publicado em 2000 (Cosendey, 2000). Outros trabalhos que se seguiram foram também fonte para a formulação deste projeto (Oliveira et al., 2002; Marin et al., 2001; Luiza, et al.). Propõe o modelo de pesquisa sintética, pela abordagem de casos múltiplos com níveis de análise imbricados quanto a abordagem da organização do nível municipal. Segundo Contrandriopoulos et al. (1997:45) "nas pesquisas sintéticas, a validade interna baseia-se na capacidade de um estudo testar, de rnaneira simultânea, um conjunto de relações, compondo um modelo teórico". Trata-se de uma pesquisa avaliativa, na medida em que busca compreender, por meio de procedimentos científicos as relações existentes entre os diferentes componentes do acesso a medicamentos essenciais, dentro do referente proposto. O modelo proposto inclui elementos da avaliação normativa, já que se baseia em padrões e normas consagrados nacional e internacionalmente e da pesquisa avaliativas, na medida em que busca compreender as diferentes relações explicativas no modelo 1ógico proposto. Os níveis de analise a serem abordados no estudo dizem respeito às três esferas de governo com interferência no processo, assim como aos principais atores envolvidos - usuários, prescritores, dispensadores e gestores.

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: AVALIATIVA/OPERACIONAL

Produção Científica


Projeto: IMPLEMENTAÇÃO DA INFRA-ESTRUTURA NO LABORATÓRIO DA PREFEITURA MUNICIPAL DE PORTO ALEGRE PARA SUPORTE ÀS INICIATIVAS DE PREPARAÇÃO DE SÍTIOS CLÍNICOS PARA PESQUISA CLÍNICA E ESTUDOS COM VACINAS HIV/AIDS.
Coordenador: LUCIENE CARDOSO SCHERER
Resumo: O projeto se propõe a implantar, no laboratório Central do município de Porto Alegre, infra-estrutura adequada para coleta e preparação de amostras de sangue para biologia molecular e criopreservação de células infectadas por HIV de pacientes atendidos no serviço de referência em DST/AIDS deste município. As amostras serão crio preservadas e armazenadas para eventuais análises de em estudos clínicos como de eficácia de produtos vacinais assim como estudos de caracterização molecular do HIV circulante nesta região. Esta infra-estrutura além da capacitação da unidade como um sítio primário de coleta e recrutamento de voluntários em estudos preparatórios para testes com vacinas, permitirá a colaboração em projetos de caracterização do HIV, da história natural de uma coorte de serviço público, bem como em projetos de pesquisa clínica como na avaliação de produtos para controle do HIV. A estruturação deste laboratório possibilitará parcerias com diversas instituições públicas de pesquisa, tais como o Instituto Adolfo Lutz (SP) e Fiocruz (RJ, BA) entre outras instituições nacionais além de parceiras em redes de pesquisa internacionais.

Objetivo: Geral: Implementar a infra-estrutura necessária para coleta e criopreservação de amostras de pacientes recrutados para estudos de eficácia de produtos vacinais e em estudos de caracterização molecular. Específicos: Obter equipamentos Iaboratoriais necessários a criopreservação de células, bem como o seu armazenamento implantar a lnfra-estrutura necessária para a coleta de amostras e criopreservação de células infectadas visando o suporte a ensaios clínicos de vacinas e ensaios de caracterização molecular; Desenvolver metodologias laboratoriais que possam contribuir no entendimento molecular do vírus; Capacitar e qualificar profissionais de saúde nesta área da saúde pública; Cooperar com outros núcleos de pesquisa do país com o objetivo de desenvolvimento institucional; Contribuir na monitoração da variabilidade do HIV em populações com evidência de infecção recente, e/ou outras populações de interesse epidemiológico; Permitir estudos da diversidade viral e a evolução doença e resposta a medicação; Criar infra-estrutura para analisar molecularmente regiões virais que possam estar relacionadas à epitopos utilizados em ensaios de vacina.

Metodologia: Local do recrutamento de pacientes O Serviço de Assistência Especializada em DST e HIV/AIDS (SAE) e um dos serviços que constitui o Centro Municipal de Atendimento em DST e HIV/AIDS e destina-se a prestar assistência de saúde, a nível ambulatorial, aos portadores do HIV/AIDS, HTLV e outras doenças sexualmente transmissíveis. Este serviço atende em tomo de 4000 pacientes por trimestre. Este serviço prevê a assistência integral dos pacientes HIV positivos sendo referencia para o município de Porto Alegre e localiza-se na mesma unidade de saúde que o laboratório. Local de coleta de amostras para armazenamento e criopreservação O laboratório Central do município de Porto Alegre, que localiza-se no Centro de Saúde da Vila dos Comerciários (CSVC), atende mensalmente em tomo de 4000 pacientes, gerando em tomo de 25000 exames por mês. O laboratório realiza exames nas áreas de bioquímica, hematologia, bacteriologia, imunologia, citometria de fluxo e carga viral, atendendo principalmente aos Programas de DSTI AIDS, Assistência Pré- Natal e Tuberculose. O laboratório apresenta as seguintes características técnicas: 12 auxiliares de laboratório, 8 farmaceuticos-bioquimicos, 4 estagiários de nível médio e 1 auxiliar administrativo; Software gerenciador de resultados, contendo um banco de dados de todos os exames realizados desde julho de 2003, possibilitando a assinatura eletrônica de exames, o envio de resultados por e-mail, o levantamento de dados epidemiológicos através de relatórios estatísticos, alem de diversas peculiaridades técnicas; Interfaciamento de Resultados Laboratoriais; Automação em todos os setores do laboratório; Identificação de materiais biológicos com código de barra. Gerenciamento do sítio primário O gerenciamento do sítio primário será realizado pelo coordenador do projeto. Recrutamento dos pacientes De acordo com os critérios de inclusão proposto nos estudos provenientes de cada instituição parceira, os pacientes serão recrutados no ambulatório de DST/AIDS, através de clínicos treinados. Os clínicos serão responsáveis pela eleição dos pacientes que participarão no estudo, pelo preenchimento das fichas clínicas e encaminhamento dos pacientes aos auxiliares de pesquisa apresentarão o termo de consentimento aos pacientes, supervisionados por um técnico clínico e o termo de consentimento será assinado neste momento, e os pacientes encaminhados ao laboratório. Banco de Dados Todos os prontuários do ambulatório de DST/AIDS serão cadastrados em EPI- INFO, através de formulário padronizado, disponibilizando os dados clínicos e laboratoriais para análise estatística. Os auxiliares de pesquisa cadastrarão os prontuários dos pacientes. Coleta e preparação de amostras No laboratório os seguintes procedimentos serão realizados: Recepção dos pacientes Coleta das amostras de sangue em tubos apropriados Identificação do projeto e das amostras Separação de soro e/ou plasma Separação de alíquotas Armazenamento das amostras em freezer - 70ºC ou LN2 Extração de RNA e retrotranscrição em cDNA Procedimentos de Criopreservação, Congelamento e Descongelamento de células infectadas (de acordo com protocolos utilizados no Laboratório Avançado de Saúde Pública (LASP)/CPqGM/Fiocruz/ Bahia, de acordo com treinamento realizado pelo Ministério da Saúde, Coordenação Nacional de DST/ AIDS. Envio das amostras as instituições de pesquisa envolvidas Análise dos dados A partir da análise dos dados será possível o fortalecimento de inter-institucional e um maior entendimento da epidemiologia, patogênese e história natural do HIV. Período do Estatuto Uma vez que o sítio primário seja implantado com a infra-estrutura adequada para a aplicação de projetos inter- institucionais, a coleta de amostras poderá ser iniciada a partir de Março de 2004, após a devida aprovação pelas instâncias pertinentes. Consentimento Esclarecimento Será utilizado o Consentimento Esclarecimento proposto por cada estatuto que utilizar o sítio primário de coleta de amostras em sua versão final após aprovação pelo Comitê de Bioética das instituições participantes. Esses voluntários, caso consistam por consentimento obtido durante 0 seguimento, poderão ter também material biológico mantido em unidades públicas participantes para uso no desenvolvimento de estudos relacionados ao desenvolvimento de vacinas contra 0 HIVI AIDS. Integração com o Sistema Único de Saúde - SUS O sítio para pesquisa cIínica e testes com microbicidas ou produtos vacinais contra o HIVIAIDS desenvolvera suas ações conjuntamente com o Política Municipal DST/AIDS de Porto Alegre, Gerência Estadual e Coordenação Nacional. As atividades cotidianas estarão vinculados com as do Serviço de Referência Municipal e demais unidades de saúde pertencentes ao SUS, em esfera municipal, estadual e nacional, caso necessário. Possibilitando assim acesso e disponibilização desses recursos e das informações geradas neste sitio, assim como contribuir na prestação de serviço da comunidade científica e população geral.

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: APOIO À ESTRUT. DE SÍTIOS PARA TESTES COM INSUMOS ESTRATÉGIC

Produção Científica


Projeto: OBTENçÃO E AVALIAÇÃO DE REAGENTES PADRONIZADOS PARA ESTUDOS COMPARATIVOS DE NEUTRALIZAÇÃO DO HIV-I.
Coordenador: VERA BONGERTZ
Resumo: Como única participante brasileira da reunião da OMS - UNAIDS sobre padronização de metodologias de neutralização do HIV (WHO-UNAIDS Meeting on "Progress in the Development and Standardization Methods to Measure anti-HIV-I Neutralizing Antibodies in HIV Vaccine Research and Clinical Trials'', Milão, Itália, Instituto San Raffaele. concordei em tentar obter soros e/ou plasmas de pacientes infectados por HIV-I para a produção de pelo menos 300ml de cada pool. Como indicado na lista acima, concordei em tentar obter pools de plasmas B (encontrado no mundo inteiro), Bbr (mais freqüentes na América do Sul), C (diferentes na America e na África) e F1 (mais freqüentes no Brasil). O Laboratório de AIDS e Imunologia Molecular vem trabalhando há muitos anos no polimorfismo genético e antigênico do HIV-I. Neste período, vários projetos de pesquisa foram realizados, e a análise gênica e antigênica do HIV-I de um grande número de pacientes em tratamento/observação pelo Instituto de Pesquisas Evandro Chagas da FIOCRUZ (IPEC/ FlOCRUZ) foi realizada. Para obtenção de plasmas de indivíduos infectados com o genótipo C, contatos com 0 LACEN da Prefeitura Municipal de Porto Alegra, Rio Grande do Sul e com a Dra. Maria Elizabeth Menezes do Laboratório DNAnálise de Florianópolis foram tomados. Pacientes infectados com os subtipos B, Bbr e F serão selecionados de estudos anteriores realizados pelo Laboratório de AIDS e Imunologia Molecular da FIOCRUZ, em tratamento e observação no Instituto de Pesquisa Evandro Chagas, FIOCRUZ e pacientes que procurem atendimento no Hospital Nereu Ramos de Florianópolis e do LACEN de Porto Alegre serão convidados a participar deforma voluntaria do estudo proposto. Em 07 de agosto de 2003, fui convidada a participar de uma reunião da OMS - UNAIDS sobre padronização de metodologias de neutralização do HIV (WHO-UNAIDS Meeting on "Progress in the Development and Standardization Methods to Measure anti-HIV-I Neutralizing Antibodies in HIV Vaccine Research and Clinical Trials"), Milão, Itália, Instituto San Raffaele. Nesta reunião, da qual participaram pesquisadores de 15 Institutos de Pesquisa de 13 países diferentes, além do Coordenador e Vice-Coordenador do grupo "Pesquisa de Vacinas Virais" da OMS-UNAIDS, foi decidido que uma rede formada pelos participantes do Encontro testaria as 7 técnicas ora em uso para a determinação da neutralização do HIV-I usando os mesmos reagentes, a fim de permitir a seleção de uma metodologia sensível e reprodutível (e, de preferência, de baixo custo e curto tempo de executivo) para permitir a avaliação de testes de vacinas. Uma das conclusões do Encontro foi à necessidade do uso de misturas (pools) de soros de indivíduos soropositivos para o HIV-I, já que não e possível obter a quantidade necessária para uma análise internacional de 14 laboratórios de apenas um individuo. Os pools obtidos seriam testados pela Dra. Terry Wrin (membro da Rede, Virologia, EUA) e, caso apresentarem neutralização satisfatória do HIV-I (vários genótipos, o que, conforme S Zolla-Pazner e V. Bongertz, que trabalharam com vários pools, e provável), distribuídos por Harvey Holmes (Natls Inst Bioi Standards & Control. UK) a todos os membros da Rede. Foi concluído também que pools de plasmas obtidos de indivíduos infectados com subtipos diferentes de HIV-I (genótipos A I. A 2, B, variante Bbr, variante B', C, D, E, FI e F2) deveriam ser obtidos para distribuição aos diversos laboratórios da rede. Ate o momento não é conhecida nenhuma correlação entre genótipo e "neutrotipo", porém sabe-se que há agrupamentos de genótipos com susceptibilidade I potência de neutralização similar, como A/F/B (S Zolla-Pazner, V. Bongertz). E (L. Morris), C/D (P Kaleebu), porém os estudos realizados até o momento envolvem um número pequeno de isolados virais, e necessita ser confirmado. Para a preparação destes pools, foi sugerida a mistura de estoques de soros ou plasmas de indivíduos infectados pelo HIV-I disponíveis aos diversos componentes da Rede. Entretanto, o volume mínimo de será pelo indivíduo seria de 1ml. Foi verificado que poucos laboratórios dispunham de tais estoques, já que materiais obtidos para os diversos projetos de pesquisa geralmente eram consumidos quase que totalmente. Portanto, foi decidido formar os seguintes pools de plasmas: (I) de indivíduos infectados misturados indiscriminadamente (África/America/Europa/Ásia). (2) A1 / A2: Africano, (3) B: Norte-Americano, Europeu e Brasileiro, (4) B: Tailandês, (5) Bbr: Brasileiro, (6) C: Africano, Brasileiro (7) D: Africano, (8) E: Tailandês, (9) F1: Brasileiro, (10) F2: Africano, (II) G: Africano, (12) H: Africano. Também foi decidido usar isolados primários padrões de HIV-I, 2 a 4 de cada subtipo. O projeto pretende a formação dos pools de soros e plasmas e o isolamento de cepas padrão de HIV-I.

Objetivo: Geral: Preparo de material (pool de soros e/ou plasmas e isolados de HIV-1) para padronizar e comparar as técnicas de Neutralização do HIV-1 ora em uso nos diversos laboratórios. Específicos: Aproveitar o projeto internacional de padronização da neutralização do HIV-1 para um estudo de caracterização imunológica de isolados primários de HIV-1 do subtipo genético C (tema de uma tese de doutorado, vide abaixo).

Metodologia: Como única participante "brasileira" (trabalhando no Brasil) da reunião OMS - UNAIOS sobre a padronização de metodologias de neutralização do HIV (WHO-UNA IDS Meeting on "Progress in the Development and Standardization Methods to Measure anti-HIV-1 Neutralizing Antibodies in HIV Vaccine Research and Clinical Trials", Milão, Itália, Instituto San Raffaele, concordei em tentar obter soros e/ou plasmas de pacientes infectados por HIV-1 para a produção de pelo menos 300ml de cada pool. Como indicado na lista acima, concordei em tentar obter pools de plasmas B (encontrado no mundo inteiro), Bbr (mais freqüentes na America do Sul), C (diferentes na America e na África) e F1 (mais freqüentes no Brasil). Preparação de pool geral de soros anti-HIV-1 (Pool 1) Um total de 30 pacientes infectados com HIV-1 em acompanhamento pelo IPEC, em bom estado de saúde (com números de linfócitos CD4 no sangue periférico de pelo menos 400 / mm3), que não estão em tratamento com medicamentos antiretrovirais serão convidados a participar. Preparação de pool de soros de pacientes infectados com os diferentes subtipos de HIV-1(Pools 2 a 5) A análise de resultados de projetos anteriores será usada para a seleção de pacientes infectados com os diversos subtipos genéticos de HIV-1 e, em parte, previamente analisados quanto a detecção de anticorpos neutralizantes. Listas dos números de prontuário, agrupadas segundo os genótipos de HIV-1, serão encaminhados ao IPEC. Os médicos realizarão então uma seleção dos pacientes listados, para convidarem pacientes em bom estado de saúde (preferencialmente sem terapia anti-retroviral) a participarem do projeto. Cerca de 20 pacientes serão convidados a participar para a produção dos pools B, Bbr e F. Cerca de 80 pacientes serão convidados a participar para a produção do pool C. O número elevado de pacientes a serem convidados para a preparação do pool de soros C deriva da necessidade de genotipar os vírus em questão, antes da inclusão no estudo, já que poucos estudos de genotipagem foram efetuados na região sul do Brasil em indivíduos que não pertenciam ao grupo de gestantes infectadas pelo HIV-1. Isolamento de HIV-1 Será feita a tentativa de isolamento de isolados primários de HIV-1 dos indivíduos infectados com genótipo conhecido, que não estejam sob terapia antiretroviral (serão poucos) e que estejam em bom estado clínico (com pelo menos 400 linfócitos T CD4 por mm3 de sangue periférico). Será feita a tentativa de isolamento viral do sangue de todos os pacientes provenientes da região Sul do Brasil. Tipagem de HIV-1 Amostras não genotipadas anteriormente, provenientes de Porto Alegre, RS ou de Florianópolis, SC, serão tipadas por HMA, sob orientação da Dra. Mariza G Morgado. Neutralização de HIV-1 Metodologias já tradicionais e métodos novos serão utilizados. Para a metodologia já usada em rotina no Lab. AIDS e Imunologia Molecular, a inibição da replicação de isolados primário s de HIV-1 em células mononucleares de sangue periférico observada após pre-incubação do HIV com os pools de plasma produzidos será avaliada pela produção extra-celular de antígeno p24, quantificado por kits comerciais (Bongertz et al. 2002). Uma metodologia nova, usando linhagens celulares U87 transfectadas com o receptor e os co-receptores de HIV-1 (CD4 e CCR5 ou CXCR4) que, ao se infectarem com HIV-1 formam sincícios, e onde a quantificação das placas sincícios e proporcional a concentração viral, com (neutralização) ou sem (controle positivo) pre-incubação com os pools de plasmas (Shi et al. 2002). Esta segunda metodologia (quantificação de placas de sincícios em células U87 transfectadas) foi estudada por ocasião de uma viagem financiada pela WHO-UNA IDS em outubro deste ano, para o laboratório da Dra. Eva-Maria Fenyö, da Universidade de Lund, onde a técnica foi desenvolvida. As células estão disponíveis no Lab. AIDS e Imunologia Molecular por doação da Dra. EM Fenyö por ocasião do Workshop de Caracterização e Neutralização do HIV-1 recentemente realizado no Lab. AIDS e Imunologia Molecular (WHO sponsored workshop on "Application of Methods for Biological and Immunological Characterization of HIV strains in HIV Vaccin-Related Research in Latin America and the Caribbean", to be held from 16-22 November 2003). Preparação de pool geral de soros e plasmas anti-HIV-1 (Pool 1) Pacientes infectados com HIV-1 em acompanhamento pelo IPEC, em bom estado de saúde (com números de linfócitos CD4 no sangue periférico de pelo menos 500/ mm3), que não estão em tratamento com medicamentos antiretrovirais serão convidados a doarem cerca de 50 ml de sangue (30 ml a serem colhidos com anticoagulante citrato ou EDTA e 20ml a serem colhidos sem anticoagulante), alem do material colhido rotineiramente para os exames de acompanhamento (em geral, 5 ml para hemograma, e 5 ml para quantificação de linfócitos T CD4 e T CD 8 e determinação da carga viral). O sangue será colhido, após aprovação do paciente, por ocasião das visitas regulares dos pacientes para acompanhamento da carga viral e número de linfócitos T CD4 positivos, não exigindo visitas especificas dos pacientes ao Hospital. Os soros e plasmas serão separados no Laboratório e armazenados até a obtenção de um volume total de pelo menos 500 ml (aproximadamente 30 pacientes participantes). Preparação de pool de soros e plasmas de pacientes infectados com as diferentes subtipos de HIV-1 (Pools 2 a 5) Pools de soros e plasmas B (Pool 2), Bbr (Pool 3) e F (Pool 4): a análise de resultados de projetos anteriores permitira a seleção de pacientes infectados com as diversos subtipos genéticos de HIV-1. Listas dos números de prontuário, agrupadas segundo as genótipos de HIV-1 serão encaminhados aos colaboradores do IPEC, onde será a seleção dos pacientes, para serem convidados as pacientes em bom estado de saúde (>400 C04 / mm3) a participarem do projeto. Cerca de 20 pacientes serão convidados a participar para a produção de cada pool: 20 do HIV-1 subtipo B clássico, 20 da variante Bbr do subtipo B e 20 do genótipo F. Solicitaremos a doação de 50 ml de sangue de cada individuo (30 ml a serem colhidos com anticoagulante citrato ou EDTA, para preparação do pool de plasmas e para a isolamento viral e 20 ml a serem colhidos sem anticoagulante para a produção do pool de soros). Para a preparação destas misturas de soros e plasmas, provavelmente pacientes em terapia anti-retroviral devem ser incluídos, para obtenção dos volumes necessários. Para prevenir a interferência dos antiretrovirais nas análises de neutralização viral, concentrados de imunoglobulinas serão preparados destes plasmas por precipitação com sulfato de amônio (Harvey Holmes, UK). Indivíduos infectados com HIV-1 residentes na região a Sul do Brasil, onde a subtipo C de HIV-1 e prevalente (Pool 5) (Santa Catarina e Rio Grande do Sul) serão convidados a participar pelos médicos dos respectivos Institutos baseados apenas em seu estado de saúde (preferencialmente indivíduos que não estão sob tratamento com antiretrovirais). Solicitaremos a doação de 50 ml de sangue de cada individuo (30 ml a serem colhidos com anticoagulante citrato ou EDTA, para preparação do pool de plasmas e para a isolamento viral e 20 ml a serem colhidos sem anticoagulante para a produção do pool de soros). Tipagem do HIV A genotipagem do HIV-1 de plasmas de indivíduos residentes na região sul do Brasil (Santa Catarina e Rio Grande do Sul) será realizada como descrito par Delwart (1993) (vide Guimarães et al. J Clin Virol 21(2) 143-151,2001). Isolamento de HIV-1 Será feita a tentativa de isolamento de isolados primários de HIV-1 de indivíduos infectados com HIV-1 de genótipo conhecido, que não estejam sob terapia antiretroviral (serão poucos) e que estejam em bom estado clínico (com pelo menos 400 linfócitos T CD4 par mm3 de sangue periférico). A metodologia a ser usada e a metodologia padronizada da OMS-UNAIDS, versão 2002, que recomenda a co-cultivo de células mononucleares periféricas do paciente com células mononucleares periféricas pré-ativadas (com fitohemaglutinina), durante 28 dias, com alimentações (com células normais) e testes de antígeno viral semanais. Neutralização Viral Metodologias já tradicionais e métodos novas será a utilizados. Para a metodologia já usada em rotina no Lab. AIDS e Imunologia Molecular, a inibição da replicação de isolados primários de HIV-1 em células mononucleares de sangue periférico observada após pre-incubação do HIV com os pools de plasma produzidos será avaliada pela produção extra-celular de antígeno p24, quantificado par kits comerciais (Bongertz et al. 2002). Uma metodologia nova, usando linhagens celulares U87 transfectadas com o receptor e as co-receptores de HIV-1 (CD4 e CCR5 ou CXCR4) que, ao se infectarem com HIV-1 formam sincícios, e onde a quantificação das placas de sincícios e proporcional a concentração viral, com (neutralização) ou sem (controles) pré-incubação com as pools de plasmas (Shi et al. 2002). Isolados primários brasileiros com genótipo conhecido (B, Bbr, C e F) assim como isolados primários recebidos do repositório central (Inglaterra) dos subtipos A, B, B', C, D e E serão testados quanta a susceptibilidade a neutralização por pools de plasmas mistos e pools de plasmas específicos para cada genótipo/variante de HIV-1 (produzidos no Brasil ou recebidos da Inglaterra).

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: ESTUDOS E PESQUISAS

Subnatureza: AVALIATIVA/OPERACIONAL

Produção Científica


Projeto: Preparação de sítios para testes com microbicidas ou produtos vacinais contra o HIV/AIDS: Monitoramento da evolução da patogênese viral através do seguimento de uma população infectada pelo HIV .
Coordenador: PAULO RICARDO DE ALENCASTRO
Resumo: O projeto se propõe a preparar unidades do SUS da região metropolitana de Porto Alegre para participar de testes de eficácia com produtos vacinais ou microbicidas contra a AIDS. Este projeto pretende contribuir na obtenção de dados preliminares sobre a evolução clínica usual e favorecer a identificação e a organização da infra-estrutura necessária a esta atividade. Ainda, acompanhar a evolução dos infectados em estudos e tanto um compromisso com os voluntários destes estudos como uma necessidade de vigilância em saúde pública. Tanto a avaliação da eficácia patogênica como o seguimento destes voluntários implica na preparação desta rede de suporte. Este projeto devera atuar nesta área através da caracterização e geração de infra-estrutura de pesquisa em unidades locais que atuam junto a uma população de voluntários soropositivos para HIV. A padronização do monitoramento clínico-laboratorial, que será à base de estudos clínicos como com produtos vacinais, será implementada e avaliada. Serão recrutados 200 indivíduos da população que apresente testes sorol6gicos positivos para o HIV em serviços públicos, em especial no Serviço de Assistência Especializada do Complexo Hospitalar Sanatório Parthenon, participante ativo, do esforço estadual de preparação para vacinas contra HIV/Aids. Estes indivíduos, que são rotineiramente encaminhados aos serviços de saúde para seguimento clínico usual, serão convidados a participar de um seguimento monitorado. Os voluntários que concordarem e assinarem consentimento esclarecido participarão de seguimento clinico que envolvera, adicionalmente aos testes laboratoriais, visitas, consultas individuais ou em grupo para trabalhar adesão, investigação através de questionários, avaliações laboratoriais e retornos extras que possibilitarão responder as diferentes questões deste estudo. Independentemente da participação no estudo, os indivíduos serão avaliados quanto a necessidade de tratamento e farão usa de medicamentos conforme o consenso vigente de usa de medicamentos antiretrovirais combinados (disponível em www.aids.gov.br/assistencia).

Objetivo: Geral: Organizar e documentar o seguimento de indivíduos com diagnóstico recente de infecção pelo HIV que utilizam o serviço participante e testar a hipótese de que existe um impacto imunológico, definido aqui como o percentual de queda anual do número de linfócitos T CD4+ durante a infecção, distinta, entre indivíduos infectados por variantes HIV-1C em relação a indivíduos infectados com variantes HIV-1 B. Específicos: Avaliar o incremento do set point viral durante a fase pré-tratamento; Determinar em uma amostragem destes pacientes o percentual de subpopulações de células e de memória na entrada e sua correlação com a evolução clínica; Avaliar a resposta (queda de Carga Viral e nível de CD4) ao tratamento em sua fase precoce (primeiras semanas) e tardia (24 e 48 semanas); Avaliar a evolução da diversidade do gene pol durante o tratamento.

Metodologia: Estudo observacional , de acompanhamento de coorte, prospectivo com voluntarios que consintam neste seguimento por consentimento esclarecido. Amostra Pacientes em seguimento no serviço associado SAT Sanatório Parthenon serão seguidos conforme os procedimentos usuais, sendo convidados aqueles que preencherem os critérios inclusão com infecção recente ou até 200 casos incluindo aqueles com diagn6stico recente e CD4>400/mm3. Voluntários serão recrutados pelos médicos do serviço participante e colaboradores, serão apresentados aos detalhes do estudo e se consentirem por escrito após lerem atentamente ao consentimento informado, farão entrevista padronizada e seguirão plano de retornos regulares com 0 registro de dados clínicos laboratoriais em banco de dados específico para o acompanhamento dos participantes deste estudo. Termo de Consentimento Livre e Esclarecido (TCLE) Será utilizado o Consentimento Esclarecido em sua versão final após aprovação pelo Comitê de Ética das instituições participantes. O modelo proposto pode ser visto no anexo 1. Esses voluntários, caso consintam por consentimento obtido durante o seguimento, poderão ter também material biológico mantido no repositório de unidades públicas participantes para uso no desenvolvimento de estudos relacionados ao desenvolvimento de vacinas contra 0 HIV/AIDS. O TCLE informara sobre 0 armazenamento de amostras para a realização de alguns testes a posterior, mas já previstos no projeto, ou seja, o isolamento e seqüenciamento viral, a identificação de infecções recentes pelo método conhecido como "detuned", e a quantificação da resposta CD8+ específica através de técnicas de ELISPOT. Critérios de Seleção Inclusão: Indivíduos infectados pelo HIV-1, com 18 anos ou mais, que ap6s ler e assinar 0 consentimento esclarecido concordarem em participar do estudo. Exclusão: Gestantes; Menores de 18 anos; Indivíduos sob efeito de drogas ou álcool ou com problemas psiquiátricos que os impeçam de decidir sobre a participação no estudo. Viremia total (Carga Viral) Plasma separado em tempo real menor que 6h deverá ser clareado em microspin refrigerada a 10.000 rpm por 3 min e aliquotado. Alíquotas de 500 ul a 1 ml serão armazenadas para posterior detecção de número de moléculas de RNA por amplificação isotérmica (Nasba, OT, Holanda) quando for necessário complementar ou confirmar as quantificações da rotina de seguimento. O método de quantificação utilizado será o estabelecido para a região do sítio clínico disponível na rede publica, podendo ser baseado em uma das metodologias comerciais; de DNA ramificado (Bayer); por quantitativo (Roche) ou Nuclisens (Organon Tecknika). Seqüenciamento genético RNA viral no plasma, concentrado por centrifugação, seguido de extração por solução de trizol e retrotranscrito em amplificação isotérmica (42°C) por 1 h na presença com enzima superscript II, hexametros rand6micos, dNTPs será a fonte primordial de material genético para analises. Alternativamente, lisado celular (DNA) equivalente a 1 milhão de células mononucleares será utilizado como fonte de DNA genômico após digestão com Proteinase K e purificação. Reação de PCR sera realizada para amplificar o material genético viral. Cada mistura de reagentes incluirá 10 pmol de cada oligonucleotideo iniciador (primers). Os primers utilizados incluirão: F1 (gttgactcagattggttgcac), F2 (gtatgtcattgacagtccagc), F3 (tatcaggatggagttcataac), F4 (ggatggcccaaaagttaaac), K1 (cagagccaacagccccacca), K2 (ttccccactaacttctgtatgtcattgaca), K3 (ggggcatccattcctggctttaattt), DP10 (taactccctctcagaagcaggagccg), DP11 (ccattcctggctttaattttactggta), DP16 (cctcaaatcactctttggcaac), DP17 (aaaatttaaagtgcagccaat), os quatro nucleotídeos trifosfatados, MgCI2, enzima termoestável e tampão da reação. A reações de amplificação serão realizadas em um volume final de 20-100 ul. Três ambientes fisicamente separados serão utilizados para minimizar contaminação. A etapa de seqüenciamento e interpretação será a preconizada pelo sistema adotado. O seqüenciamento das regiões env serão realizadas com um par de primers, selecionados a partir dos seguintes: EDS (atgggatcaaagcctaaagaaatgtg), ED 12 (agtgcttcctgctgctcccaagaacccaag), ES7 (tgtaaaacgacggccagtctgttaaatggcagtctagc), ES8 (aggaaacagctatgacccacttctccaattgtccctca), V3i3 (atgaattctgggtcccctcctgagga), V3iS (ataagcttgcagtctagcagaagaaga), V30ut (3'atgaattcattacagtagaaaaattccc) e V30ut (5'ataagcttcaatgtacacatggaatt). Um dos primers internos aos utilizados na reação de PCR sera adicionado ao produto purificado por etanol e isopropanol em conjunto com reagentes (big dye) com dideoxinucleotideos validados para uso com equipamento de seqüenciamento disponibilizado ao IAL, ABI 377. A corrida de até 7 horas permitirá a obtenção de seqüências nas duas orientações (3' e 5') a serem editadas em programa específico do aparelho (Navigator) ou disponibilizados no LACEM (phred, DNA Star) e analisadas em programas públicos disponibilizados na Internet, incluindo o programa BLAST disponibilizado no site da HIVNET do Laboratório Nacional Americano de Los Alamos para determinação de eventuais contaminações (http://hiv-web.lanl.govl, e em programas específicos para mutações associadas a resistência aos anti-retrovirais, HIV-Seq (http://hiv-4.stanford.edu/cgi-bin/hrp-asap-web.pl ). Serão seqüenciados todos os caso de infecção recente e uma amostragem dos casos de infecção crônica selecionados a partir da evolução clínica e laboratorial. Quantificação de Células CD4+ e CD8+ e estudo fenotípico celular por citometria de fluxo A quantificação de marcadores de subpopulações celulares T CD4+ e T CD8+. Será realizada seguindo as instruções do fabricante. Em uma parte da população em seguimento uma análise mais detalhada das características fenotípicas e funcionais destas células será realizada, envolvendo a determinação de parâmetros como a CD4SRA CD4SRO e marcadores de ativação celular de CD8+, CD62L HLA-DR e CD38. Resumidamente, as amostras serão coletadas em tubos com EDTA (acido etilenodiaminotetracetico, Becton-Dickinson, San Jose, CA, EUA) em temperatura ambiente, sendo adicionados a 100 µl de sangue total, 5 µl de anticorpo monoclonal conjugado com FITC (isotiocianato de f1uoresceina), Cy5 ou PE (ficoeritrina). Repositório de amostras As amostras colhidas periodicamente dos participantes do estudo, autorizadas expressamente no TCLE serão utilizadas na determinação sorológica voltada a confirmação do diagn6stico de infecção pelo HIV, na estimativa do tempo de infecção, atraves de testes Elisa de baixa sensibilidade e na obtenção de cDNA viral quando aplicável, o isolamento viral e a caracterizar;:ao biológica do HIV-1. Estas amostras serão crio preservadas para a formação de um reposit6rio com a finalidade de serem submetidas, a posteriore, e na dependência de financiamento específico, a testes que poderão auxiliar no desenvolvimento de produtos vacinais voltados para esta população e em estudos correlatos, envolvendo a caracterização virologia e imunol6gica da infecção pelo HIV, relevantes ao estudo do controle do HIV por vacinas contra o HIV/Aids. Estes estudos podem incluir a caracterização de HLA e receptores de membrana, estudo de clones CD8 citotóxicos e a utilização, a partir da seqüência genética deduzida do HIV isolado, de clonagem de DNA em plasmidios para expressão de proteínas em sistemas celulares como CHO. Serão priorizadas as variantes incidentes mais representadas, variantes do HIV-1 B de importância no País, como com GWGR na alça V3 e de variantes não-B. As amostras estarão disponíveis aos voluntários para eventuais usos, não previstos pelo conhecimento disponível, mas que possam vir a ser de algum benefício (e.g. uma putativa auto vacina ou determinação de padrão evolutivo viral ancestral), quando a pedido do paciente e com o acordo da os tramites e autorização pertinentes pelas Instituições envolvidas. Todos os estudos adicionais com este material biológico deverão ser autorizados por comitês de bioética e comitês científicos das instituições envolvidas. Os resultados laboratoriais serão analisados em conjunto com dados epidemiológicos dos sítios. Ensaio de Elisa de baixa sensibilidade As amostras de plasma serão previa mente analisadas segundo algoritmo de diagnóstico sorológico do HIV recomendado pelo Ministério da Saúde. Amostras com positividade confirmada serão submetidas a um ensaio de Elisa modificado para pré-selecionar aquelas potencial mente provenientes de pacientes com infecções recentes. Esta seleção sera realizada atraves do usa do conjunto de diagnóstico Vironostika HIV-1 Microelisa System, um Elisa licenciado pelo Food and Drug Adminstration (FDA) para uso em diagnóstico sorológico do HIV-1. No Brasil este teste e usado apenas em pesquisa. As amostras de plasma são diluídas 1:20.000, incubadas com conjugado reconstituído (50 mL de diluente com 1 envelope de ENZABODY conforme instruções do fabricante). Cada ensaio em placa inclui a reação de pelo menos três controles negativos, controles positivos e calibradores, fornecidos pelo CDC, que permitem calcular a sensibilidade da ligação dos anticorpos das amostras no final do teste. A primeira incubação e feita a 37ºC por 30 minutos, seguida de lavagem imediata, sendo uma segunda incubação realizada em condições similares, seguida de uma lavagem da placa e finalmente uma terceira incubação com substrato por 10 minutos em temperatura ambiente. Após a finalização da reação pela adição de 150 uL de solução stop, que para a reação, a placa elida em um leitor de Elisa na faixa de 405 mm. O cálculo do resultado e realizado a partir da média dos três controles negativos mais 0.270. A densidade óptica estandardizada (SOD) corresponde a densidade óptica (DO) da amostra menos a media das DO dos controles negativos divididas pela media da DO dos calibradores. Uma SOD igual ou menor que 1.5 sugere possível amostra de infecção recente, sendo esta confirmada em ensaio em triplicata. Este ensaio confirmatório testaria as amostras biológicas em três diluições. Ensaios válidos são aferidos tanto pela DO dos controles positivos, negativos (de acordo com as especificações do fabricante) como pelos calibradores, que tem que apresentar uma DO não ajustada igual ou superior a 0.200. Os resultados serão oficialmente apresentados ao PN DST/AIDS e divulgados em simpósios, seminários e congressos nacionais e internacionais, onde o tema seja pertinente. Se a avaliação dos dados obtidos justificarem, será preparado artigo para publicação em revista indexada, de preferência internacional.

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: APOIO À ESTRUT. DE SÍTIOS PARA TESTES COM INSUMOS ESTRATÉGIC

Produção Científica


Projeto: NOVAS FORMULAÇÕES E NOVOS ADJUVANTES PARA VACINA CONTRA HIV/AIDS.
Coordenador: CELIO LOPES SILVA
Resumo: O Instituto do Milênio REDE TB, em parceria com a empresa NANOCORE, estão capacitados a fazer estudos de imunogenicidade, testes pre-clínicos e produção em escala ou lote piloto em condições GMP de novas vacinas ou imunomoduladores, como os adjuvantes, e fazer transferência de tecnologia incluindo o treinamento de pessoal, para participar do projeto de desenvolvimento de uma vacina para HIV/AIDS. Some-se a isto a adequação da infra-instrutora, controle de qualidade e tecnologia para P&D estabelecidas nessa instituição. Essa experiência, bem sucedida e (mica no Brasil, foi obtida com o desenvolvimento de uma vacina de DNA profilática e terapêutica para tuberculose (Nature 1999), que já se encontra em testes clínicos em humanos e bovinos. Além disso, a REDE TB conta com o apoio logístico do Centro de Pesquisas em Tuberculose da FMRP-USP, diversas instituições de pesquisa no Brasil e no exterior, rede de nanobiotecnologia e empresas de base biotecnológica como a NANOCORE. Em síntese, temos uma plataforma tecnológica e capacidade instalada para: (i) produção em escala ou lote piloto (adequando-as conforme as necessidades), com área física compatível com as exigências das boas normas de produção (GMP) e capacidade de controle de qualidade interna do produto final, das etapas de produção e dos testes preliminares de imunidade; (ii) Estabelecer os componentes necessários para o desenvolvimento dos diversos aspectos relacionados a vacinas anti-HIV; (iii) Estabelecer estratégias para a avaliação da segurança, imunogenicidade e eficácia de produtos candidatos a vacinas anti-HIV preventivas e imunoterapeuticas; (iv) Estabelecer políticas e processos para planejamento, desenvolvimento, e disponibilização de vacinas seguras, eficazes e custo acessível para prevenir a infecção pelo HIV; (v) Implementar, monitorar e administrar as atividades de pesquisa relacionadas a produtos candidatos a vacina anti-HIV; (vi) Identificar instituições acadêmicas e de pesquisa nacionais e internacionais e agencias internacionais para colaborar no esforço para o desenvolvimento e a avaliação de produtos candidatos a vacina anti-HIV; (vii) Avaliar a atual capacidade das instituições nacionais para realizar as atividades de pesquisa necessárias, incluindo atividades de P&D e transferência de tecnologia para o setor produtivo. Uma produção local e particularmente importante em dois aspectos: devido à presença da variação de subtipos regionais do HIV; e devido à limitada capacidade de produção mundial; (viii) Identificar as necessidades e custos para reforçar à infra-estrutura e treinar pessoal para executar todas as atividades de pesquisa necessárias para os testes de produtos candidatos a vacina anti-HIV no Brasil. A eficácia de uma vacina pode ser aumentada pela formulação, a qual refere-se a forma final para administração in vivo. Um dos maiores desafios atuais na área de vacinologia e o desenvolvimento de formulações vacinais de dose (mica, contendo adjuvante potente e eficaz, que possam ser administradas sem o uso de seringas, estáveis à temperatura ambiente e que possam na mesma formulação trabalhar com 0 conceito de "prime - boots". Esse conceito vem sendo trabalhado pela REDE TB e NANOCORE é é objeto da presente proposta. Além do antígeno, a formulação pode conter adjuvante e outros excipientes. Por adjuvante entende-se qualquer material que, juntamente com o antígeno, estimule a resposta imune efetiva. De forma geral, os adjuvantes podem agir sobre o antígeno, sobre as células hospedeiras envolvidas na resposta imune ou sobre ambos. Apesar da grande variedade de compostos que vem sendo estudados, setenta anos apos a introdução dos sais de alumínios como adjuvantes apenas lipossomas foram aprovados para uso em humanos. Então, apesar do considerável progresso, esta limitação da disponibilidade de adjuvantes e a certeza de que sistemas cada vez mais complexos que permite estimular resposta efetiva e duradoura serão a base das vacinas modernas e torna mister o desenvolvimento de tais sistemas bem como a avaliação da sua eficácia, segurança e o entendimento do seu mecanismo de ação, para a possível aplicação desses sistemas em vacinas para HIV/AIDS. Dentro da presente proposta, a utilização de micro esferas poliméricas biodegradáveis surgiu então como uma nova abordagem para otimização e aumentar a imunogenicidade de vacinas. As microesferas são um sistema matricial no qual o antígeno a ser encapsulado esta dissolvido ou disperso. Estas partículas são constituídas de poliésteres do ácido lático e glicólico (PLGA), que já são utilizados na clínica humana e possuem a vantagem de serem biodegradáveis. Além disso, sua potencialidade de utilização como adjuvante reside também no fato de formarem, apos administração subcutânea ou intramuscular, um deposito onde o antígeno e liberado lentamente de acordo com o polímero utilizado na sua fabricação. A velocidade de hidrolise de tais polímeros depende: de sua composição química; da proporção dos monômeros; do tamanho da cadeia e do tamanho das partículas, podendo-se obter tempos de degradação que variam entre 2 semanas e 24 meses, aproximadamente. Outra característica fundamental para a adjuvanticidade das microesferas e o estabelecimento de um direcionamento passive para células fagocitárias. Assim, espera-se contar ao final do projeto com um produto de grau farmacêutico (produzido em condições GMP) para usa em estudo clínico, caracterizado como um sistema vacinal de dose (mica com as seguintes propriedades: Uma formulação contendo um sistema de liberação controlada composto por um carreador inerte (microesfera); um adjuvante que potencie a imunogenicidade da vacina; e o antígeno que pode ser DNA, proteína recombinante ou peptídeos.

Objetivo: Espera-se contar ao final do projeto com um produto de grau farmacêutico (produzido em condições GMP) para uso em estudo clinico, caracterizado como um sistema vacinal de dose (mica com as seguintes propriedades: Uma formulação contendo um sistema de liberação controlada composto por um carreador inerte (microesfera, lipossoma ou nanocapsulas); um adjuvante que potencie a imunogenicidade da vacina; e o antígeno que pode ser DNA, proteína recombinante ou peptídeos; Adaptada para ser administrada por via intramuscular, oral ou intranasal; Que possa liberar os antígenos de maneira controlada e prolongada; Que possa ser usada como vacina de dose única; Que permita o use ou a administração de vacinas combinadas em dose única; Que possa ser usada dentro do conceito de prime-boost, uma das estratégias mais inovadoras na área de vacinas, atualmente. Que possa ser usada com antígenos desenvolvidos no Brasil ou com prot6tipos de vacinas já em desenvolvimento no exterior.

Metodologia: Obtenção de vacinas de DNA, proteínas recombinantes ou peptídeos imunogênicos Vacinas de DNA e proteínas recombinantes serão fornecidas por pesquisadores ligados ao programa DST/AIDS. No Centro de Pesquisa em Tuberculose serão otimizados os processos de obtenção do plasmódio em condições GMP que permitam a obtenção de um material de grau farmacêuticos para estudos pré-clínicos e clínicos. Os peptídeos, selecionados apos reunião de consenso entre os grupos que trabalham com seqüenciamento das variáveis virais (reunião organizada pelo PN-DST/AIDS em 04/2004) e que sejam imunogênicos, serão obtidos por síntese clássica. Os processos de obtenção serão escalonados pela empresa NANOCORE. Encapsulamento do DNA, proteínas e peptídeos, com ou sem adjuvantes em microesferas As microesferas serão obtidas pelo método da emulsão múltipla e evaporação do solvente como descrito anteriormente e de domínio da NANOCORE. Avaliação da eficiência do encapsulamento dos antígenos nas microesferas A taxa de encapsulamento dos antígenos sera determinada adicionando-se, em tubos tipo eppendorf, 10 mg de microesferas e 0,2 ml de NaOH 0,1 M. As amostras serão incubadas em banho de ultrasom 3210 (Branson) por 2 horas a 50°C para permitir a solubilização das microesferas. Após a abertura, as amostras serão diluídas 1: 1 em água destilada. Os antígenos serão quantificados logo em seguida. Os procedimentos serão feitos pela empresa NANOCORE. Determinação da distribuição de diâmetro das microesferas A distribuição de diâmetro das partículas será determinada por difratometria laser utilizando SALD (SHIMADZU). Os resultados serão expressos como valores cumulativos de % sob determinado diâmetro. Os procedimentos serão feitos pela empresa NANOCORE. Ensaio de liberação in vitro As microesferas serão ressuspensas em PBS e postas sob agita9ao constante a 37°C. Serão retiradas alíquotas em intervalos de tempo pré-estabelecidos e a proteína liberada no sobrenadante sera dosada por espectrofotometria como descrito no item 2. Os procedimentos serão feitos pela empresa NANOCORE. Animais Serão utilizados camundongos BALB/c, pesando entre 18-20 gramas, provenientes do Biotério de Animais Isogênicos da Faculdade de Medicina de Ribeirão Preto-USP. Imunizações com os Ags encapsulados em microesferas Camundongos BALB/c receberão por via subcutânea uma dose da vacina associada aos diferentes adjuvantes e encapsulados em microesferas. Os grupos de animais ser80 sacrificados 30 dias e 90 dias apos a imuniza980 para avalia90es imunológicas. Os procedimentos serão feitos pela empresa NANOCORE. Ensaio Imunoenzimático (ELISA) para dosagem de anticorpos A produção de anticorpos sera avaliada por ensaio imunoenzimático ELISA nos soros pré-imunes e em soros coletados 15, 30, 60 e 90 dias apos imunização. Ensaio imunoenzimático (ELISA) para detecção das citocinas As citocinas em celulas do ba90 dos camundongos serao determinadas por ELISA. Ensaio de Linfoproliferação Os ensaios de linfoproliferaçao serão executados de acordo com procedimentos descritos anteriormente. Avaliação da expressão de marcadores de superfície por citometria de fluxo Células do baço e do pulmão de animais imunizados e/ou desafiados serão caracterizadas pela expressão de marcadores de superfície utilizando anticorpos conjugados a fluoroforos. O número de células nas suspensões provenientes dos órgãos citados deve ser acertado para 1 x 107 células 1ml em PBS. A seguir, 100 µl de cada suspensão celular devem ser distribuídos em tubos FACS. As células devem, então, ser incubadas com anticorpo anti-CD16/CD32 (Fc Block™ - PharMingen) na concentração de 0,5 - 0,75µg / 106 células durante 30 minutos, a 4°C para evitar a ocorrência de ligações inespecíficas. Posteriormente, as células devem ser incubadas com os respectivos anticorpos monoclonais de interesse (0,5 - 0,75 µg / 106 células) durante 30 minutos, a 4°C, no escuro. Após o tempo de incubação, as células devem ser lavadas com PBS contendo 2% de soro bovino fetal por tubo, sendo o precipitado celular coletado através de centrifugação a 1500 rpm durante 5 minutos. O sobrenadante deve ser retirado e o sedimento celular ressuspenso em 500 µl de PBS contendo 1 % de formaldeído, para a fixação das células. As preparações celulares serão adquiridas no FACSort (Becton & Dickinson), sendo coletados 10.000 eventos de cada amostra. Dentre as moléculas a serem avaliadas incluen-se CD4, CD8, CD19, Classe II e CD44.

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: TECNOLÓGICA

Produção Científica


Projeto: Preparação para Testes com Vacinas e microbicidas em Curitiba: Infra-estrutura e caracterização preliminar.
Coordenador: MARIANA THOMAZ
Resumo: É reconhecido que o elevado grau de variabilidade genética do HIV-1 ocasiona uma evolução diferencial das variantes virais, com uma regionalização, como sub-epidemias (Coffin, 1992; Morgado, 1994;Sabino, 1996; UNAIDS, 1997; Bongertz, 2000, Soares, 2003; Ezparza, 2003). A diversidade do HIV associada a uma importante variabilidade de seu genoma e a característica fundamental deste retrovírus (Coffin, 1992). A globalização crescente favorece o intercambio de vírus circulantes em regiões diferentes (Quinn, 1996), permitindo tanto a introdução de novas variantes (Louwagie et aI., 1993; WHO, 1994; Fransen ., 1996; Galai , 1997; Gadkari ., 1998;), como a conseqüente recombinação genética destas variantes (Felsenstein & Yokoyama, 1976; Donald 1997, Burke, 1997, Litsola 1998, Carr,2001). O Brasil com diferentes variantes circulantes e um ambiente favorável a esta recombinação. Tais variações podem determinar, diferentes graus de resistência aos anti-retrovirais. O impacto potencial destas variações para o desenvolvimento de vacinas e significativo (UNAIDS, 1998). Com isso, o reconhecimento das características dos vírus circulantes torna-se de fundamental importância para as medidas de controle da epidemia (DIETRICH, 94, Gadkari, 1998), modificações em testes sorológicos usuais tem permitido a identificação de infecção recente (Janssen, 1998) favorecendo o entendimento da dinâmica epidêmica. Um dos estudos que pode contribuir com esta proposta e a determinação dos epítopos virais para células citotóxicas (CTL) específicas para o HIV. A identificação desses epítopos, sua proporções nas diferentes variantes circulantes e a avaliação de sua prevalência para os vírus incidentes poderão, numa etapa posterior, contribuir no desenvolvimento de produtos vacinais adequados a realidade brasileira. Além disso, a estimativa da taxa de incidência do HIV também se coloca como fator importante na tomada de medidas mais efetivas para conter o avanço do HIV/Aids. O reconhecimento das infecções recentes pode contribuir para o aprimoramento das ações de vigilância epidemiológica, assim como permitira o acompanhamento da infecção pelo HIV em indivíduos e na coletividade, o monitoramento de grupos de pessoas HIV negativas com risco acrescido vai permitir a avaliação da soroconversão, em situações em que esta ocorrer, assim como a identificação dos fatores sócio comportamentais associados. O Projeto será desenvolvido na cidade de Curitiba, que conta hoje com 1.700.000 habitantes. O sistema municipal de saúde conta com 105 unidades de saúde, das quais 97 são Unidades Básicas, com 7 referências para atendimento ambulatorial de pessoas vivendo com HIV e Aids. A partir de março de 1999, foi introduzida a testagem de gestantes no pré-natal, com realização de aproximadamente 1300 exames por mês nesta população, sendo encontrada soroprevalência em cerca de 1,0%. Em dezembro de 2003, a testagem para detecção do HIV vem sendo ofertada atraves das Unidades Básicas, com uma media de procura e realização de 2554 exames por mês, e soroprevalência em torno de 2,51%. São realizados cerca de 546 exames por mês no CTA, com soroprevalência de aproximadamente 4,3%. A média de não retorno no CTA para busca de resultados e de 7 %, considerado baixo para os padrões nacionais. A coleta dos exames e descentralizada, com utilização de código de barra, sendo as amostras transportadas ao Laboratório Municipal, o qual realiza cerca de 3.100 exames por mês de anti-HIV, com realização dos confirmatórios, através dos exames Western Blot e Imunofluorescencia. A coleta de CD4 e de carga viral e realizada no próprio laboratório, atendendo cerca de 600 pacientes/mês, servindo de referência para todos os serviços especializados ambulatoriais do SUS em Curitiba, com exceção do Hospital de Clínicas. O tempo médio de entrega de resultados negativos em toda a rede municipal e de 3 a 5 dias e 7 dias para resultados positivos. Além dos atendimentos nos serviços de referência, as equipes médicas das unidades básicas foram recentemente capacitadas a realizar o acompanhamento ambulatorial do portador do HIV assintomático, com protocolo específico.

Objetivo: Geral: Caracterizar aspectos da infecção pelo HIV incidente em Curitiba, com identificação das características sócio comportamentais de voluntários e características moleculares de isolados de vírus circulantes nestas populações. Específicos: Implantar metodologias de biologia molecular no Laboratório em Curitiba para identificação características moleculares de isolados virais; Avaliar o polimorfismo genético do HIV circulante e incidente na área estudada; Estimar a taxa de incidência em amostras HIV+ anônimas desvinculadas da soroteca do Laboratório Municipal; Estruturar o monitoramento da infecção recente em Curitiba e seguimento de pacientes HIV +; Avaliar metodologias de recrutamento e retenção de voluntários HIV negativos de risco acrescido; Estudar os fatores associados, retenção e soroconverção dos voluntários.

Metodologia: O projeto consiste de quatro componentes: a) a estruturação de atividades locais e de referência laboratorial para realização de ações que possibilitem a determinação da freqüência da infecção recente e das características moleculares dos vírus circulantes; b) a seleção de amostras de sangue de pessoas HIV+, de forma anônima e confidencial, para determinação da taxa de incidência e caracterização do vírus incidente; c) a seleção de voluntários HIV negativos, com consentimento livre e esclarecido, com risco acrescido, para monitoramento de risco de infecção pelo HIV e soroconversão. d) Seguimento clínico de todos identificados soropositivos para o HIV nos serviços de saúde associados e, nos casos do que consentirem por escrito, em coorte estruturado com documentação de procedimentos e dados clínico - laboratoriais A metodologia e as técnicas a serem adotadas em relação a estes componentes são, respectivamente: Para a estruturação da referencia laboratorial para a determinação da infecção recente, propõe se implantar etapas locais necessárias a técnicas de Ensaio Imunoenzimático adaptadas a menor sensibilidade, inclusive pela realização dos exames laboratoriais confirmatórios de acordo com o algoritmo proposto pelo Ministério da Saúde. Para a caracterização molecular do vírus circulante, propõe a implantação de técnicas de biologia molecular que permitam a caracterização genotípica do HIV-1. Após a obtenção de consentimento livre e esclarecido para uso do material biológico, as amostras de sangue positivas para o HIV, oriundas de pessoas testadas através do CTA e das UBS, serão testadas novamente, com teste sorológico com metodologia modificada para diminuir a sensibilidade, possibilitando a estimativa de infecção incidente. As amostras encaminhadas ao laboratório, com resultados indeterminados serão submetidas a novos testes. Caso apresentem-se positivas após nova testagem, serão submetidas juntamente com as já confirmadas como positivas a uma testagem com Ensaio Imunoenzimático adaptado para menor sensibilidade. Aquelas que apresentarem densidades ópticas dentro de uma faixa adequada serão retestadas em triplicata, com o objetivo de estimar-se o número de pacientes com infecção recente. 0 material biológico restante será mantido a-lO°C no laboratório, para realização de seqüenciamento genômico em uma amostragem desta casuística. Todos as pessoas com evidencia laboratorial de infecção recente ou crônica serão encaminhados para serviço clínico de referencia para as devidas providencias relativas ao seguimento clínico rotineiro. A identificação de pessoas HIV negativo com risco acrescido, será realizada através da aplicação de questionário sócio comportamental no CTA, com a oferta de participação no estudo (consentimento livre esclarecido) de monitoramento da soroconversão. Uma amostragem destes voluntários será seguida em estudo prospectivo de avaliação de risco e de soro incidência. Pacientes soroconvertores neste seguimento serão encaminhados, para serviço clínico de referencia para as devidas providencias. A análise de dados será feito em conjunto com 0 PN-DST/Aids através do programa Epi - Info e/ou SPSS.

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: APOIO À ESTRUT. DE SÍTIOS PARA TESTES COM INSUMOS ESTRATÉGIC

Produção Científica


Projeto: AVALIACAO DO IMPACTO DO HAART (TERAPIA ANTI-RETROVIRAL ALTAMENTE EFICAZ) NO CONTROLE DA TUBERCULOSE
Coordenador: AFRANIO KRITSKI
Resumo: A pandemia Síndrome da Imunodeficiência Humana (SIDA/AIDS) já acometeu cerca de 30 milhões de pessoas e segundo dados da Fundação Nacional de Saúde do Ministério da Saúde (FNSIMS) em 1999, foram notificados 210.447 casos em todo o território nacional e sendo destes 143.907 (68%) dos casos na região sudeste. Em 1995 e 1996 foi aprovado pelo FDA (Food and Drug Administration) e pelos CDC (Centers of Disease Control) o uso dos inibidores de protease (IP) na terapia antiretroviral (ART), para associações com os inibidores da transcriptase reversa nucleosideos (NRTI) e não nucleosideos (NNRTI), previamente aprovados e em uso corrente ate então. Em nível nacional, entre os IP disponíveis pelo Programa Nacional de DST/AIDS do Ministério da Saúde encontram-se saquinavir, ritonavir, indinavir nelfmavir e amprenavir. Esta classe de medicamentos e considerada a mais potente na terapia antiretroviral atualmente. Entre os principais efeitos encontrados com o uso da ART encontram-se uma significativa reconstituição do sistema imune através da recuperação de respostas linfoproliferativas HIV especificas e patôgeno específicas, além de um aumento gradual na contagem de linfócitos CD4. Como esperado, observou-se urna queda na mortalidade global associada ao HIV e na incidência de algumas infecções oportunistas. Em países em desenvolvimento, a tuberculose (TB), em todas as suas formas, e uma das mais freqüentes infecções em pacientes portadores do HIV ou com SIDA. A presença do HIV pode ocorrer em 4% a 70% dos pacientes com tuberculose, dependendo do tipo de paciente analisado, do tipo de unidade de saúde e da região avaliada (área urbana ou rural). Se a terapia antiretroviral interfere na historia natural da SIDA, pode-se inferir, que ela possa interferir na incidência e prevalência das infecções oportunistas, como a TB. O Hospital Universitário Clementino Fraga Filho, da Universidade Federal do Rio de Janeiro (HUCFF-UFRJ) e referência no Estado do Rio de Janeiro para acompanhamento e tratamento de pacientes portadores de mv. A prevalência infecção por HIV entre os tuberculosos atendidos nesta unidade era de aproximadamente 35%,em 1996. A introdução dos inibidores de protease a ART se iniciou em 1997, de acordo com a portaria do Ministério da Saúde, fornecendo as medicações gratuitamente através da rede de saúde em todos os seus níveis (primário, secundário e terciário). O Hospital Evandro Chagas do IPEC e referência para TB/HIV e centro de pesquisa de excelência, onde o acompanhamento dos pacientes e realizada de forma sistemática e padronizada. Os Institutos Estaduais Emílio Ribas e CRT/AIDS, em São Paulo, centralizam em media 750/3000 (25%) dos casos de TB/HIV anualmente notificados naquele centro urbano, e as condições já estabelecidas, como nos centros escolhidos no Rio de Janeiro, permitem que sejam realizados estudos retrospectivos tipo coorte histórica, que atendam a e questão: qual a eficácia e a efetividade destes esquemas associados (HAART/tratamento anti-TB) no controle de ambas as endemias. Estes estudos poderão demonstrar as formas realmente efetivas de condução clínica da co-infecção na Rede de Saúde, com distribuição dos recursos otimizada. Até o momento, são escassas as informações sobre a tuberculose, quanta a incidência da TB e resultados do tratamento anti-TB (para TB ativa ou TB latente) em países com elevada prevalência da co-infecção, após a instituição do HAART na terapêutica de pacientes portadores de HIV. Dados sobre a eficácia e a efetividade destes esquemas associados (HAART/tratamento anti-TB) poderão demonstrar as formas realmente efetivas de condução clinica da co-infecção na Rede de Saúde, com distribuição dos recursos otimizada.

Objetivo: Geral: Entre os pacientes infectados pelo HIV atendidos Unidades de Referência para AIDS no Rio de Janeiro em São Paulo, avaliar a incidência, a freqüência das formas clínicas, a taxa de aderência ao tratamento, a evolução clínica laboratorial, a morbi-letalidade de TB ativa, taxas de recidiva, as indicações/aderência do tratamento da TB latente com o uso de HAART, seus efeitos adversos e impactos na co-infecção. Específicos: Avaliar a freqüência das diferentes formas clínicas da TB. Avaliar a letalidade por tuberculose, em pacientes com e sem outras co-morbidades Identificar a taxa de aderência aos esquemas HAART e anti-TB associados. Identificar a taxa de negativação do escarro ao segundo mês, a taxa de cura, a taxa de recidiva em dois anos e de reações adversas durante o tratamento (reações paradoxais) com o uso dos esquemas HAART e anti-TB associados. Avaliar as indicações do tratamento da TB latente Avaliar a sobrevida dos pacientes com TB/HIV e o impacto do esquema HAART. Avaliar a taxa de abandono do tratamento da TB latente. Avaliar a ocorrência de reações adversas durante a quimioprofilaxia e de TB ativa "a posteriori", nos dois anos subseqüentes, nos indivíduos que fizeram usa do tratamento da TB latente.

Metodologia: Estudo tipo coorte histórica. Análise do impacto do HAART na incidência e forma de apresentação da TB ativa: Através do banco dados dos casos de infecção pelo HIV e/ou SIDA diagnosticados nas quatro Unidades de Saúde incluídas no projeto, serão identificados os indivíduos a serem investigados no banco de dados de notificação de TB no Estado do Rio de Janeiro ou no Estado de São Paulo, base de dados SINAN. Os pacientes serão divididos em dois grupos: Grupo I, de pacientes infectados pelo HIV sem uso de HAART ; Grupo 2, de pacientes infectados pelo HIV, sob uso de HAART. O mesmo paciente poderá ser incluído em ambos os grupos, caso tenha sido tratado sem e depois com HAART, contribuindo para cada grupo durante o período de tempo de cada intervenção terapêutica. Análise do impacto do HAART no resultado do tratamento anti-TB. Através do banco dados dos casos de infecção pelo HIV e/ou SIDA diagnosticados nas Unidades de Saúde serão identificados os indivíduos a serem investigados no banco de dados de notificação de TB e de prescrição de retrovirais no Estado do Rio de Janeiro e no Estado de São Paulo, base de dados SINAN e base de dados da farmácia central de distribuição de anti-retrovirais. Os pacientes serão divididos em três grupos: Grupo 1, de pacientes HIV soropositivos uso de HAART e esquema anti-TB com rifampicina; Grupo 2, de pacientes HIV soropositivos sem uso de HAART, mas com esquema anti TB com rifampicina ; Grupo 3, de pacientes HIV soropositivos com uso de tratamento antiretroviral contendo um ou dois antiretrovirais mas com esquema anti-TB com rifampicina. Após a revisão dos prontuários, quando não existir informações durante os seis a nove meses do tratamento da TB (abandono do tratamento), os pacientes e/ou familiares serão contatados para se obter dados mais fidedignos sobre o resultado final do tratamento anti-TB entre os pacientes com TB infectados pelo HIV, usando ou não HAART. Estudo Descritivo da terapia HAART na TB latente Através dados dos prontuários dos casos de infecção pelo HIV e/ou SIDA diagnosticados nas Unidades de Saúde serão identificados os indivíduos a serem investigados no banco de dados de notificação de tratamento da TB latente e de prescrição de anti-retrovirais no Estado do Rio de Janeiro e no Estado de São Paulo de dados SINAN e base de dados da farmácia central de distribuição de anti-retrovirais. Os pacientes serao divididos em dois grupos: Grupo I, de pacientes HIV soropositivos uso de HAART e uso de isoniazida para tratamento da TB latente; Grupo 2, de pacientes HIV soropositivos sem uso de HAART e uso de isoniazida para tratamento da TB latente. Após a revisão dos prontuários, quando não existir informações durante pelo menos 12 meses após os seis meses do tratamento da TB latente (abandono do tratamento), os pacientes e/ou familiares serão contatados para se obter dados mais fidedignos sobre o resultado final do tratamento da TB latente bem como avaliar a ocorrência de TB ativa "a posteriori" nos dois grupos de pacientes Calculo Amostral Para avaliação do impacto do HAART na forma clínica de apresentação da TB. No estudo piloto, de acordo com dados disponíveis no Serviço de Ação Comunitária - SAC do HUCFF-UFRJ são notificados anualmente cerca de 150 casos de tuberculose infectados pelo HIV, nesta instituição. Como a forma pulmonar paucibacilar entre os HIV+, o tratamento de prova (empírico) ocorreu em 34%, no ano de 1996, e como no estudo piloto realizado em nosso Hospital, esta taxa passou a 16% após o HAART (Mello, FCQ, et. al. 2002 - ver serão de resultados preliminares), para demonstrarmos que o esquema HAART com IP esta associado a uma queda da apresentação atípica da TB/tratamento empírico em países com alta prevalência da co-infecção, com um poder de 80%, um erro alfa de 5%, precisaremos de 260 casos de TB e HIV soropositivos sem exposição ao esquema HAART e 65 casos de TB e HIV soropositivos sob uso de HAART. Para avaliação do impacto do HAART no resultado do tratamento anti-TB: Será priorizado o esquema HAART contendo efavirenz. Pois este esquema esta associado a uma queda da mortalidade entre HIV positivos com TB em atividade, considerando o relato da literatura de queda da mortalidade HIV/TB de 35% para 20% ap6s 0 HAART (Girardi e cols,2000), com um poder de 80%, um erro alfa de 5%. precisaremos de 388 casos de HIV soropositivos sem utilização do esquema HAART e 97 casos de HIV soropositivos sob usa de efavirenz, ambos sob usa de do esquema anti- TB com rifampicina. Para demonstrarmos que o esquema HAART e fator de risco associado ao desenvolvimento da reação paradoxal, considerando os dados do estudo retrospectivo (Narita e cols., 1998), que evidenciou a ocorrência da reação em HIV soropositivos sem HAART de 7% e naqueles com HAART de 36%, com um poder de 80%, um erro alfa de 5%, precisaremos de 97 pacientes sob uso de HAART e 24 sem uso de HAART. Para o Estudo Descritivo da terapia HAART na TB latente: Serão revistos todos os casos de co-infectados atendidos nestas instituições no período do estudo. submetidos a quimioprofilaxia anti-TB com ou sem esquema HAART associado. No Hospital Evandro Chagas da Fiocruz, no complexo hospitalar IDT/HUCFF da UFRJ, no Instituto Emílio Ribas e no CRT-AIDS da SESP, são atendidos anualmente respectivamente, 90, 110, 500 e 200 pacientes com TB e infectados pelo HIV, demonstrando que no período do estudo, a amostra mínima será obtida nestas instituições.

Concorrência: Pesquisas Científicas - Set/2001

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICA

Produção Científica


Projeto: ORIENTACÃO FARMACÊUTICA EM DST NAS DROGARIAS DO DISTRITO FEDERAL: UM ESTUDO EXPERIMENTAL CONTROLADO DE INTERVENÇÃO.
Coordenador: JANETH DE OLIVEIRA SILVA NAVES
Resumo: As DST estão entre as seis maiores causas de procura por atendimento nos centros de saúde (Brasil, 1999). A OMS estima que ocorram no Brasil cerca de 12 milhões de DST por ano, e que 70% dessas pessoas, com alguma DST, busquem o primeiro atendimento em farmácias. As farmácias e drogarias da rede privada no Brasil, são responsáveis pelo fornecimento de 76% dos medicamentos diretamente a população (MF, 2003). Embora haja, no Brasil, a exigência legal da presença do farmacêutico de formação superior como responsável técnico pela drogaria, o balconista é ainda o profissional mais disponível para o atendimento da população e dispensação de medicamentos, mesmo que minimamente qualificado (Barros, 1997). Não há, até o momento, nenhuma exigência legal quanta à formação e qualificação deste profissional. A dificuldade de acesso a serviços de saúde, a falta de orientação quanto ao uso racional de medicamentos e a automedicação são uma realidade no Brasil, onde a população encontra-se excessivamente exposta a propaganda de medicamentos, sem ter acesso à informação sobre os riscos associados ao seu uso indiscriminado (Castro, 2000). Pesquisa desenvolvida do Distrito Federal verificou que apenas 18,7% dos pacientes que tem atendimento no SUS compreendem a prescrição, mostrando a necessidade de reforçar a prática da orientação farmacêutica para melhorar a adesão ao tratamento e a compreensão do paciente sobre a sua patologia (Naves e Silver, 2002). Portanto, estabelecer parcerias educativas com estabelecimentos farmacêuticos é de fundamental importância para a saúde pública.

Objetivo: OBJETIVO GERAL: Promover a melhoria da qualidade do atendimento das farmácias em relação às demandas de DST em Brasília e Taguatinga em 2004/2005 OBJETIVOS ESPECÍFICOS: - Conhecer as motivações que levam os usuários de medicamentos a buscar as drogarias, em primeiro lugar, e não os serviços de saúde, para solucionarem problemas de saúde como as DSTs. - Descrever práticas de atendimento a possíveis portadores de DST nas Drogarias do DF. - Avaliar.o grau de conhecimento dos balconistas com relação a DST e antibioticoterapia em drogarias da rede privada. - Implementar medidas educativas em DST/AIDS para balconistas das drogarias em estudo. - Divulgar a prioridade de atendimento ao usuário com queixas de DST na SES-OF

Metodologia: As 70 drogarias serão selecionadas por processo aleatório randômico e alocados em dois grupos: um grupo de controle e outro que receberá uma intervenção educativa. Para conhecer o grau de conhecimento com relação às DSTs, os balconistas responderão a um questionário na forma de entrevista semiestruturada que será aplicado antes da intervenção educativa e 10 semanas depois da intervenção para avaliar se houve melhora dos conhecimentos. Para descrever as práticas de atendimento e as orientações fornecidas aos usuários será utilizada a técnica do cliente simulado (Chuc, 2002; Syhakhang, 2001; Madden et ai, 1997), que serão 10 estudantes de Farmácia da UnB, devidamente treinados, simulando um sintoma de secreção uretral com ardência ao urinar. Esse procedimento será repetido antes e depois da intervenção educativa. Para se conhecer as motivações que levam as pessoas a buscarem um primeiro atendimento nas drogarias quando tem um sintoma de DST, serão constituídos dois Grupos Focais com portadores de DST nos Centros de Referência de DST/AIDS da SES/DF, utilizando a metodologia de Debus, 1995. Será aplicado um instrumento na forma de entrevista semi-estruturada com profissionais de saúde treinados em abordagem sindrômica, para se avaliar as dificuldades encontradas na operacionalização das ações preconizadas. As unidades de saúde serão estimuladas a informar, por meio de cartazes informativos fixados ao lado do guichê de marcação de consultas, que os usuários com algum sintoma de Doenças Sexualmente Transmissíveis, terão direito a consulta imediata. Estes cartazes serão elaborados e fornecidos pela Gerência de DST/AIDS da SES-DF. A intervenção educativa se constituirá num cicio de palestras, abordando os conhecimentos importantes em aconselhamento, transmissão, epidemiologia e prevenção das DST; antibioticoterapia e resistência bacteriana; legislação vigente e responsabilidade social do farmacêutico e balconista; estrutura da SES com relação ao atendimento de DST. Serão elaborados e distribuídos para farmácias, materiais didáticos informativos, cartilhas, folders e cartazes, para divulgação de conhecimentos e orientações importantes em DST.

Concorrência: Pesquisas Científicas - Abr/2002

População Alvo: Outras populações-alvo

Natureza: ESTUDOS E PESQUISAS

Subnatureza: AVALIATIVA/OPERACIONAL

Produção Científica


Projeto: CURSO AVANCADO DO MANEJO CLÌNICO DE HIV/AIDS E CO-INFECÇÕES
Coordenador: JOSE LUIZ DE ANDRADE NETO
Resumo: O Curso será realizado em Santa Catarina, e disponibilizará 120 vagas para médicos clínicos e infectologistas que atendem pessoas vivendo com HIV/Aids. Este evento será caracterizado como Curso Avançado dentro do " Programa Share", mantido pela International AIDS Society do Brasil. Importante enfatizar que o Programa Share é reconhecido pela OMS como de excelente qualidade e está sendo adotado como parte da estratégia de ampliação ao acesso adequado ao tratamento ARV em escala global, sendo que centros de excelência para capacitação em âmbito nacional e intemacional estão sendo selecionados em diversas partes do mundo. Considerando: - a grande demanda reprimida nos cursos realizados em 2002 e 2003 (Maceió, Itapema e Foz do Iguaçu) - a qualidade técnica dos consultores - a qualidade da metodologia empregada - os resultados do aproveitamento dos alunos Este projeto é estratégico para o PN-DST/Aids, considerando o cumprimento da proposta de educação clínica continuada para profissionais dos serviços de referencia em HIV/Aids

Objetivo: Qualificar e atualizar profissionais de saúde no controle e manejo do HIV/Aids e co- infecções.

Metodologia: Para realização de cursos de capacitação para os profissionais de saúde que lidam com o manejo de pacientes portadores de HIV/Aids será seguido o seguinte plano de execução: - Reunir consultores especialistas para elaboração de um conteúdo adequado para cada curso; - Selecionar monitores para auxiliarem no monitoramento das discussões dos grupos, de acordo com a região onde será realizado 0 curso; - Selecionar os participantes através de inscrições prévias observando pré-requisitos definidos; - Contratar empresa organizadora de evento para organização da logística do curso (divulgação, inscrição, serviço de secretaria e viabilização de infra-estrutura adequada); - Realizar o curso em três dias, aplicando metodologia de problematização, discussões em grupos e atividades interativas.

Concorrência: Eventos

População Alvo: Outras populações-alvo

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: APOIO À ESTRUT. DE NÚCLEOS DE PESQUISA CLÍNICA

Produção Científica


Projeto: Estudo sobre as representantes socias de vacinas anti-HIV/AIDS para um grupo de homens e mulheres heterossexuais no Rio de Janeiro
Coordenador: GISELA CORDEIRO PEREIRA CARDOSO
Resumo: Atualmente, nos países em desenvolvimento, a maioria das transmissões do HIV ocorre através de relações heterossexuais. Tendo em vista as mudanças epidemiológicas que ocorreram nos últimos anos e a perspectiva da condução de estudos para a avaliação de produtos vacinais no país, e sumamente importante realizar pesquisas nas quais as questões da transmissão heterossexual e de gênero sejam priorizadas. Estudos sócio-comportamentais podem ser muito ricos tanto no levantamento de informações contextuais como na compreensão do ponto de vista dos participantes. O conhecimento do sistema de crença e valores, assim como o mapeamento de informações disponíveis sobre vacinas contra o HIV, possibilitando um entendimento das motivações para participar de pesquisas para desenvolvimento de vacinas. Ademais, permitirá adequar um programa de informação de acordo com as necessidades de cada grupo específico (CN-DST/AIDS, Ministério da Saúde, 2002). Assim, no presente projeto nos propomos a realizar um estudo exploratório de natureza qualitativa sobre as representações sociais de vacinas para HIV/AIDS para um grupo de homens e mulheres heterossexuais que procurarem a Unidade de Vacinas do Projeto Praça Onze com o intenso de participar de projetos de vacinas anti-HIV/AIDS. Critérios de inclusão: Sexo masculino ou feminino, idade entre 18 e 60 anos, soro negatividade para o HIV, relato de comportamento exclusivamente heterossexual nos últimos 24 meses. Critérios de exclusão: Incapacidade em entender ou recusa em assinar termo de consentimento; quadro mental agudo e/ou grave por ocasião da entrevista; incapacidade de compreensão mínima das perguntas realizadas; soropositividade para o HIV. O tamanho da amostra será de 30 pessoas (15 homens e 15 mulheres). O estudo será realizado no Projeto Praça Onze, que funciona nos andares imediatamente acima do COASHESF A. Para todos que procuram o Projeto Praça Onze e preenchida uma ficha cadastral. Na qual o indivíduo informa se quer ser contactado para participar de futuros estudos e qual a forma de contacto preferida (correio ou telefone). Entraremos em contato com potenciais voluntários de acordo com os dados da ficha cadastral e, após breve explicação, os convidaremos para que compareça a sede do projeto. Nesta entrevista de comparecimento explicaremos que se trata de um estudo qualitativo que procurara analisar as razões e motivações do desejo de participar de testes de vacinas anti-HIV/AIDS. Os indivíduos que aceitarem participar do estudo assinam um termo de consentimento livre e esclarecido e serão submetidos a urna entrevista semi-dirigida, que será gravada Na entrevista procuramos explorar algumas questões: a relação do sujeito com a AIDS, sua vida sexual e sua receptividade em relação a possíveis ensaios com vacinas anti HIV/AIDS. Antes do inicio da entrevista algumas perguntas sobre dados sócio-demográficos serão realizadas, como, por exemplo, idade, escolaridade, profissão, ocupação, religião e renda pessoal e familiar. Método de análise: Todas as entrevistas serão transcritas e analisadas de acordo com os critérios da análise de conteúdo térmico de Bardin. Principais indicadores e variáveis: O principal indicador será o conteúdo das entrevistas. As variáveis constarilo dos dados sócio-demográfico (idade, escolaridade, faixa etária, ocupação, profissão, religião, renda), crença, motivação, práticas (tipo e freqüência) e atitudes. Aspectos éticos: O presente estudo foi submetido ao Comitê de Ética em Pesquisa do HUCFF e apenas será iniciado após receber aprovação final por parte do mesmo. Consentimento livre e esclarecido será obtido de todos os participantes do estudo. Confidencialidade estrita será mantida durante todo o estudo.

Objetivo: Geral: Conhecer as RS de uma vacina anti-HIV/ AIDS para um grupo de indivíduos heterossexuais soronegativos para o HIV e que manifestaram desejo explicito em participar de estudos com vacinas. Específicos: Explorar quais são as RS da AIDS para este grupo; Conhecer as RS de vacinas parcialmente eficazes; Conhecer as motivações em querer participar de testes de vacinas anti-HIV/AIDS; Conhecer o modo como esse grupo se relaciona sexualmente (tipo de prática sexual, freqüência destas práticas, número de parceiros, etc.); Identificar os modos de prevenção de HIV/AIDS habitual mente utilizados.

Metodologia: Estudo exploratório de natureza qualitativa que procura analisar as representações sociais de vacinas anti-HIV/AIDS para um grupo de heterossexuais soronegativos para o HIV e que manifestaram interesse em participar de estudos de vacinas anti-HIV/AIDS. O estudo será realizado no Projeto Praça Onze, que funciona nos andares imediatamente acima do COAS-HESF A. No Projeto Praça Onze são por nos conduzidos diversos estudos clínicos e epidemiológicos, incluindo estudos de vacinas anti-HIV/AIDS. A população do estudo será selecionada a partir de indivíduos que espontaneamente procurarem o Projeto Praça Onze com o intuito de participar de projetos ligados a pesquisas com vacinas anti-HIV/AIDS. Cerca de 30 pessoas por mês procuram o Projeto Praça Onze com a intenção de participar de estudos vacinais. Para todos e preenchida uma ficha cadastral na qual o individuo informa se quer ser contactado para participar de futuros estudos e qual a forma de contato preferida (correio ou telefone). Entraremos em contato com potenciais voluntários de acordo com os dados da ficha cadastral e, após breve explicação, os convidaremos para que compareça a sede do projeto. Nesta entrevista de comparecimento explicaremos que se trata de um estudo qualitativo que procurara analisar as razões e motivações do desejo de participar de testes de vacinas anti-HIV/AIDS, aos indivíduos que aceitarem participar do estudo assinarão um termo de consentimento livre e esclarecido e serão submetidos a uma entrevista semi-dirigida, que será gravada. Estudos qualitativos não se baseiam em critérios numéricos para ter representatividade. O tamanho da amostra precisa ser o suficientemente grande para que os temas a serem explorados na entrevista possam aparecer de forma a abranger o problema investigado em sua múltiplas dimensões (Minayo, 1998). Assim, 30 pessoas (15 homens e 15 mulheres) participarão do estudo. Critérios de inclusão: Sexo masculino ou feminino; Idade entre 18-60 anos; Soronegatividade confirmada; Relato de comportamento exclusivamente heterossexual nos últimos 24 meses. Critérios de exclusão: Incapacidade em entender ou recusa em assinar termo de consentimento; Quadro mental agudo ou grave por ocasião da entrevista; . Incapacidade de compreensão mínima das perguntas realizadas; Soropositividade para o HIV. Instrumento de coleta de dados: As técnicas mais utilizadas dentro do referencial teórico das RS são as de caráter interrogativo (entrevistas, questionários, pranchas indutivas, desenhos) e as associativas (associação livre e mapa associativo) (Moreira 1998). Para este estudo foi escolhida a utilização de uma entrevista com roteiro estruturado, ou de constam também 2 perguntas de associação livre (em anexo). Na entrevista procuramos explorar algumas questões: a relação do sujeito com a AIDS, sua vida sexual e sua receptividade em relação a possíveis ensaios com vacinas anti-HIV/AIDS. Antes do inicio da entrevista algumas perguntas sobre dados sócio-demográficos serão realizadas, como, por exemplo, idade, escolaridade, profissão, ocupação, religião e renda pessoal e familiar. Método de análise: Todas as entrevistas serão transcritas e analisadas de acordo com os critérios da análise de conteúdo temático de Bardin (1977). A análise de conteúdo temática consiste na construção de uma planilha para cada uma das perguntas do roteiro da entrevista. A partir desta planilha surgem os agrupamentos de respostas por afinidade que vão formando os "núcleos de sentido" das respostas dadas a cada pergunta. A presença e a freqüência de aparição destes núcleos de sentido darão uma representatividade ao objeto analítico em questão. A análise do material ocorre a partir desta catalogação e tabulação. Por ultimo, realiza-se uma análise de concorrências entre algumas perguntas do roteiro que se destacam no sentido de orientar para a construção das RS.

Concorrência: Pesquisas Científicas - Set/2001

População Alvo: População em Geral

Natureza: ESTUDOS E PESQUISAS

Subnatureza: COMPORTAMENTAL

Produção Científica


Projeto: Contas Nacionais em AIDS - Brasil , 2003 e 20042
Coordenador: SERGIO FRANCISCO PIOLA
Resumo: As Contas Nacionais em DST/Aids consistem na contabilização sistemática, periódica e exaustiva dos gastos e fluxos de financiamento relacionados com o controle da epidemia. Seu objetivo e determinar o montante de recursos destinados a prevenção e ao tratamento da Aids, as fontes (públicas e privadas, internas e externas) que suportam o financiamento, as instituições que canalizam e gerenciam os recursos, assim como aquelas que os utilizam, os programas desenvolvidos e os gastos realizados. Com esse objetivo, o Programa Conjunto com as Nações Unidas para HIV e Aids (UNAIDS), por meio do SIDALAC e em colaboração com a Fundação Mexicana para a Saúde (FUNSALUD), desde 1999, vem incentivando o estudo dos níveis e os fluxos de financiamento e de gasto para a prevenção e tratamento da Aids para diversos parses da America Latina e Caribe. Na primeira fase do Projeto (1999), 0 Brasil, México, Guatemala e Uruguai completaram o exercício. No Brasil foi feita a consolidação dos gastos em HIV/AIDS a nível federal e foram realizadas estimativas preliminares referentes ao gasto de empresas, de estados e municípios e o gasto das famílias para os anos de 1997 e 1998. Os resultados foram apresentados no relaório "Brasil: Contas em AIDS - Gasto publico federal em 1997 e 1998 e estimativa do gasto nacional em 1998", de dezembro 1999. A segunda fase do Projeto, que envolveu os quatro países citados, teve como objetivo atualizar os dados sobre o gasto federal com prevenção e tratamento da aids para os anos de 1999 e 2000 e estimar, com maior precisão os gastos descentralizados e privados. Concomitantemente, outros 15 parses da America Latina e Caribe deram início a primeira fase do Projeto de Contas Nacionais em HIV/Aids e contaram, para isso, com a assistência técnica de equipes dos parses que já se encontravam na segunda fase de estimativas. 0 estudo do Brasil foi publicado em 2002. Apesar do esforço para aprimorar a metodologia de contabilização dos gastos descentralizados e privados, a pesquisa de Contas Nacionais no Brasil ainda oferece uma serie de limitações. De forma a sanar as deficiências encontradas, varias foram as recomendações propostas no estudo 1999/2000, visando o aperfeiçoamento de pesquisas futuras, a saber: a) Elaborar amostra mais significativa de municípios para levantamento rotineiro dos gastos com DST-Aids com recursos pr6prios, aprimorando o questionário já testado nesse estudo; b) Incluir no cadastramento das Organizações não Governamentais (ONGs), que tem convênios ou instrumentos de cooperação (TC ou CFA) com o PN/DST-Aids, informações que permitam a expansão das informações obtidas por meio de inquérito amostral. c) Realizar pesquisa, com o apoio da rede de organizações de apoio a doentes de aids e positivos, com o objetivo de obter maiores informações sobre a "cesta de consumo de serviços assistenciais" dessa população. A hipótese e que tal população recorre a diferentes modalidades de atendimento, dependendo de sua vinculação ou não ao segmento de pianos e seguros de saúde e do tipo de serviço demandado. d) Estimular o desenvolvimento de estudos de custos de diferentes tipos de serviços e aperfeiçoar os dados de cobertura; e) Estreitar a aproximação entre os estudos sobre Contas Nacionais em Aids e o esforço que esta sendo iniciado pelo Ministério da Saúde e outras entidades para a elaboração das Contas Nacionais em Saúde. Apesar do esforço para aprimorar a metodologia de contabilização dos gastos descentralizados e privados, a pesquisa de Contas Nacionais no Brasil ainda oferece uma serie de limitações. De forma a sanar as deficiências encontradas, varias foram as recomendações propostas no estudo 1999/2000, visando o aperfeiçoamento de pesquisas futuras, a saber: f) Elaborar amostra mais significativa de municípios para levantamento rotineiro dos gastos com DST-Aids com recursos próprios, aprimorando o questionário já testado nesse estudo; incluir no cadastramento das Organizações não Governamentais (ONGs), que tem Este projeto de estimação dos gastos nacionais com aids, para os anos de 2003 e 2004, pretende dar continuidade aos estudos realizados para o período de 1997 a 2002, os quais já foram publicados. Esta proposta tem por objetivo: (i) consolidar os gastos federais com aids em 2003 e 2004, dispersos em vários bancos de dados e fontes de informação do Ministério da Saúde; (ii) regionalizar esses dispêndios federais; (iii) realizar estimativa dos gastos públicos subnacionais (estados e municípios) em aids para o ano de 2004. O conhecimento mais atualizado dos montantes e da distribuição dos recursos públicos destinados a prevenção e tratamento da DST/Aids e acompanhamento de sua evolução se constitui em ferramenta importante para gestão nacional do programa. A Coordenação Nacional já possui estudos sobre os gastos públicos com DST/Aids para o período de 1997 a 2002 e sua atualização para 2003 e 2004 permitirá a consolidação de dados sobre o financiamento público no combate a epidemia. Como já ocorreu na elaboração de Contas Nacionais para o período 2001/2002, o PN-DST-Aids optou por dar prioridade, no período 2003/2004 ao levantamento dos gastos públicos (federal, estadual e municipal) de forma mais detalhada, incluindo sua regionalização, por entender que, desta forma, estaria atendendo, de maneira mais agi) e adequada, as necessidades de gestão do Programa Nacional.

Objetivo: Geral: Levantar, consolidar e analisar os gastos federais com DST/Aids no período 2003/2004 e realizar estimativas dos gastos descentralizados (com recursos pr6prios de estados e municípios) para o ano de 2004. Específicos: Levantar e consolidar os gastos federais com DST/Aids par fonte e função de atenção, fonte e provedores e por tipo de serviço preventivo e curativo; Estimar a participação das fontes de financiamento no custeio dos serviços; Regionalizar os dispêndios federais efetuados; Estimar os gastos descentralizados em Aids, em estados e municípios selecionados.

Metodologia: As informações sobre os gastos com DST/Aids encontram-se dispersas em diversos bancos de dados. Assim, as etapas a serem percorridas para consolidação do gasto federal com DST/Aids constarão, num primeiro momento, do levantamento das informações existentes nos bancos de dados da coordenação do Programa Nacional que correspondem, basicamente, aos recursos dos empréstimos do Banco Mundial e da contrapartida nacional. Essas informações deverão ser organizadas de forma a atender o formato de algumas das matrizes utilizadas nos estudos anteriores. Posteriormente, a esses recursos serão agregadas as despesas realizadas com medicamentos, internações, testes de triagem de sangue, diagnóstico e monitoramento levantadas em outros bancos de dados do Ministério da Saúde. Não se dispõe de informações sobre os gastos efetivamente realizados por Estados e Municípios com recursos próprios no financiamento de ações de prevenção e controle da Aids. Esta estabelecido no POA I (1999) que esse percentual de contrapartida seria de 10% para os estados e municípios do Norte/Nordeste/Centro-Oeste e de 20% para os estados e municípios do sul e sudeste. Esses valores foram acrescidos em 30% no POA II (2000). Na primeira fase do projeto de Contas Nacionais, foram enviados questionários para 27 SES e 42 SMS, que foram aquelas que, em 1997 e 1998, celebraram convênios com o GNPN/DST/Aids. Do total enviado, foram devolvidos menos de um terço dos questionários e, assim mesmo, alguns preenchidos de forma incompleta. Para os anos de 1999 e 2000, foi elaborado um questionário simplificado e realizada uma oficina de trabalho, que contou com a presença de um grupo selecionado de coordenadores e técnicos dos programas de DST/Aids de secretarias estaduais e municipais de saúde, com o intuito de validar o instrumento. O levantamento final de questionários recebidos referentes ao ano de 1999, incluindo tanto o questionário simplificado quanta o questionário aperfeiçoado, mostrou que 74 foram respondidos, perfazendo 63,8% do total de questionários enviados (116). Já para o ano de 2000, somente 40% dos OGPs (estados e Municípios) preencheram o questionário (70 dos 175 remetidos). Com base nos resultados obtidos, procurou-se realizar estimativas sobre os gastos próprios dos OGPs que não responderam a solicitação. Inicialmente, tentou-se realizar estimativas com base na taxa de incidência, população e região onde se encontram estados e municípios conveniados. Observou-se, no entanto, não existir correlação entre essas variáveis e o volume de gastos com recursos próprios realizados pelas esferas subnacionais. Tendo sido frustrada a primeira tentativa de realização de estimativas, buscou-se um novo caminho. Obteve-se, junto ao GNPN/DST/Aids, informações referentes as transferências federais para estados e municípios com convênios para os anos de 1999 e 2000, tendo por referencia as datas de pagamento das parcelas dos POA I e POA II. Calculou-se quanto os gastos com recursos próprios declarados pelos OGPs que responderam ao questionário representavam do total de recursos liberados pelo Ministério da Saúde por ano e para cada ente federado conveniado. Por fim, obteve-se a media desses percentuais por região, que foi aplicado sobre o total de recursos efetivamente repassados pela esfera federal para cada OGP que não respondeu ao questionário. Para a realização das estimativas dos gastos subnacionais para o ano de 2004, será necessário elaborar nova metodologia. Sendo assim, a princípio, serão estudadas as modificac6es de gastos decorrentes do aprofundamento de sua descentralização Acredita-se que os riscos de não se alcançar os objetivos da pesquisa sejam baixos, uma vez que a equipe já dispõe de experiência sobre o tema e dispõe de metodologia testada nos estudos anteriores. Apresentação e discussão dos resultados com o PN/DST/Aids e em eventos técnicos (seminários, encontros) patrocinados pelo Programa Nacional. Disponibilização no site do Programa Nacional.

Concorrência: Estratégico

População Alvo: População em Geral

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ECONÔMICA

Produção Científica


Projeto: AVALIAÇÃO DE ACEITABILIDADE DE PARTICIPAÇÃO EM ENSAIOS COM VACINAS ANTI-HIV EM COORTE DE INCIDÊNCIA EM BELO HORIZONTE, MINAS GERAIS 2004
Coordenador: DIRCEU BARTOLOMEU GRECO
Resumo: Em 1992, a CNDST/Aids, em colaboração com a OMS, estabeleceu três centros de avaliação de vacinas anti-HIV, em Belo Horizonte, Rio de Janeiro e São Paulo. Nestes centros foram iniciados a partir de 1994 estudos de coorte, aberto, multicêntrico, envolvendo pesquisadores dos três estados. O coorte iniciado em Belo Horizonte em outubro de 1994 foi denominado Projeto Horizonte. Seus objetivos incluem o estabelecimento e acompanhamento por período médio de três anos, de coorte aberto de homossexuais e bissexuais masculinos para: a) Avaliar a real factibilidade de estabelecer este tipo de coorte e manté-lo por período prolongado; b) Determinar a incidência da infecção pelo HIV; c) Avaliar o impacto de programas preventivos na incidência do HIV; avaliar a eficácia do aconselhamento e das intervenções educacionais na taxa de incidência; d) Avaliar a possibilidade de conduzir um ensaio clínico com vacinas candidatas anti-HIV com os voluntários recrutados deste coorte, como parte integrante do Plano Nacional de Vacinas anti-HIV do Ministério da Saúde; e) Discutir os diferentes aspectos éticos e técnicos de ensaios c1inicos conduzidos com vacinas candidatas preventivas anti-HIV, a representação social do HIV/AIDS, para responder diversas perguntas: como são motivadas as pessoas para participar de tais ensaios; como descobrir e utilizar as tendências de modificação de comportamento que podem ser importantes para diminuir o risco de infecção ao pelo HIV; como melhor informá-los e como disponibilizar procedimentos de informação livre e esclarecido culturalmente apropriados; como informar sobre o racional de ensaios duplo-cego em testes com vacinas. O Centro de vacinas anti-HIV de Minas Gerais e coordenado pela UFMG é composto por quatro componentes: comportamental, epidemiológico, clínico e laboratorial. O Projeto Horizonte tem aprovação e suporte financeiro do Ministério da Saúde e da UNAIDS. A epidemia de AIDS ainda esta em expansão em nosso pais e ha a necessidade incontestável do monitoramento da verdadeira incidência da infecção pelo HIV. Desta maneira, o conhecimento da incidência em diversos grupos populacionais e: a) essencial para se conhecer o real espectro da epidemia no Brasil; b) imprescindível para avaliar o impacto das medidas preventivas. Além disto, a manutenção e a expansão de coortes deste tipo será crucial para o planejamento e realização de ensaios clínicos para vacinas candidatas anti-HIV.

Objetivo: Geral: Avaliar a aceitabilidade de participação em estudo de vacinas anti-HIV entre homossexuais e bissexuais masculinos HIV negativos acompanhados prospectivamente. Específicos: Avaliar a incidência da infecção pelo HIV para conhecer 0 real espectro da epidemia, avaliar 0 impacto das medidas preventivas e preparar para ensaios clínicos futuras vacinas candidatas anti-HIV. Avaliar 0 impacto das diversas intervenções sobre as mudanças comportamentais necessárias para diminuir 0 risco de infecção pelo HIV, através do aconselhamento pré e pós-teste, Fórum de debates de sexo mais seguro e Cine Horizonte. Discutir e informar sobre a participação autônoma em futuros ensaios com vacinas candidatas HIV através de educação continuada. Desenvolver novas estratégias de comunicação para aumentar a visibilidade do Projeto e ampliar o recrutamento. Determinação da incidência da infecção pelo HIV, inferindo que a mudança de diminuição desta incidência. Utilização desta incidência no desenho de futuros ensaios clínicos com vacinas candidatas. Mudanças de comportamento, visando 0 sexo seguro, com diminuição do risco para a infecção pelo HIV; Aperfeiçoamento das estratégias de intervenções educativas apreendidas para aplicação em outros contextos, inclusive nas ações do Programa Nacional de DST/AIDS para o controle da epidemia Voluntários capacitados para decidir sobre participação autônoma em possíveis ensaios clínicos com vacinas candidatas anti-HIV. Adesão de outros grupos de homens que fazem sexo com outros homens - travestis, miches, bissexuais - diversificando 0 perfil populacional atendido no Projeto Horizonte. Investir no aperfeiçoamento/aprimoramento técnico da equipe do Projeto Horizonte, através de cursos, participação em congresso, visando o planejamento de ensaios clínicos com futuras vacinas candidatas anti-HIV. Organizações Governamentais, coortes. Acompanhar clínica, psicológica, virológica e imunologicamente os voluntários que se infectarem após recrutados para a coorte. Aperfeiçoamento dos profissionais que participam do Centro Nacional de Vacinas anti HIV/MG. Utilização da experiência acumulada no Projeto para formação de novas coortes (mulheres, adolescentes, profissionais da construção civil, vendedores ambulantes, população do sistema prisional). Tratamento dos pacientes infectados, de acordo com 0 Consenso Brasileiro de Tratamento antiretroviral Isolamento e caracteriza<;ao do HIV dos voluntários recem-convertores.

Metodologia: Desde setembro de 1994 vem sendo mantida coorte aberta com homens que fazem sexo com outros homens, HIV negativos, com idade a partir de 18 anos, residentes na região metropolitana de Belo Horizonte, que não possuem doença psicológica/psiquiátrica ou dependência de substâncias químicas. Os voluntários têm sido recrutados através da divulgação do Projeto pela grande mídia e por outras estratégias específicas traçadas pela equipe de comunicação. A coorte aberta diferencia-se da coorte fechada por não haver limitação temporal da entrada de participantes. Apesar de sua gerência ser mais complexa, apresenta vantagens no estudo de incidência de doenças na população alvo, como a manutenção da taxa de incidência mais constante, não apresentando a queda característica do efeito coorte que ocorre nas coortes fechados. Além disso ela também propicia o início imediato de ensaios clínicos, não sendo necessária a formação de novo coorte. A avaliação preliminar de homossexuais e bissexuais em situação de risco para o HIV estimou incidência entre 1,3 e 8/100. Esta estimativa baseou-se nos dados de soro prevalência do HIV nesta população. A amostra calculada para 0 presente projeto com base nesta incidência, para precisão de 1 % a 2%, foi de 800 a 1.000 pessoas. Todos os candidatos são convidados a participar do projeto e, após o devido consentimento, são avaliados conforme protocolo específico. Tem sido realizada avaliação detalhada do comportamento e suas alterações apos as intervenções educacionais/aconselhamento. Vem sendo estudada também a disponibilidade desta população para participar de possível ensaio clínico da vacina profilática para o HIV. Estas avaliações são realizadas semestralmente. O instrumento utilizado para a coleta dos dados quantitativos e um questionário-entrevista que contem questões sobre as práticas sexuais, use de drogas e conhecimentos sobre vacinas. A necessidade de oferecer maiores e mais profundos conhecimentos sobre vacinas, que permitam aos voluntários decidir autonomamente sobre sua participação ou não em ensaios de vacinas candidatas anti-HIV, levou a introdução de procedimentos e avaliações qualitativas, como fóruns de debates, grupos focais e seminários. Aos participantes e oferecidos o conhecimento sobre meios de transmissão e prevenção do HIV, bem como meios necessários para sua realização. Além disso, todos recebem assistência médica necessária e aqueles que se infectam pelo HIV durante a participação neste coorte tem recebido acompanhamento médico necessário, no próprio Centro de Treinamento e Referencia em Doenças Infecciosas e Parasitaria (CTRDIP). Os voluntários são atendidos no CTR/DIP Orestes Diniz por sua equipe de médicos e psicólogos e os exames são realizados pelo Laboratório Central - Hospital das Clinicas/UFMG e no Laboratório DIP Serviço DIP/UFMG.

Concorrência: Estratégico

População Alvo: Homossexuais

Natureza: ESTUDOS E PESQUISAS

Subnatureza: COMPORTAMENTAL

Produção Científica


Projeto: VI SIMPÓSIO BRASILEIRO DE PESQUISA EM HIV/AIDS - CENTRO DE CONVENÇÕES DA UNIVERSIDADE FEDERAL DE OURO PRETO - 28 DE ABRIL A 1º DE MAIO DE 2005.
Coordenador: DIRCEU BARTOLOMEU GRECO
Resumo: Os Simpósios Brasileiros de Pesquisa em HIV/AIDS iniciado em 1995 com participação de pesquisadores da FIOCRUZ, Universidades Públicas Federais e Estaduais (USP, UNFESP, UFBA, UFRJ, UFMG) tendo como objetivos reunir os profissionais que atuam em pesquisa básica de HIV/AIDS no Brasil, juntamente com pesquisadores estrangeiros visando discutir projetos em colaboração. Ainda e relativamente baixo o número de profissionais que atuam em pesquisa básica do HIV I AIDS no Brasil. É extremamente importante que esta pesquisa seja racionalizada, não só para atender às necessidades do sistema de saúde brasileiro, mas também evitar que projetos sejam duplicados, reduzindo ainda mais a mão de obra especializada. É necessário divulgar o trabalho em HIV I AIDS para estudantes, de modo a aumentar a massa crítica de profissionais. A colaboração com pesquisadores estrangeiros é de importância fundamental para a pesquisa de HIV I AIDS, já que inúmeros laboratórios, a nível mundial, realizam pesquisa básica em HIV I AIDS. Além disto, a expansão do programa para pesquisa em todas as áreas da infecção pelo HIV facilitará o intercambio das informações e a complementariedade das pesquisas.

Objetivo: OBJETIVO GERAL: Reunir profissionais de diversas instituições de pesquisa brasileiras para apresentação de trabalhos e discussão de projetos OBJETIVOS ESPECÍFICOS: - Permitir a discussão de trabalhos sendo realizados em pesquisa de HIV I AIDS; - Estimular colaborações entre institutos de pesquisa brasileiros; - Estimular o interesse pela pesquisa em HIV/AIDS de estudantes brasileiros; - permitir o intercambio de informação entre cientistas brasileiros e estrangeiros; - Expandir a pesquisa nas diversas áreas do conhecimento relacionados à infecção pelo HIV.

Metodologia: Um simpósio de 4 dias de duração será realizado em Ouro Preto, no Centro de Convenções da Universidade Federal de Ouro Preto. A escolha da cidade teve diversas razões: a acessibilidade ao local por pesquisadores e estudantes de diversas regiões do Brasil, com ótimo centro de convenção (de baixo custo), hotéis de diversos preços (acessível aos estudantes de graduação e pos graduação) e, evidentemente, o ambiente agradável desta cidade histórica. A Iista de endereços dos pesquisadores brasileiros e estrangeiros construída desde o primeiro simpósio de 1995 e ampliada nos 5 últimos simpósios será usada como base. Novos convidados brasileiros e estrangeiros conhecidos por colaborações, participação em congressos e por referências bibliográficas serão incluídos por indicação dos participantes do Comitê Científico do Simpósio (Mariza G. Morgado, Dumith Chequer Bou-Habib, Luiz Roberto Castello Branco, Vera Bongertz (Fiocruz- Rio de Janeiro, Alberto Duarte (USP), Bernardo Galvão-Castro (Fiocruz Salvador), Amilcar Tanuri e Rodrigo Brindeiro (UFRJ), Mirthes Ueda (Instituto Adolfo Lutz, Sao Paulo), Dirceu Greco, Jorge Andrade Pinto e Lucia Aleixo (UFMG), Francisco Inácio Bastos (FIOCRUZ, RJ), Orlando Ferreira (Hospital Albert Einstein, São Paulo), Ricardo Diaz (USP), Esther Sabino (Instituto de Hemoterapia, SP), Luiz Brígido (CN-DST/AIDS - MS), Carlos Brites (UFBA). A população alvo constitui-se dos profissionais de saúde e estudantes e pesquisadores em HIV I AIDS e em áreas correlatas, como Imunologia, Virologia, Doenças Infecciosas, epidemiologia, vacinas, clínica.

Concorrência: Eventos

População Alvo: Outras populações-alvo

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: APOIO A EVENTOS, SEMINÁRIOS, CAPACITAÇÕES E FORMAÇÕES CIENT.

Produção Científica


Projeto: ELABORAÇÃO DE 16 ARTIGOS SOBRE PESQUISAS EM AIDS NO BRASIL PARA PUBLICAÇÃO FORA DO PAÍS.
Coordenador: ALUISIO AUGUSTO COTRIM SEGURADO
Resumo: O projeto se refere a elaboração de artigos científicos para publicação fora do pais. Divide-se em duas etapas sendo a primeira de elaboração de 16 artigos sobre pesquisas em aids realizadas no pais e a segunda, a preparação de um número especial de Revista AIDS com as várias experiências de pesquisa em aids no Brasil. O objetivo e mostrar, para a comunidade internacional, as variadas e amplas ações voltadas ao conhecimento e ao combate da aids e da infecção pelo HIV realizadas no Brasil e apoiadas pelo Programa Nacional de DST/AIDS. Para a primeira etapa foram selecionados 16 projetos relacionados a temas como transmissão vertical, tipagem de HIV, teste rápido, prevalência de HIV entre vários grupos específicos, como mulheres que fazem sexo com mulheres, estudos de sobrevida, entre outros. A lista dos projetos selecionados para essa fase encontra-se em anexo. Esta fase será desenvolvida na forma de Seminários de redação de artigos. Os participantes, pesquisadores responsáveis pelos projetos, serão reunidos em dais momentos. Em um primeiro momento serão analisados as resultados das pesquisas e definida as questões a serem apresentadas no artigo. Um segundo encontro será realizado já com o artigo pronto que será submetido à apreciação por pares. Essa fase terminará com a incorporação, no texto, das sugestões dos revisores. Espera-se fazer uma revisão par grupos de profissionais da área, pesquisadores brasileiros e uma revisão, posterior, par pesquisadores americanos com experiência em consultoria a publicações estrangeiras, principalmente a revista AIDS. A segunda etapa do projeto consiste em agrupar e montar um número especial da revista AIDS. Este suplemento será formado par um conjunto de artigos relatando pesquisas de excelência e os artigos elaborados nos seminários de redação. Para compor o conjunto de artigos para o número especial de AIDS, foram convidados pesquisadores nacionais com pesquisas de importância para a área de conhecimento, assim como aquelas pesquisas apoiadas pelo Programa Nacional de DST/AIDS. A segunda etapa do projeto consiste em coordenar a recebimento dos artigos, articular a tradução e adequação dos mesmos a língua inglesa, e elaborar uma apresentação que coloque a importância dessa iniciativa. Essa iniciativa permitirá levar a comunidade científica internacional aspectos pouco conhecidos da realidade de luta contra a epidemia de aids no Brasil. Esses aspectos são fundamentais para a entendimento do processo que levou a um programa com tanto êxito e reconhecimento uma vez que parte desse sucesso deve-se ao trabalho do Ministério da Saúde com a academia e com organizações não governamentais. Esse diálogo entre governo e instituições, tanto de ensino e pesquisa como de prestação de serviços, permeou e norteou as ações e os programas voltados ao controle da epidemia no pais. Assim, esperamos obter, na primeira fase do projeto, um produto final constituído de 16 artigos científicos sobre pesquisas de relevância, realizadas no Brasil e prontos a serem submetidos a publicação em revista estrangeira. A segunda fase resultara na soma desses artigos com os trabalhos elaborados pelos pesquisadores convidados, finalizando, assim, um conjunto de artigos a serem publicados em um suplemento da revista AIDS. A experiência brasileira de combate a epidemia de HIV/AIDS é bastante conhecida e reconhecida como bem sucedida, em todo o mundo. O esforço do Programa Nacional de DST/AIDS para, em pouco tempo, responder as necessidades da população vivendo com HIV e Aids, tem servido de exemplo tanto para países em desenvolvimento como para os desenvolvidos. No entanto, em que pese o enorme respeito as propostas brasileiras, pouco se sabe sobre o processo de conhecimento que foi gerado no pais, em relação a Aids. Esse projeto tem como objetivo preparar uma publicação internacional de grande impacto na área de saúde pública como e a revista AIDS. Esperamos editar um suplemento especial da revista com os artigos científicos que possam disseminar, alem de nossas fronteiras, a ampla gama de pesquisas realizadas no Brasil. Assim, serão preparados artigos sobre temas que vão desde a prevenção realizada por prostitutas no Amazonas, a estudo de biologia molecular mostrando a diversidade de subtipos do HIV existentes no país. Esperamos, com isso, tornar visível a comunidade científica, grande parte dos estudos que sustentam o programa de combate a infecção pelo HIV e a aids no Brasil.

Objetivo: Mostrar, para a comunidade internacional, as variadas e amplas ações voltadas ao conhecimento e ao combate da Aids e da infecção pelo HIV realizadas no Brasil e apoiadas pelo Programa Nacional de DST/Aids.

Metodologia: A metodologia definida para o processo de elaboração dos artigos já vem sendo utilizada há alguns anos pelos pesquisadores envolvidos nesse projeto e tem se mostrado bastante eficiente. Consta de três momentos, partindo da seleção dos projetos participantes e da formação de grupos constituídos por dois ou três projetos e um orientador. Esses grupos trabalharão cada tema, elaborando os artigos e submetendo cada etapa produzida à revisão por pares. Serão realizados dois encontros de uma semana cada, em período integral. Nessas duas ocasiões serão discutidos e redigidos os artigos. Em um terceiro encontro os artigos serão submetidos a revisão por pares, sendo a primeira revisão por pares do Brasil e a segunda por pessoas de fora do pais. Essas comissões de avaliação serão compostas por pesquisadores nacionais e internacionais com experiência em produção e publicação de artigos assim como de avaliação dos mesmos. Após esse processo um conjunto de 16 artigos, em inglês, já submetidos à revisão de profissionais da área, tanto do Brasil como de fora, estarão prontos a serem submetidos a revista. A segunda etapa do projeto consta da reunião dos artigos da primeira fase com os textos submetidos diretamente ao grupo, pelos pesquisadores convidados. Assim, além dos 16 artigos preparados durante a primeira etapa, dos seminários, a coordenação do projeto reunira os artigos de pesquisadores convidados, com resultados de pesquisas de excelência, e formará um conjunto de textos sobre as várias experiências do Brasil no combate a epidemia de infecção pelo HIV.

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: CAPACITAÇÃO E FORMAÇÃO EM PESQUISA

Produção Científica


Projeto: DESENVOLVIMENTO E MANUTENÇÃO DE UM NÚCLEO DE REFERÊNCIA EM BIOINFORMÁTICA PARA DAR SUPORTE E TREINAMENTO AOS PROJETOS DESENVOLVIDOS PELO CN-DST/AIDS - FASE I.
Coordenador: LUIZ CARLOS JUNIOR ALCANTARA
Resumo: O Núcleo de Bioinformática do LASP no desenvolvimento de suas atividades dará oportunidade ao CN-DST/AIDS, bem como outras instituições de Saúde Pública e toda a comunidade científica que estuda o HIV-1 no Brasil, o acesso aos bancos de dados em HIV e também aos programas de bioinformática que possam ser utilizados como ferramentas para analises das seqüências geradas e utilização dos resultados para desenvolvimento de vacinas potenciais (numa tentativa de controlar a infecção do HIV no nosso país) e promover o desenvolvimento de uma terapia antiretroviral de alta atividade, podendo assim causar um grande impacto na história natural da infecção, diminuindo a mortalidade e morbidade, melhorando a qualidade de vida dos pacientes com AIDS. Este novo projeto visa transformar o laboratório de bioinformática do LASP no Núcleo de Referência em Bioinformática para dar suporte ao Ministério da Saúde na caracterização do HIV-1 no Brasil, criando um banco de dados das seqüências geradas no país e realizando todas as devidas análises. Mas para isto seria necessário, além da maior dedicação ao desenvolvimento deste Núcleo, ampliarmos os recursos para assim podermos alcançar os objetivos propostos.

Objetivo: Descrever o que se deseja alcançar ao final da execução das ações do projeto. Capacitação do Laboratório de Bioinformática do LASP/CPqGM/FIOCRUZ (http://lasp.cpqgm.fiocruz.br) em um Núcleo de Referência em Bioinformática para dar suporte ao CN-DST/AIDS do Ministério da Saúde na criação de um repositório de seqüências genéticas do HIV-1, ministrar treinamento específico em bioinformática a outros pesquisadores da rede e transferir esta tecnologia para outros núcleos emergentes de bioinformática no Brasil.

Metodologia: O laboratório de bioinformática do LASP/CPqGM/FIOCRUZ foi instalado entre o final de 2003 e início de 2004, contendo servidores e estações de trabalho com todos os programas necessários para realização de pesquisa genética em HIV-I e HTLV-I. A interface integrada para análise de seqüências do HIV-I baseada no "(GDE)" instalada no servidor L1NUX, sendo acessada remotamente (via "network") pelas estações de trabalho. A interface GDE contem programas de bioinformática necessários para edição, alinhamento e análises citogenéticas de seqüências retrovirais (de Oliveira el at. 2003). Possuímos também um web site do laboratório do (LASP/CPqGM/FIOCRUZ) contendo um banco de dados (separado por regiões gênicas) de seqüências brasileiras do HTV-I e de seqüências do HTLV-I provenientes de todo o mundo. Estes bancos de todos estão separado por nome do vírus, números de acessos, procedências, subtipos, referências bibliográficas, além dos respectivos alinhamentos e análises filogenéticas geradas no laboratório do LASP. Todas essas informações encontram-se disponíveis para o "download" das mesmas. O banco de dados completo de seqüências de HIV e HTLV será desenvolvido usando o programa HIVBase ™ (Lammers et al. 2003). Este programa permite ao usuário além de adicionar as seqüências ao banco de dados, complementar com informações epidemiológicas e clínicas dos pacientes. Como exemplo das informações que serão depositadas no banco de dados temos: informações sobre o paciente (idade, sexo), exames clínicos (carga viral, contagem de CD4, doenças oportunistas, genotipagem), tratamento (droga utilizada, nível de resistência) e seqüência (região genética, subtipo, etc.), o banco de dados será desenvolvido junto ao CN-DST/AIDS e será adaptado para conter informações necessárias para o estudo de resistência e desenvolvimento ele vacinas a nível nacional. Como descrito anteriormente, um dos principais objetivos do projeto e o treinamento de pesquisadores a nível local e nacional e capacitação de outras unidades ele bioinformática no Brasil.

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: BIOINFORMÁTICA

Produção Científica


Projeto: Desenvolvimento e manutenção de um Núcleo de Referência em Bioinformática para dar suporte e treinamento aos projetos desenvolvidos pelo CN-DST/AIDS, Ministério da Saúde. Fase II
Coordenador: LUIZ CARLOS JUNIOR ALCANTARA
Resumo: O Núcleo de Bioinformática do LASP no desenvolvimento de suas atividades dará oportunidade ao CN-DST/AIDS, bem como outras instituições de Saúde Pública e toda a comunidade científica que estuda o HIV-I no Brasil, o acesso aos bancos de dados em HIV e também aos programas de bioinformática que possam ser utilizados como ferramentas para análises das seqüências geradas e utilização dos resultados para desenvolvimento de vacinas potenciais (numa tentativa de controlar a infecção do HIV no nosso país) e promover o desenvolvimento de uma terapia antiretroviral de alta atividade, podendo assim causar um grande impacto na história natural da infecção, diminuindo a mortalidade e morbidade, melhorando a qualidade de vida dos pacientes com AIDS. Capacitação do Laboratório de Bioinformática do LASP/CPqGM/FIOCRUZ (http://lasp.cpggm.fiocruz.br) em um Núcleo de Referência em Bioinformática para dar suporte ao CN-DST/AIDS do Ministério da Saúde na criação de um repositório de seqüências genéticas do HIV-1, ministrar treinamento específico em bioinformática a outros pesquisadores da rede e transferir esta tecnologia para outros núcleos emergentes de bioinformática no Brasil. As características do HIV incidente no período inicial da infecção, quando ocorre o surgimento de resposta imune celular e humoral no hospedeiro podem trazer contribuições importantes as iniciativas vacinais. O isolamento e a caracterização dessas variantes e fundamental para o desenvolvimento de vacinas contra o HIV/AIDS. Um dos estudos que pode contribuir com esta proposta e a determinação dos epítopos virais para células citotóxicas (CTL), específicas para o HIV. A identificação desses epítopos, sua proporção nas diferentes variantes circulantes e a avaliação de sua prevalência para os vírus incidentes poderão orientar no desenvolvimento vacinas. Outro aspecto de grande importância em saúde pública e o impacto da variabilidade do vírus circulante na capacidade dos testes comerciais de determinar a infecção pelo HIV. Avanços recentes tem leva do a um aumento no número de dados de seqüências de HIV em todo mundo. A maioria dessas informações adquiridas esta depositada em repositórios públicos, como o Banco de Dados de Seqüências do HIV de Los Alamos (Kuiken et al., 2000). Estes grupos de dados constituem uma importante fonte de informações sobre as seqüências e epitopos para uso em estudos evolucionários e desenvolvimento de vacinas. Novas ferramentas em bioinformática são necessárias para o direcionamento efetivo, análise e interpretação de novos dados que estão sendo constantemente gerados na Rede Nacional de isolamento e caracterização ao dos subtipos do HIV no Brasil. Diferentes programas "Softwares", que trabalham de maneira individual, alinham, editam e realizam análises filogenéticas, mas são difíceis de localizar e utilizar Para facilitar a exploração dos dados gerados, foi desenvolvido na África do Sul, pelo pesquisador Túlio de Oliveira (Nelson Mandem Medical School), e implantado no laboratório de Bioinformática do LASP, um sistema de trabalho em bioinformática, que combina a flexibilidade do sistema "Genético Data Environment" (GDE) com o poder do sistema L1NUX. GDE e um programa de análises de seqüências, originalmente desenvolvido pelos sistemas SUN UNIX™ (Smith et al., 1994). O GDE-L1NUX reduz a complexidade e natureza repetitiva de formatações importadas e exportadas e facilita o desenvolvimento de banco de dados bem localizados e de utilidade bem definida a uma população e/ou doença específica. GDE-L1NUX e particularmente utilizado em análise evolucionária e de diagnóstico de patógenos virais (HIV, HBV, HCV, HHV-8, HTLV-1). Todos os bancos de dados seqüência-específicos, programas e informações necessárias para o estudo da diversidade e filogenia molecular do HIV-1 foram integrados em uma única interface GDE Linux. Assim, informações sobre localização da seqüência, detecção de contaminação, subtipo genético, outras linhagens, resistência a drogas, epitopos importantes, recombinantes, regiões subgenômicas e taxa de evolução são facilmente importadas. Avanços recentes no seqüenciamento e bioinformática tornaram mais fácil analisar seqüências do HIV-1 e correlacionar à informação genética com as propriedades biológicas e imunológicas deste vírus. Estes avanços, combinados com o desenvolvimento de um banco de dados de seqüências de HIV-1 no Brasil baseado no software HIVBase ™ serão de grande utilidade para desenvolvimento de candidatos a vacinas e controle das drogas, permitindo nos direcionarmos para uma melhor prevenção e seleção do tratamento eficaz no Brasil. O conhecimento genotípico das cepas de HIV presentes no Brasil ira corroborar com a seleção de um tratamento seguro e eficaz, reduzindo assim a morbidade e morte prematura devido ao HIV-1 e AIDS, além de desempenhar um papel importante na redução da transmissão. O laborat6rio de bioinformática do LASP/CPqGM/FIOCRUZ foi desenvolvido a partir de financiamento obtido pela aprovação de um projeto de infra-estrutura da FAPESB (convênio 303/2003) de R$286.000,00; cujo objetivo principal seria dar suporte as análises de seqüências virais dos projetos em desenvolvimento no LASP. A primeira meta deste projeto, após instalação do laboratório (que já consta de 4m servidor de alta velocidade com os sistemas Linux e Windows e 15 estações de trabalho, todas equipadas com os programas de bioinformática para análises de seqüências gênicas e protéicas, um técnico em bioinformática e coordenado pelo pesquisador Luiz Carlos Junior Alcântara), foi ministrar um treinamento teórico-prático (durante duas semanas) a todos os usuários deste laboratório, bem como a outros pesquisadores de outros centros, com informações completas na web site http://iasp.cpggm.fiocruz.br. Este projeto consta com mais dois outros cursos que serão realizados em junho/2004 e novembro/2004, sendo que o primeiro será ministrado pela Dra. Flora Fernandes (USP-São Paulo), Dr. Luiz Carlos J. Alcântara (LASP), Dr. Túlio de Oliveira (África do Sul), Dr. Marco Salemi (EUA) e Dr. Mika Salminen (Finlandia), durante uma semana, e o último será um Workshop Latino-americano organizado pela Dra. Anne-Mieke Vandamme (Belgica), com a participação de outros especialistas internacionais em análises de seqüências do HIV e HTLV-1. Este novo projeto visa transformar o laboratório de bioinformática do LASP no Núcleo de Referência em Bioinformática para dar suporte ao Ministério da Saúde na caracterização do HIV-1 no Brasil, criando um banco de dados das seqüências geradas no país e realizando todas as devidas análises. Mas para isto seria necessário, além da maior dedicação ao desenvolvimento deste Núcleo, ampliarmos os recursos para assim podermos alcançar os objetivos propostos.

Objetivo: Capacitação do Laboratório de Bioinformática do LASP/CPqGM/FIOCRUZ (http://lasp.cpggm.fiocruz.br) em um Núcleo de Referência em Bioinformática para dar suporte ao CN-DST/AIDS do Ministério da Saúde na criação de um repositório de seqüências genéticas do HIV-1, ministrar treinamento específico em bioinformática a outros pesquisadores da rede e transferir esta tecnologia para outros núcleos emergentes de bioinformática no Brasil.

Metodologia: O laboratório de bioinformática do LASP/CPqGM/FIOCRUZ foi instalado entre o final de 2003 e início de 2004, contendo servidores e estações de trabalho com todos os programas necessários para realização de pesquisa genética em HIV-1 e HTLV-I. A interface integrada para análise de seqüências do HIV-1 baseada no "GDE" foi instalada no servidor Linux, sendo acessada remotamente (via "network") pelas estações de trabalho. A interface GDE contém programas de bioinformática necessários para edição, alinhamento e análises filogenéticas de seqüências retrovirais (de Oliveira et al. 2003). Possuímos também um website do laboratório (http://lasp.cpqgm.fiocruz.br) contendo um banco de dados (separado por regiões gênicas) de seqüências brasileiras do HIV-1 e de seqüências do HTLV-1 provenientes de todo o mundo. Estes bancos de dados está separado por nome do vírus, números de acessos, procedências, subtipos, referências bibliográficas, além dos respectivos alinhamentos e análises filogenéticas geradas no laboratório do LASP. Todas essas informações encontram-se disponíveis para o "download" das mesmas. O banco de dados completo de seqüências de HIV e HTLV será desenvolvido usando o programa HIVBaseTM (Lammers et al. 2003). Este programa permite ao usuário além de adicionar as seqüências ao banco de dados, complementar com informações epidemiológicas e clínicas dos pacientes. Como exemplo das informações que serão depositadas no banco de dados temos: informações sobre o paciente (idade, sexo, descendência), exames clínicos (carga viral e/ou pró-viral, contagem de CD4, doenças oportunistas, genotipagem), tratamento (droga utilizada, nível de resistência) e seqüências (região genética, subtipo, etc). O banco de dados será desenvolvido junto ao CN-DST/AIDS e será adaptado para conter informações necessárias para o estudo de resistência e desenvolvimento de vacinas a nível nacional. Como descrito anteriormente, um dos principais objetivos do projecto é o treinamento de pesquisadores a nível local e nacional e capacitação de outras unidades de bioinformática no Brasil. Treinamento e capacitação: Treinamentos serão ministrados no Núcleo de referência do LASP/CPqGM/FIOCRUZ (no primeiro ano) e nos laboratórios emergentes de bioinformática (no segundo ano). Treinamentos a serem desenvolvidos e professores envolvidos: 1.Treinamento em Bioinformática e Análises Genéticas e Evolutivas Virais. No Centro de Pesquisas Gonçalo Moniz, FIOCRUZ, Salvador, Bahia, Brasil. (Data: 29 de Janeiro a 6 de Fevereiro 2004). (Já realizado com recursos da FAPESB) Professores envolvidos: Dr. Luiz Carlos Alcântara (CPqGM/FIOCRUZ), Dra. Flora Maria de Campos Fernandes (Museu de Zoologia, USP) Dr. Túlio de Oliveira (Escola de Medicina Nelson Mandela, África do Sul) Dr. Marcelo Soares (Dep. De genética, UFRJ). 2. Estudos Avançados em Bioinformática e Analises Evolutivas Virais. No Centro de Pesquisas Gonçalo Moniz, FIOCRUZ, Salvador, Bahia, Brasil. (Data: 14 a 19 de Junho 2004) (A ser realizado com recursos da FAPESB ) Professores envolvidos: Dr. Marco Salemi (John Hopkins School of Medicine, USA). Dr. Mika Salminem (Departamento de Saúde da Finlândia) Dr. Sussana Lammers (HIVBase, GeneJohnson, USA). (recursos deste novo projeto) Dr. Luiz Carlos Alcântara (CPqGM/FIOCRUZ), Dra. Flora Maria de Campos Fernandes (Museu de Zoologia, USP) Dr. Túlio de Oliveira (Escola de Medicina Nelson Mandela, África do Sul) Dr. Marcelo Soares (Dep. De genética, UFRJ). Dr. Richard Charles Garratt (USP-São Carlos) (Recursos deste novo projeto) 3. Segundo Workshop Brasileiro em Evolução Viral e Epidemiologia Molecular / Primeiro Workshop Latino Americano em Evolução Viral e Epidemiologia Molecular. No Centro de Pesquisas Gonçalo Moniz, FIOCRUZ, Salvador, Bahia, Brasil. (Data: 01 da 06 de novembro de 2004). (A ser realizado com recursos da FAPESB ) 4.Curso de instalação e desenvolvimento de núcleos de bioinformática e treinamento em analises de sequências. Laboratório de Bioinformática a ser definido (sugestão: Adolfo Lutz, São Paulo). Professores envolvidos: Dr. Marco Salemi (John Hopkins School of Medicine, USA). Dr. Luiz Carlos Alcântara (CPqGM/FIOCRUZ). Dr. Túlio de Oliveira (Escola de Medicina Nelson Mandela, África do Sul) Ramon Moreau (CPqGM/FIOCRUZ). 5. Curso de instalação e desenvolvimento de núcleos de bioinformática e treinamento em analises de sequências. Laboratório de Bioinformática a ser definido. Professores envolvidos: Dr. Marco Salemi (John Hopkins School of Medicine, USA). Dr. Luiz Carlos Alcântara (CPqGM/FIOCRUZ). Dr. Túlio de Oliveira (Escola de Medicina Nelson Mandela, África do Sul) Ramon Moreau (CPqGM/FIOCRUZ). 6. Terceiro Workshop Brasileiro em Evolução Viral e Epidemiologia Molecular / Primeiro Workshop Latino Americano em Evolução Viral e Epidemiologia Molecular. Local a ser definido pelo Ministério da Saúde. (Data: Novembro 2005). Professores envolvidos: Dr. Marco Salemi (John Hopkins School of Medicine, USA). Dr. Anemieke VanDamme (Instituto Rega, Universidade Católica de Leuven, Bélgica). Dr. Philippe Lemey (Instituto Rega, Universidade Católica de Leuven, Bélgica). Dr. Robert Miller (Inpharmatica, Reino Unido). Sonia VanDoren (Instituto Rega, Universidade Católica de Leuven, Bélgica). Dr. Luiz Carlos Alcântara (CPqGM/FIOCRUZ), Dra. Flora Maria de Campos Fernandes (Museu de Zoologia, USP) Dr. Túlio de Oliveira (Escola de Medicina Nelson Mandela, África do Sul) Dr. Marcelo Soares (Dep. De genética, UFRJ). Professores envolvidos: Dr. Marco Salemi (John Hopkins School of Medicine, USA). Dr. Anne-Mieke Vandamme (Instituto Rega, Universidade Católica de Leuven, Bélgica). Dr. Philippe Lemey (Instituto Rega, Universidade Católica de Leuven, Bélgica). Dr. Robert Miller (Inpharmatica, Reino Unido). (recursos deste novo projeto) Sonia VanDoren (Instituto Rega, Universidade Católica de Leuven, Bélgica). Dr. Luiz Carlos Alcântara (CPqGM/FIOCRUZ), Dra. Flora Maria de Campos Fernandes (Museu de Zoologia, USP) Dr. Túlio de Oliveira (Escola de Medicina Nelson Mandela, África do Sul) Dr. Marcelo Soares (Dep. De genética, UFRJ). 4. Curso de instalação e desenvolvimento de núcleos de bioinformática. No Centro de Pesquisas Gonçalo Moniz, FIOCRUZ, Salvador, Bahia, Brasil. (Data: 7 da 13 de Novembro 2004). (A ser realizado com recursos deste novo projeto que está sendo submetido ao Ministério da Saúde ) Professores envolvidos: Dr. Marco Salemi (John Hopkins School of Medicine, USA). Dr. Luiz Carlos Alcântara (CPqGM/FIOCRUZ). Dr. Túlio de Oliveira (Escola de Medicina Nelson Mandela, África do Sul) Domingos Ramon Moreau da Cunha (CPqGM/FIOCRUZ). Cursos a serem desenvolvidos em 2005: 5. Curso de instalação e desenvolvimento de núcleos de bioinformática e treinamento em analises de sequências. Laboratório de Bioinformática (local a ser definido) (sugestão: Adolfo Lutz, São Paulo). (A ser realizado com recursos deste novo projeto que está sendo submetido ao Ministério da Saúde ) Professores envolvidos: Dr. Marco Salemi (John Hopkins School of Medicine, USA). Dr. Luiz Carlos Alcântara (CPqGM/FIOCRUZ). Dr. Túlio de Oliveira (Escola de Medicina Nelson Mandela, África do Sul) Domingos Ramon Moreau da Cunha (CPqGM/FIOCRUZ). 6. Curso de instalação e desenvolvimento de núcleos de bioinformática e treinamento em analises de sequências. Laboratório de Bioinformática a ser definido. (A ser realizado com recursos deste novo projeto que está sendo submetido ao Ministério da Saúde ) Professores envolvidos: Dr. Marco Salemi (John Hopkins School of Medicine, USA). Dr. Luiz Carlos Alcântara (CPqGM/FIOCRUZ). Dr. Túlio de Oliveira (Escola de Medicina Nelson Mandela, África do Sul) Domingos Ramon Moreau da Cunha (CPqGM/FIOCRUZ). 7. Terceiro Workshop Brasileiro em Evolução Viral e Epidemiologia Molecular / Primeiro Workshop Latino Americano em Evolução Viral e Epidemiologia Molecular. Local a ser definido pelo Ministério da Saúde. (Data: Novembro 2005). (A ser realizado com recursos deste novo projeto que está sendo submetido ao Ministério da Saúde ) Professores envolvidos: Dr. Marco Salemi (John Hopkins School of Medicine, USA). Dr. Anemieke VanDamme (Instituto Rega, Universidade Católica de Leuven, Bélgica). Dr. Philippe Lemey (Instituto Rega, Universidade Católica de Leuven, Bélgica). Dr. Túlio de Oliveira (Escola de Medicina Nelson Mandela, África do Sul) Sonia VanDoren (Instituto Rega, Universidade Católica de Leuven, Bélgica). Dr. Luiz Carlos Alcântara (CPqGM/FIOCRUZ), Dra. Flora Maria de Campos Fernandes (Museu de Zoologia, USP)

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: BIOINFORMÁTICA

Produção Científica


Projeto: Estudo da Soroprevalência da Infecção pelo HIV, Sífilis e Hepatite C em instituições públicas de atenção a Saúde Mental: Um Estudo Multicêntrico Nacional
Coordenador: MARK DREW CROSLAND GUIMARÃES
Resumo: Estudo de corte transversal com componentes quantitativo e qualitativo tendo como principal objetivo determinar a prevalência da infecção pelo HIV, sífilis e hepatite C e os fatores associados com a positividade entre pacientes internados em hospitais psiquiátricos públicos e entre pacientes em acompanhamento em serviços substitutivos (CAPS) em amostra representativa nacional. Os participantes serão submetidos a uma entrevista estruturada que abordara aspectos sócio-demográficos, psicossociais, comportamentais, clínicos e aqueles relativos aos serviços. Dados complementares serão obtidos dos prontuários médicos. A análise quantitativa incluíra distribuição de freqüência, análise univariada e multivariada por meio do modelo de regressão logística binomial e polinomial. Serão estimados os odds ratios com intervalo de confiança de 95%. A abordagem qualitativa incluirá entrevistas em profundidade abertas com pacientes dos centros selecionados e grupos focais com profissionais de saúde envolvidos com a atenção a saúde de indivíduos portadores de sofrimento mental, procurando compreender o processo vivenciado pelos pacientes/profissionais durante o tratamento/acompanhamento. Os resultados deverão ser utilizados pelos serviços de saúde participantes e pelo Ministério da Saúde (PN-DST/AIDS e Área Técnica em Saúde Mental) na compreensão e elaboração de estratégias de melhoria da atenção a saúde dos pacientes que se encontram infectados pelo HIV, sífilis e hepatite C bem como para auxiliar na implementação de medidas de prevenção destas condições.

Objetivo: Determinar a prevalência de HIV, sífilis e hepatite C em hospitais psiquiátricos e em serviços substitutivos (CAPS) públicos, em amostra representativa nacional selecionada aleatoriamente, estratificando pelo tipo de serviço (Hospitais e CAPS) e ponderando-se pela distribuição populacional dos municípios. Descrever o perfil sócio-demográfico, de comportamento e situação de risco, e de atenção a saúde, incluindo diagnóstico, tratamento e tempo de internação, dos pacientes hospitalizados e/ou em acompanhamento nas instituições selecionadas. Avaliar a existência de associação entre a prevalência de HIV, sífilis e Hepatite C e as características sócio-demográficas, de comportamento e situação de risco, e de atenção a saúde dos participantes. Avaliar a estrutura dos servi90s (hospitais, CAPS) envolvidos no estudo. Descrever os aspectos etnográficos/qualitativos e de representação social dos participantes em relação aos comportamentos e situações de risco identificados.

Metodologia: Desenho: Será realizado estudo de corte transversal por um período de aproximadamente 1 (um) mês, durante o qual será determinada a prevalência da infecção pelo HIV, sífilis e hepatite C entre os pacientes internados ou em atendimento nos centros selecionados. Informações sobre a atenção a saúde, incluindo os aspectos clínicos, o perfil sócio-demográfico e as características dos serviços serão coletados retrospectivamente. Sorologias: Será oferecido aos participantes a oportunidade de fazer exames para sífilis, hepatite C e HIV, com aconselhamento pré e pós-teste. Aqueles que concordarem (vide consentimento abaixo) terão 1 ml de sangue coletado por meio de punção com lanceta na polpa do dedo indicador para realização dos exames específicos. O sangue será coletado em papel filtro, seguindo normas padronizadas, secados ao ar livre e posteriormente enviados para a Coordenação Central. A positividade para sífilis será feita utilizando técnica de detecção de IgM em Kit testado e avaliado para papel filtro. De maneira semelhante, a positividade para o HIV (ELISA - Enzyme-linked Immunoassay) e hepatite C (anti-corpos IgG) será feita também utilizando metodologias testadas e avaliadas para aplicação em papel filtro (CAIAFFA, 2001). Chamamos atenção para o fato de que estes exames serão considerados como exames iniciais de triagem, e não serão utilizados para fins de diagnóstico. Todos os pacientes positivos nestes nesta etapa deverão ser encaminhados aos serviços de referência para confirmação laboratorial seguindo protocolo do Ministério da Saúde, principalmente para o HIV. Será de responsabilidade dos serviços participantes este encaminhamento e a comunicação dos resultados aos pacientes. Neste caso, deverão ser realizados dois ELISA, com princípios ativos diferentes e confirmação realizada por meio de Western Blot ou Imunodeficiência, enquanto que para hepatite C será feita esta confirmação poderá ser feita por método mais específico (RIBA - Recombinant Immunoblot Assay). Em todos os exames serão utilizadas técnicas padronizadas e disponíveis no mercado. Os exames serão realizados, de forma centralizada, em laboratório de referência da Faculdade de Medicina da UFMG (NUPAD - Núcleo de Propedêutica e Atenção Diagnóstica). Entrevista Semi-Estruturada e Questionário de Avaliação do Serviço: Todos os pacientes selecionados para a pesquisa, e que concordarem em participar, serão submetidos a uma entrevista semi-estruturada para verificar as características sócio-demográficas, de comportamento e situação de risco e de atenção a saúde incluindo: idade, nível de instrução, residência, renda familiar, diagnóstico, tratamentos e condutas, história e diagnóstico de doenças sexualmente transmissíveis, tempo de internação, comportamento sexual, uso de álcool e drogas lícitas, tabagismo, encarceramento, violência verbal, física e sexual e outros fatores associados com o risco de transmissão das infecções de interesse. Informações complementares serão extraídas dos prontuários médicos. Propõe a realização de entrevista semi-estruturada com perguntas fechadas e abertas. Tanto a entrevista quanta a coleta de sangue deverão ser realizadas dentro da rotina dos servi 5, visando minimizar possíveis desconfortos aos pacientes. O instrumento para a responder aos objetivos 2 e 3 foram preparados e testados em estudo piloto, e ainda poderão sofrer alterações finais. Para o objetivo 4, será utilizado o instrumento de avaliação de estrutura de serviços adaptado e testado em estudo piloto para as instituições psiquiátricas (Hospitais e CAPS). A aplicação deste instrumento será feita pelo supervisor local no decorrer da pesquisa e objetiva avaliar a estrutura dos serviços, As variáveis de interesse para este item incluem numero de leitos, numero, tipo e capacitação dos profissionais ligados a saúde mental, existência de atenção clinica e/ou cirúrgica, numero e capacitação dos profissionais clínicos/cirúrgicos, numero e qualidade de manutenção de consultórios, salas de cirurgia (e outros) e dos instrumentos, dentre outros. Os instrumentos serão testados e avaliados quanta a sua confiabilidade em estudo piloto. Estudo Qualitativo: Para analisar os aspectos psicossociais referente ao tema em estudo, em abordagem qualitativa, optou-se pelo referencial das representações sociais. Jovchelovitch & Guareschi (1995) enfatizam o significado dessas representações enquanto um fenômeno psicossocial que se encontra arraigado no espaço público e nos processos através dos quais o individuo desenvolve uma identidade social, cria símbolos e abre-se para a diversidade de um mundo coletivo. Os significados são elaborados por um grupo social que se transformam e se tornam subjetivados. A coleta de dados será realizada através de um roteiro de entrevistas, que serão gravadas com o prévio conhecimento e consentimento dos participantes. Esta prevista a realização de 60 entrevistas para avaliar o use do preservativo, conhecimentos e atitudes em relação as DSTs/AIDS, comportamentos de risco e vulnerabilidade para o HIV e conhecer as representações sociais a respeito da sexualidade e da relação de gênero. Também fez parte do estudo piloto a aplicação e avaliação de algumas entrevistas qualitativas. Roteiro: A entrevista constara de uma questão norteadora, naão-diretiva, em forma de relato de vida no sentido que lhe confere Bertaux (1997) e Gaulejac (2001): "Conte-me sobre sua vida afetiva e sexual". (Caso seja necessário relançar a fala do entrevistado, levantar questões relativas as idéias/representações sobre as doenças, sobre formas de prevenção (conhecimento e escolhas), temores, religiosidade, parceiros amorosos e sexuais, prazer e amor). Para estes autores, e necessário entender que entre as experiências vividas e seu relato se interpõem diversas mediações (percepção, memória, refletividade do sujeito, suas capacidades narrativas e os parâmetros da situação da entrevista, etc), que devem ser ainda mais consideradas no que se refere a pessoas com doença mental. Porem, Bertaux (1997) nos lembra que estas mediações, também para pessoas que tem sofrimento mental, trazem consigo as significações que o sujeito atribui as experiências e que servem de substrato, por isto mesmo, para suas ações, atitudes e posturas diante da pr6pria vida e nas relações sociais, no presente e no futuro. Assim, e dispondo de uma serie de testemunhos sobre o mesmo objeto social, o pesquisador deve buscar um núcleo comum das experiências, que corresponde a sua dimensão social numa abordagem sociológica, conferindo-lhe o caráter de rigor necessário a pesquisa. As entrevistas serão gravadas em fita cassete, mediante autorização previa e transcritas na integra. O tempo de entrevista e o número de encontros não serão definidos a priori, ficando a cargo do pesquisador e do entrevistado, durante este processo, decidirem sobre a finalização da coleta. O numero de participantes também não e definido anteriormente e o critério para a suspensão de novas entrevistas será o da repetitividade de conteúdos, quando ha saturação de informações, o que permitira estabelecer uma análise rigorosa e contextualizada posteriormente, considerando-se o ponto de vista dos sujeitos. Assim, e obrigatório que a analise preliminar das entrevistas seja realizada durante a coleta, havendo uma primeira listagem de unidades temáticas abordadas pelos sujeitos. A definição inicial de inclusão de 60 participantes na pesquisa qualitativa deve-se, então, a necessidade de programação e de orçamento no projeto. Analise das informações: A análise das entrevistas fundamenta-se na proposta de análise narrativa de Demaziere e Dubar (1997), que e dividida em 3 etapas. A primeira etapa do trabalho corresponde à análise de cada entrevista, separadamente. Nesta etapa, o primeiro momento e o de leitura vertical (BLANCHET & GOTMAN, 1992), buscando o sentido global de cada uma, quando também noções e palavras que chamam a atenção são marcadas, permitindo conhecer o "tom" da entrevista e indicar os temas presentes. Num segundo momento, chamado de leitura horizontal (BLANCHET & GOTMAN, 1992), o conjunto do texto e numerado em seqüências, fazendo surgir os enunciados que explicitam o campo de significações para a pessoa que fala em torno de cada objeto do discurso. Estes objetos se encontram, obviamente, espalhados ao longo da fala, pois este e sempre um processo de idas e vindas para apresentá-los e justificá-los. Em seguida, os objetos e suas explicações serão reagrupados, reorganizando as seqüências por temas, na totalidade do relato, tentando encontrar, acompanhar e reproduzir o trabalho de categorização que o próprio entrevistado realizou. A tematização permite, assim, recuperar a complexidade das experiências dos entrevistados, numa leitura horizontal, e os enunciados serão categorizados nas suas similitudes e diferenciações, nas disjunções e conjunções apresentadas. A segunda etapa do trabalho consiste em encontrar o que e comum e discordante no conjunto de entrevistados para agrupar e categorizar o significados explicitados, numa leitura chamada de transversal (BLANCHET & GOTMAN, 1992), desvelando as representações que os entrevistados tem sobre as doenças, os riscos e a prevenção das DST e HIV/AIDS. Em seguida, passa-se a terceira etapa, correspondente ao fechamento da análise, que podemos chamar de teorização, onde as categorias surgidas na analise das entrevistas são aprofundadas pelas leituras e reflexões teóricas do pesquisador (DEMAZIERE & DUBAR, 1997). Tamanho da Amostra: Considerando os objetivos do estudo de se estimar a prevalência de quatro condições diferentes, optou-se por uma estimativa preliminar de tamanho amostral baseada nos seguintes parâmetros: estimativa media das condições (o mais conservador possível) de 50%, um nível de precisão de 0,2% (considerando a necessidade de obter estimativas estratificadas) e um nível de confiabilidade de 5%. Serão necessários 2.401 pacientes para se estimar a verdadeira prevalência das condições de interesse. Considerando uma perda estimada de 40%, o numero amostral final foi calculado em 3.362 (FOREMAN, 1991; SIQUEIRA 2001; LEVY & LEMESHOW 1991). Escolhido o tamanho de amostra total, o próximo passo foi proceder a amostragem estratificada por região do país, com partilha proporcional de acordo com a distribuição dos casos de AIDS notificados ate dezembro de 2003, e tipo de atendimento (Hospitais e CAPS). Visando obter uma menor variabilidade amostral entre as unidades selecionadas na região Sudeste, ajustou-se o numero final de pacientes a serem selecionados de acordo com o centro com o menor numero de leitos da seguinte forma: Probabilidade amostral de cada um dos centros selecionados = P(n) = Número de leitos/Total de leitos Ajuste da probabilidade amostral = A(n)=P(i)/P(n), sendo P(i) aquele com menor probabilidade Ajuste do numero final de pacientes = A(f)= A(n)*(Numero de leitos de cada centro) O tempo de permanência, longa permanência (acima de um ano) e menos que um ano, será avaliado a posteriori. O plano amostral foi assim constituído de cinco etapas: 1. Cálculo amostral; 2. Distribuição da amostra de acordo com os estratos Hospitais e CAPS; 3. Ponderação de cada estrato de acordo com as Regiões e distribuição dos casos de AIDS; 4. Seleção aleatória, dentro de cada estrato (região), dos Hospitais ou CAPS; 5. Seleção aleatória dos pacientes a serem testados dentro de cada unidade. Finalmente, após a coleta dos dados, para obtermos as estimativas das prevalências da infecção pelo HIV, hepatite C e sífilis, devemos respeitar o plano amostral adotado. Os CAPS e Hospitais sorteados encontram-se no Quadro 1. PLANO DE COLETA: Protocolo: Utilizando o plano amostral cada centro devera seguir de forma padronizada a seleção dos pacientes, a aplicação do questionário, incluindo a coleta de dados do prontuário, e coleta de sangue para exames. Seleção do Paciente: A amostra de pacientes hospitalizados será selecionada a partir de listagem de pacientes internados no momento da pesquisa. Para os CAPS, propõe a seleção de pacientes de forma seqüencial durante o período designado para a realização da pesquisa (um mês), de acordo com planilha amostral pré-definida. Esta deve estar disponível em um local (e.g. enfermaria, recepção, ambulatório) que facilite a seleção, em todos os turnos, de forma seqüencial. O Coordenador Local ficará responsável pela supervisão deste processo. Chegando o paciente para atendimento, no caso dos CAPS, a recepção deve verificar a lista e caso aquele paciente tenha sido selecionado, será alocado um número de identificação (IDENT), que deve ser anotado na Ficha de Controle de Recrutamento. Estes números estão pré-definidos para cada centro participante. Não devem ser alterados. A recepção deve repassar este anexo para o Coordenador na medida em que as seleções ocorrerem. Não devem ser acumuladas. Por número de ordem (ORDEM) entende-se a seqüências de chegada dos pacientes em cada centro, e ao final do recrutamento deve coincidir com o tamanho amostral. O número de identificação (IDENT) e previamente definido para toda a pesquisa. Para os pacientes internados, a Coordenação Local deve dispor de uma listagem dos pacientes que serão selecionados aleatoriamente de acordo com os números previamente definidos por centro. Deve-se então localizar o paciente (enfermaria, quarto, leito etc.) a fim de viabilizar a coleta de sangue e a entrevista. Entrevistas Semi-Estruturadas e Coleta de Sangue: O Coordenador Local devera indicar ao entrevistador e ao técnico o momento da entrevista a coleta da material. Recomenda-se que a coleta de sangue seja feita antes da entrevista, provavelmente dentro da rotina do serviço. Este item pode ser flexibilizado de acordo com as necessidades locais. Ressalta-se que o termo de consentimento deve ser obtido antes das atividades previstas, quer seja entrevista ou coleta. O termo de consentimento devera ser aplicado por pessoa treinada para este fim, de preferência o próprio coordenador ou o entrevistador. As instruções de coleta preparo, armazenamento e transporte das amostras devem estar disponíveis em cada centro. O entrevistador devera receber o questionário já com o número de identificação afixado a folha de rosto preenchido. Os tubos de coleta de sangue devem ser identificados com o mesmo numero. A entrevista deve ser acompanhada de apresentação e introdução incluídas no manual de orientação da entrevista. O Coordenador Local deve certificar que foi feita a entrevista e que o material foi coletado e, em seguida, registrar na Ficha de Controle de Recrutamento. O Coordenador Local deve acompanhar o processamento do material e verificar que as alíquotas sejam adequadamente estocadas. Deve receber as entrevistas preenchidas, verificar se existe erro de preenchimento (i.e., espaços em branco, letras ilegíveis, opções duplicadas, codificações incorretas, etc.) e guardar ate o final do recrutamento. O consentimento assinado deve ser guardado em armário onde somente o Coordenador Local tenha acesso. Ao final do período e após completar a amostra necessária, o material (entrevistas, os consentimentos assinados, ficha de controle de recrutamento, papel filtro) deve ser enviado a Coordenação Geral localizada no GPEAS-UFMG (Grupo de Pesquisas em Epidemiologia a Avaliação em Saúde). A seqüência de pacientes selecionados descrita na planilha deve ser seguida rigorosamente. No caso de recusa de participação, após os devidos esclarecimentos, deve ser registrado na ficha de controle de recrutamento como "Não-participante", anotando-se dados mínimos no questionário (e.g. idade, sexo, escolaridade, renda familiar, diagnostico), se possível. Não haverá substituição desta não-participação, pois o tamanho amostral já antecipou em 40% estas perdas. Deve-se proceder normal mente com a lista ate obter o tamanho definido. O objetivo e obter o número mínimo estipulado. Caso o número mínimo não tenha sido obtido dentro do prazo de um mês, este tempo pode ser prorrogado, após consulta a Coordenação Geral do Projeto. Os exames serão realizados em laboratório de referência da Faculdade de Medicina - UFMG (NUPAD), em Belo Horizonte. Após a realização dos exames, o laboratório de referência encaminhará os resultados em planilhas pré-definidas a Coordenação Geral do Projeto. Cada Centro devera receber os resultados dos exames de seus respectivos participantes, o que devera ser feito através da Coordenação do Projeto. O cronograma de atividades pode ser visto na Parte V. Será realizada análise de confiabilidade das entrevistas e dos exames realizados. Para isso, uma pequena parcela da população participante do estudo (amostra aleatório de 5%) será convidada a repetir a entrevista, no prazo de uma semana apos a 1º entrevista, e coletar nova amostra para os exames. O questionário de avaliação do serviço será aplicado pelo Coordenador Local durante a realização da coleta de dados, prevista para um período de um meso As entrevistas qualitativas serão também realizadas neste período por pessoal especial mente treinado. Estão previstos dois pacientes por centro selecionado para participarem da entrevista qualitativa. ANÁLISE DE DADOS: Uma vez chegando na Central de Dados, os questionários e os resultados de exames serão digitados em banco de dados (Paradox Windows®) e processados para analise. Serão criados filtros de validação visando aprimorar a qualidade dos dados. A confiabilidade dos dados coletados na entrevista será avaliada através do percentual de concordância a do índice de Kappa, comparando-se a entrevista original com uma segunda entrevista em 5% dos pacientes. Os dados serão analisados utilizando-se os softwares SAS® e Egret®. As diferenças de proporção serão avaliadas através do qui-quadrado, as diferenças de médias através do teste t de Student. O nível de significância considerado será de 0,05. A estimativa da forca da associação será feita através do odds ratio (OR) com intervalo de confiança de 95% e o efeito independente das potenciais variáveis explicativas por meio do modele de regressão logística binomial e polinomial.

Concorrência: Estratégico

População Alvo: Portadores de deficiência

Natureza: ESTUDOS E PESQUISAS

Subnatureza: EPIDEMIOLÓGICA

Produção Científica


Projeto: Afroatitude na Prevenção de DST/AIDS na cidade do Rio de Janeiro
Coordenador: MÁRCIO TADEU RIBEIRO FRANCISCO
Resumo: O primórdio da epidemia de HIV/AIDS, no Brasil, foi marcado pela desinformação e, principalmente, pela construção de discursos impregnados pelo viés do preconceito. Passou-se a disseminar, então, inclusive através de campanhas públicas coordenadas pelo Ministério da Saúde, a noção de "grupos de risco". Esta se dirigia especificamente para homens homossexuais e prostitutas, dando alguma ênfase também sobre os hemofílicos e usuários de drogas. A televisão destacava as celebridades atingidas pelo HIV: cabeleireiros de estrelas, artistas e cantores. Todos homens sabidamente (ou não) homossexuais. Como exceção, havia o Betinho, sociólogo respeitado no meio acadêmico nacional e internacional, visto por muitos como mártir da epidemia, infectado através de uma transfusão de sangue. Nessa época, quem falava das mulheres? E, quando as mulheres surgiram no cenário do HIV, quem entre elas era a dona-de-casa, a mulher comum? Quem, entre os rostos presentes na mídia, era uma mulher negra infectada pelo HIV/AIDS? Nestes anos, a epidemia era assunto para outros - os desviantes, os brancos, as prostitutas (cuja face de mulher, a face de mulher negra, não era vista em lugar algum). Erigiu-se um muro de ignorância que, ao invés de proteger, nos tornava mais frágeis. Os resultados estão sendo medidos agora: cada vez mais o HIV espalha-se entre mulheres, passando a ser um assunto (e um risco) para as mulheres negras. Atualmente a AIDS é uma epidemia que se espalha no Brasil e no Mundo. A cada dia, descobrimos que, como todas as epidemias, ela afeta aquelas pessoas ou grupos de maior vulnerabilidade social. E esta vulnerabilidade significa falta de acesso a informação e aos meios de prevenção de infecções, bem como falta de acesso a serviços de saúde para diagnóstico e tratamento. O Brasil tem um dos melhores programas de prevenção e tratamento do HIV/AIDS do mundo. No entanto, este nível de excelência - que, diga-se de passagem, foi em grande parte construído pelas organizações não-governamentais - não tem sido suficiente para impedir a feminilização da epidemia; e mais, a sua chegada as mulheres negras. Será realizado um levantamento bibliográfico sobre o tema, envolvimento do público-alvo na elaboração de indicadores qualitativos e quantitativos, contato com instituições e pessoas que estarão participando do estudo, coleta de dados e análise dos dados.

Objetivo: OBJETIVOS GERAIS: - Fortalecer a resposta setorial de combate a epidemia de HIV/Aids e das prÁticas de implementação de ações afirmativas inclusivas, sustentáveis e permanentes, através da implantação/implementação de ações nos âmbitos do ensino, pesquisa e assistência a adolescentes e jovens negros e social mente precarizados; - Estimular o protagonismo juvenil, planejando, executando e avaliando ações pertinentes a desconstrução do racismo e do preconceito, tanto com relação à raça negra, quanto às pessoas vivendo com HIV/Aids. OBJETIVOS ESPECÍFICOS: - Garantir a participação de estudantes cotistas em projetos de ensino, pesquisa, assistência e extensão voltadas para a prevenção de DST/Aids em populações mais vulneráveis; - Atuar na formação de estudantes cotistas como promotores comunitários de saúde, qualidade de vida e prevenção de DST/Aids; - Propiciar ações que se integrem ao Programa "Saúde e Prevenção nas Escolas" promovido pelo Ministério da Educação. - Desenvolver e implementar ações afirmativas quanto à diversidade cultural, social, de gênero, étnica, de orientação sexual, na perspectiva da educação de pares e de propiciar o protagonismo de jovens cotistas neste processo. - Fortalecer as articulações entre ensino, pesquisa, extensão e assistência desenvolvidas na universidade. - Fortalecer as articulações interinstitucionais e comunitárias estabelecidas pela universidade. - Contribuir de maneira sistemática para a inserção de temas transversais nos currículos das faculdades. - Contribuir para o fortalecimento da auto-estima dos estudantes universitários cotistas e da comunidade em geral.

Metodologia: Atividades: 1.1 - Acesso ao banco de dados de estudantes cotistas da UERJ; 1.2 - Criação do processo de divulgação do programa junto a estes estudantes (encontros, materiais de divulgação, tais como: folhetos e cartazes); 1.3 - Seleção dos estudantes para participar do Programa. 2.1 - Capacitação dos estudantes durante período de 30 horas, com os temas eixos das ações a serem desenvolvidos: sexualidade, gênero, etnia, saúde do adolescente, saúde da população negra, prevenção de DST/Aids, entre outros; 2.2 - Apresentação dos estudantes aos projetos já desenvolvidos pelo NESA nesta área: ELOSS (Espaço Livre de Orientação em Saúde e Sexualidade), PROSS (Programa de Orientação em Sexualidade e Saúde e Distribuição de Preservativos) e o Projeto Juventude Carioca; 2.3 - Divisão do grupo de jovens pelos diferentes projetos de atuação conforme seu interesse; 2.4 - Supervisão semanal junto aos alunos para avaliação e planejamento das atividades. 3.1 - Planejamento com o grupo de jovens de ações de prevenção de DST/Aids, junto a população negra, voltada para atuação nas escolas de áreas adjacentes as comunidades envolvidas; 3.2 - Promoção de feiras de saúde nas escolas das áreas adjacentes aos Programas em desenvolvimento; 3.3 - Construção de material educativo voltado para a prevenção de DST/Aids na população negra. 4.1 - Mapear organizações governamentais e não governamentais, bem como, organizações da sociedade civil que já desenvolvem ações e atividades sobre o tema e/ou produzem materiais educativos; 4.2- Promoção de ações conjuntas com ONG, OG e OSC que trabalhem as questões culturais da população negra; 4.3 - Viabilização de um evento cultural planejado e protagonizado pelos jovens a ser realizado no dia 1º de dezembro. 5.1 - Realização de pesquisa a partir da população atendida nos Programas do NESA com enfoque na prevenção de DST/Aids na população negra (Perfil do Adolescente Atendido pelo Programa); 5.2 - Apresentação dos resultados desta pesquisa, bem como, de todo o trabalho desenvolvido por este grupo de alunos nos vários fóruns já existentes na universidade: UERJ Sem Muros, Mostra de Trabalhos de Extensão, Mostra de Iniciação Científica, Semana do Hospital Universitário Pedro Ernesto, entre outros. 6.1 - Integração deste Programa com todos aqueles já desenvolvidos pelo NESA e que tem caráter intersetorial e multidisciplinar. 7.1 - Divulgação em todos os fóruns universitários do desenvolvimento das ações e resultados do Programa a fim de fomentar a inclusão de temas transversais nos currículos universitários.

Concorrência: BRASIL AfroAtitude

População Alvo: População Negra

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: CAPACITAÇÃO E FORMAÇÃO EM PESQUISA

Produção Científica


Projeto: UEL AFROATITUDE.
Coordenador: Carla Maria Canalle Pagnossim
Resumo: O Projeto UEL AFROATITUDE tem sustentabilidade por ter sido planejado e elaborado com base na política atual de cotas da Universidade Estadual de Londrina com duração mínima prevista de 7anos. Além disto, a Universidade já desenvolve projetos e serviços referentes a questão em consonância com as diretrizes municipais e estaduais. Iniciou na presente gestão a construção de pianos de ações para trabalhar questões relacionadas a prevenção de DST/Aids e dos riscos do uso de drogas com a população interna (técnicos-administrativos, docentes e discentes) da UEL, sendo que estes começaram a ser realizados de forma mais sistemática no inicio de 2004. A implantação do sistema de cotas para negros tem como principal objetivo contribuir para diminuir as desigualdades de acesso destes na Universidade Estadual de Londrina. As atividades relacionadas as pesquisas sobre a população negra deverão contribuir para o conhecimento objetivo da sua condição social e econômica levando a superação das desigualdades a que esta submetida. O combate da discriminação e do racismo deve se tomar um compromisso de toda sociedade. O projeto UEL AFROATITUDE proporcionarão desenvolvimento de pesquisas sobre as relações raciais e o processo de vulnerabilidade a que esta submetida a população negra. Uma sociedade mais equânime beneficia a todos. Outro ponto que fortalece a sustentabilidade do presente projeto e o fato de que tanto as instituições externas quanta os Cursos, Projetos, Programas e Setores da UEL que foram inseridos no projeto UEL AFROATITUDE tem o compromisso com a formação acadêmica e de cidadãos plenos. Por último destaca-se que os projetos internos e externos em sua maioria já iniciaram ações em conjunto com os serviços referenciais de saúde, sendo isto um fator facilitador no sentido do envolvimento e da organização de atividades coletivas durante todo o processo. A cidade de Londrina é localizada numa das regiões de maior dinamismo econômico do Estado do Paraná, caracterizando-se como centro sub-metropolitano, inclusive com ação extra-regional em seus serviços de educação e saúde. Sendo a 2ª Cidade do Paraná e a 3ª Cidade do Sul do Brasil conta com uma população de 446.849 habitantes, sendo pelo de uma região que tem influência direta sobre 66 municípios e indireta sobre 160, totalizando 235 municípios e cerca de 4.500.000 de habitantes, localizados nos Estados do Paraná, Mato Grosso do Sul e São Paulo. O envolvimento com atividades do SUS será estabelecido através das atividades realizadas pelo Hospital Universitário (HU) e Ambulatório do Hospital de Clínicas (AHC) da Universidade Estadual de Londrina UEL e pela Secretaria Municipal de Saúde de Londrina. O envolvimento do Hospital Universitário esta ligado as atividades realizadas pela Unidade de Moléstias Infecciosas do HU e Ambulatório Interdisciplinar de Atendimento a Portadores de HIV e Doentes de Aids do HC da Universidade Estadual de Londrina - UEL, sob a coordenação da Medica Docente Susana Lilian Wiechmann. A Secretaria Municipal de Saúde e a Secretaria de Estado da Saúde participarão do Projeto através do Centro Integrado de Doenças Infecciosas (CIDI). As Coordenações Estaduais e Municipais de DST/Aids serão comunicadas sobre o desenvolvimento do projeto e convidadas a acompanharem e apoiarem o Projeto UEL AFROATITUDE. O Programa Brasil Afroatitude e o Projeto UEL Afroatitude proporcionaram aos estudantes cotistas negros o envolvimento com a pesquisa de iniciação científica sobre questões referentes à população negra e das relac6es raciais. Os estudantes participarão também de pesquisas e ações relacionadas às vulnerabilidades e epidemia das DSTs/AIDS. Londrina possui 460.910 habitantes (IBGE2002) e o município sede (pelo estadual e pelo microrregional) da microrregião de Saúde do Plano Diretor de Regionalização do SUS no Estado do Paraná. A microrregião 17 e composta por 20 municípios 7 módulos assistenciais, abrangendo uma população de 766.129 habitantes. A população negra em Londrina e de 23% (IBGE). Não existe um estudo sistemático sobre a população negra em Londrina, não há dados analisados sobre sua situação econômica, educacional, social, cultural etc. O projeto UEL Afroatitude contribuirá para a realização de pesquisas que farão um diagnóstico da situação da população negra proporcionando condições para uma intervenção direcionada na perspectiva de diminuir as desigualdades existentes. Segundo o Ministério da Saúde (1985-2003) foram notificados em Londrina 1356 casas (13 anos ou mais), destes 918 vivos. Existem em acompanhamento no HU 56 casos (menores que 13 anos) e 44 exposed. No ano de 2004 (janeiro a novembro) foram notificados 71 novos casos. Londrina ocupa o 39° lugar em incidência de Aids (por 100.000 habitantes) e 70° posição em relação ao coeficiente/incidência. Os principais serviços de assistência e tratamento as pessoas com HIV e Aids são o Hospital Universitário (HU), Ambulatório do Hospital de Clínicas (AHC), Centro Integrado de Doenças Infecciosas (CIDI), Assistência Domiciliar Terapêutica (ADT), Centro de Aconselhamento, Orientação Sorológica (COAS),e as ONGs Casa de Apoio (Recanto Amigo de Jaguapita) e Associação Londrinense Interdisciplinar de AIDS (Alia). Não existe demanda reprimida. O Hospital Universitário e pioneiro no atendimento interdisciplinar desde 1987 a portadores e doente de Aids (ambulatorial, internação e HU). É o local de referência para Londrina e Região para internação e HU tanto para adultos como para crianças com Aids. Existem dois SAE, o do AHC - Ambulatório do Hospital de Clínicas vinculado ao HU e o CIDI - Centro Integrado de Doenças Infecciosas, vinculado a Secretaria Municipal de Saúde. No atendimento ambulatorial (SAE), além do atendimento aos adultos, o HU conta, desde 1996, com atendimentos especializados para crianças e adolescentes soropositivos e expostos ao HIV, constituindo-se no clínico serviço especializado da região Norte do Paraná e, para a operacionalização deste trabalho conta com uma equipe interdisciplinar compostas pelas áreas de enfermagem, farmácia, medicina, nutrição, psicologia e serviço social. O Serviço de Bem-Estar a Comunidade - SEBEC, que é um órgão de Apoio, ligado diretamente a Reitoria da UEL e que tem como finalidade implantar políticas institucionais que promovam o bem-estar da Comunidade Universitária, conta com dois serviços interligados: O de Saúde Mental e o de Prevenção e Educação em Saúde. O SEBEC iniciou ações na área de prevenção de DSTs em parceria com diversas organizações da comunidade de Londrina. As ações foram planejadas com o objetivo de sensibilizar estudantes, técnicos-administrativos e docentes quanta a sua vulnerabilidade em relação às infecções de DSTs, alem de ampliar a formação dos estudantes sobre o assunto, uma vez que os mesmos poderão vir a ser multiplicadores quando forem trabalhar na Comunidade Externa. O impacto previsto refere-se à melhoria da qualidade de vida e de acesso a cidadania das pessoas envolvidas no projeto; incremento nas pesquisas na área dentro do Município de Londrina e na UEL; contribuição para a compreensão da vulnerabilidade e da infecção do HIV; sensibilização e formação de multiplicadores na área de prevenção de DST/HIV/Aids; fortalecimento do trabalho em rede; Produção de conhecimento sobre a população negra em Londrina e desenvolvimento de ações relacionadas ao combate ao racismo e todas as formas de discriminação.

Objetivo: Ampliar o acesso da população de Londrina as abordagens preventivas em relação as DST/Aids; formar multiplicadores; estimular a discussão sobre a correlação infecção de DST/Aids e raça; contribuir para a formação acadêmica de estudante bolsista; apoiar o estudante que entrou pelo sistema de cotas para negros.

Metodologia: O projeto utilizará várias técnicas conforme a necessidade dos atores envolvidos, priorizando a participação, a articulação, a integração, a coletividade e a multidisciplinaridade. Abaixo destacam-se alguns métodos e técnicas: Capacitação inicial dos estudantes bolsistas durante o mês de abril de 2005, como forma de aproximação e incentivo ao envolvimento dos estudantes nas questões sociais e de saúde relacionadas ao Projeto. Além de uma preparação inicial para as atividades de extenso e iniciação cientifica com as quais trabalharão: Organização de um sistema de trabalho em conjunto com os parceiros internos e externos, fortalecendo o trabalho em rede; Reuniões periódicas com trocas de experiências entre os trabalhos desenvolvidos, discussões de estratégias para ultrapassar as dificuldades da equipe e melhorar a atuação e envolvimento no Projeto UEL AFROATITUDE; Capacitação com oficinas, seminários, palestras, entre outros que trabalhem a sensibilização, a estimulação e as representações que a equipe tem a respeito do tema DST/HIV e suas interfaces, dentre as quais a correlações DST/HIV x raça/cor; A capacitação estará integrada ao monitoramento das atividades desenvolvidas pelos bolsistas através de questionários respondidos por estes e por coordenadores de subprojetos, observação participante, entrevistas, verificação em loco, etc.; Coleta e análise de informações tendo em vista a formação de banco de dados relativo a temática.

Concorrência: BRASIL AfroAtitude

População Alvo: População Negra

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: CAPACITAÇÃO E FORMAÇÃO EM PESQUISA

Produção Científica


Projeto: Brasil Afroatitude: A UEMS Dando Visibilidade a População Negra Sulmatogrossense.
Coordenador: MARIA DE LOURDES SILVA
Resumo: O projeto será desenvolvido no Estado de Mato Grosso do Sul, envolvendo as seguintes unidades universitárias nos municípios de: Amambaí, Aquidauana, Campo Grande, Cassilândia, Coxim, Dourados, Gloria de Dourados, Ivinhema, Jardim, Maracaju, Mundo Novo, Navirai, Nova Andradina, Paranaíba e Ponta Porá. Será estabelecido convênio com a Fundação Nacional da Saúde - FUNASA Secretaria de Estado de Saúde (SES), Superintendência de Políticas de Saúde, Superintendência de Epidemiologia e Vigilância em Saúde e Secretaria Municipal de Saúde e com Coordenação Estadual/Municipal de DST/Aids (nas cidades onde esta coordenadoria existe), visando a implementação das ações propostas na justificativa do presente projeto. Salientamos que a UEMS já possui diversos convênios com estas instituições e as mesmas são parceiras dos diversos eventos que a instituição realiza. Prefeituras municipais, através de suas secretarias (saúde, cultura, finanças, assistência social, educação, esporte e lazer, meio ambiente, justiça e segurança pública e defensoria pública) Secretaria de Estado de Cultura, Esporte e Lazer - SCEUMS Secretaria de Estado de Trabalho, Assistência Social e Economia Solidaria - SET ASS Secretaria de Estado de Educação - SED Secretaria de Estado de Justiça e Segurança Pública - SEJUSP Conselho de Gestão Estadual das Políticas Sociais - COGEPS, criado pelo decreto 9825, de 25 de fevereiro de 2000, vinculado ao gabinete do governador do estado do MS Coordenadoria de Políticas Públicas de Igualdade Racial do MS - CPPIR Coordenadoria de Intermediação de Conflitos Sociais e Situações de Risco - decreto Número 11283, de 1º de julho de 2003 Superintendência das Políticas Intersetoriais e da Assistência Social MS Superintendência de Programas de lnclusão Social do MS Superintendência das Políticas de Defesa da Cidadania do MS Coordenadoria Especial de Políticas Públicas para a Mulher do MS - COMULHER Procuradoria Geral de Defensoria Pública - PGDP Subsecretaria de Apoio a Integração das Políticas de Prestação de Serviços ao Cidadão Superintendência de Medidas de Defesa da Cidadania e de Programas de Inclusão Social Universidades conveniadas ao Projeto Afroatitude Conselho Estadual do Direito dos Negros - CEDINE Fórum de Entidades do Movimento Negro Diante da preocupação do governo federal em criar políticas públicas que busquem minimizar as desigualdades e enfatizar vários aspectos favoráveis a melhoria da qualidade de vida dos brasileiros, objetivando a promoção da igualdade, do bem estar e do desenvolvimento nacional 0 seguinte projeto institucional, tenta contribuir com esse processo através do resgate da história sócio cultural e antropológico da comunidade negra de Mato Grosso do Sul. A história do Brasil contempla em vários momentos a luta dos afrodescendentes por seus direitos sociais. O Quilombo dos Palmares, a Revolta da Chibata entre outros movimentos são exemplos desse processo. Porém, pouco se sabe sobre a participação efetiva da comunidade negra na estruturação histórica do estado de Mato Grosso do Sul suscitando a questão do por que esse fenômeno acontece. Partindo desse pressuposto, se abre uma serie de questões pertinentes a estudo. Quem são os atores que participam do palco social da comunidade negra de Mato Grosso do Sul Quais as atividades que desenvolvem? Qual sua origem? Qual seu nível de escolaridade e seu perfil socioeconômico? Dentro desse quesito: qual o acesso que possuem aos meios de comunicação de massa, quais as oportunidades de trabalho que Ihe são oferecidas, e que tipo de atendimento médico e assistencial Ihes é disponibilizado? Esses grupos se organizam em instituições comunitárias? Se o fazem, de que maneira 0 fazem? Se não se organizam por que razão esse fenômeno ocorre? Qual a incidência epidemiológica de DST/AIDS dentro desse grupo étnico? Dentro desse aspecto: qual a faixa etária mais atingida? Qual 0 grupo de gênero mais suscetível? O que ocorre em relação ao uso de drogas dentro dessa comunidade? Os movimentos sociais que organizam o negro sul mato-grossense são realmente capazes de garantir ações afirmativas que melhorem a qualidade de vida do cidadão afrodescendente? Eles executam de fato o processo de resgate da cidadania como previsto pelas praticas implementadas pelo governo federal através das Diretrizes Curriculares Nacionais para a Educação das Relações Etnico-raciais e para o Ensino de História e Cultura Afro-brasifeira e Africana, de acordo com as normas estabelecidas pelo parecer CNE/CP 003/2004 e pela resolução CNE número 1 de 17 de junho de 2004? Partindo dessas duvidas que foram levantadas percebe-se o quanta esse trabalho e de suma importância não só para 0 levantamento dos dados que corroborem com 0 esclarecimento das questões sócio-históricas e de saúde pública que se referem a comunidade negra como também para esclarecer a respeito de equívocos em relação a identidade sul mato-grossense, combatendo assim a privação e a violação dos direitos aos qual a comunidade negra muitas vezes e submetida. A realidade da Universidade Estadual de Mato Grosso do Sul apresenta em seu universo a presença a de cotistas negros oriundos desse conjunto sócio-cultural que ainda não foi pesquisado, daí o fato de não existir um diagnóstico prévia a ser apresentado sobre as questões referidas na presente justificativa. Partindo do pressuposto de que a política nacional implementada pelo governo federal visa resgatar a cidadania da população negra, ninguém melhor do que os acadêmicos que fazem parte desse grupo étnico para se posicionar, pesquisar e propor alternativas que visem de fato a implementação de uma política que colabore com as prerrogativas da legislação nacional. Outro critério que deve ser ressaltado diz respeito a seguinte questão: no universo da academia alguns alunos, independente da condição da sua entrada no processo seletivo, demonstram dificuldades de ensino-aprendizagem durante 0 transcorrer de seu curso de graduação. Tais dificuldades extrapolam 0 âmbito universitário, sem que com isso se queira dizer que não e responsabilidade da Universidade sanar essas deficiências, tentando um trabalho em conjunto com a escola básica. Destarte, justifica-se a necessidade de monitorias que auxiliem tanto alunos cotistas quanto não cotistas a solucionar suas dificuldades. E, tendo em vista que existem alunos cotistas que ate então possuem um rendimento escolar que os qualifica ao cargo de monitoria, propõe que os mesmos assumam tal condição. A partir daqui reunir-se-ao as condições necessárias para que professores e alunos assumam de forma co-participativa as responsabilidades etnico-raciais positivas, enfrentando e superando discordâncias, conflitos, contestações e valorizando os contrastes das diferenças. Através desse processo dar-se-a mais valor ao patrimônio cultural afro-brasileiro, visando sua preservação e a sua difusão. Através de pesquisa de campo visando levantamento de dados referentes aos objetivos deste projeto, implementar-se-ao ações garantindo a identificação e analise do perfil sociocultural, histórico e antropológico das comunidades a serem atendidas pelo projeto, contemplando quest6es étnicas, físicas, educacionais, socio-demograficas e de saúde publica. Há que se salientar que estes dados serão de cunho qualitativo e quantitativo, e que a partir dos mesmos serão elaboradas ações na forma de palestras, oficinas, seminários, campanhas de mobilização, fóruns, publicações e outras para a disseminação dos dados obtidos através da pesquisa inicial. No inicio do ano letivo (fevereiro e março) serão publicados editais específicos das Pro - Reitorias de pesquisa e Extensão para atender este projeto, com critérios de seleção dos cotistas já embutidos no mesmo, como por exemplo: não possuir vinculo empregatício, dedicar-se as atividades de pesquisa ou extensão no mínimo 20 horas semanais, não estar recebendo nenhum tipo de remuneração em programas institucionais, carência, preferencialmente não ter concluído nenhum outro curso de graduação, relevância do projeto e no caso de alunos a partir do segundo ano adicionar desempenho acadêmico, freqüência. Para a seleção serão observados critérios gerais da pesquisa e da extensão tais como: titulação acadêmica do orientador, produção científica e tecnológica do orientador, disponibilidade do orientador de no mínimo 03 horas semanais por orientando e viabilidade técnica e econômica do projeto, além dos critérios específicos do Programa AFROATITUDE. Todos os projetos além do acompanhamento técnico das Pro - Reitorias serão acompanhadas e avaliadas pelo NEER- Núcleo de Estudos Étnicos Raciais que terá na sua chefia a coordenação geral do projeto.

Objetivo: Formar estudantes negros pesquisadores, multiplicadores e formadores de opinião para atuação em meio as suas comunidades, articulando os movimentos sociais, trabalhando em prol da formação da cidadania e do crescimento social, cultural e educacional do grupo, bem como realizando ações que possibilitem a prevenção e o tratamento da DST/AIDS. Ampliar o acesso a informação sobre a diversidade da população sul mato-grossense, dando visibilidade a população negra e aos conflitos provocados por relações etnico-raciais.

Metodologia: Seminário Institucional Brasil Afroatitude: resgatando a identidade étnica do negro sul mato-grossense a ser realizado em outubro de 2005; Participantes: professores, técnicos e alunos da comunidade universitária e demais órgãos governamentais e não govemamentais envolvidos na realização do projeto. Esse seminário será desenvolvido de forma concomitante em todas as unidades universitárias da UEMS. Objetivo: divulgar os dados obtidos através dos projetos de iniciação científica, intervenção comunitária relacionadas aos grandes eixos temáticos do projeto; Analisar o desempenho acadêmico dos alunos envolvidos no processo de monitoria. Disponibilizar os dados alcançados na pesquisa para a construção do plano estadual e nacional de políticas de promoção da igualdade racial através da participação dos pesquisadores envolvidos no projeto nas conferências municipais e estaduais de políticas de promoção da igualdade racial; Publicação de material didático-pedagógico, livros, revistas e afins referentes aos dados obtidos durante a pesquisa, subsidiando a implementação da lei numero 10.639 de 9 de janeiro de 2003 que tomam obrigatório nos estabelecimentos de ensino fundamental e médio, oficial e particular o ensino sobre a história e cultura afro-brasileira, incluindo assuntos relacionados a luta dos negros no estado de Mato Grosso do Sul, resgatando a contribuição dessa etnia nas áreas social, econômica, cultural e política pertinente a história regional e nacional; Encaminhar propostas de artigos e resenhas referentes ao tema desta pesquisa a serem divulgados inicialmente pela editora UEMS e outras editoras que disponibilizem espaço para a divulgação deste trabalho; Dependendo da necessidade detectada no decorrer da pesquisa, propõe-se a criação de um espaço específico de atendimento no núcleo jurídico do curso de Direito da UEMS, objetivando assessorar juridicamente os membros da comunidade negra das unidades universitárias de Dourados, Naviraf e Paranaíba, vítimas de todo tipo de violação dos direitos humanos; Elaboração por parte dos alunos do curso de Enfermagem da unidade universitária de Dourados envolvidos no projeto de material informativo sobre DST/AIDS e demais epidemias detectadas no projeto, alem de campanhas preventivas contra o uso de drogas; Criação de uma página on-line dentro do web site da UEMS, visando manter atualizada toda a comunidade acadêmica no que se refere ao andamento do projeto Brasil Afroatitude; Proposta de apresentações culturais valorizando as diferentes etnias que compõem a identidade afra brasileira; Implementação e fortalecimento do Núcleo de Estudos Étnicos Raciais da UEMS - NEER.

Concorrência: BRASIL AfroAtitude

População Alvo: População Negra

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: CAPACITAÇÃO E FORMAÇÃO EM PESQUISA

Produção Científica


Projeto: Apoio Insitutcional para o Deenvolvimento de Educação Popular em Saúde com ênfase na Prevenção de DST/AIDS em áreas de Reforma Agrária do Brasil
Coordenador: GISLEI SIQUEIRA KNIERIM
Resumo: As questões de saúde são problemas constantes na vida cotidiana e no cenário político do pafs. Perpassam o discurso diário de milhões de pessoas e ocupam lugar destacado na pauta dos partidos políticos, das discussões acadêmicas e dos movimentos sociais. Pouco consenso existe acerca do tema, como o conceito do que se entende por saúde, indo-se desde uma posição clássica de saúde como tratamento de doença para uma nova visão emergente de saúde como qualidade de vida, sustentabilidade e emancipação da mesma. No que diz respeito à saúde pública no Brasil e inegável o avanço obtido com a implementação do SUS nos últimos 16 anos, que alcanção de alguma forma 90% da população brasileira, sendo 28,6% esta usuária exclusiva do SUS. Atualmente (dados de 2003 do Ministério da Saúde), conta-se com cerca de 65 mil unidades ambulatoriais, que realizam mais de 150 milhões de procedimentos/ano; 5.794 unidades hospitalares com 441.045 leitos, realizando mais de 11 milhões de internacões/ano. A assistência aos portadores/as de HIV, renais crônicos e pacientes com câncer e totalmente gratuita e vista, em alguns casos, como exemplar para outros países. Porém, outros fatores contam negativamente numa avaliação da saúde no Brasil, a começar pelo desacreditamento cultural que esta recebe por grande parte da população. De certa forma, faz parte do imaginário e humor nacional a concepção de urn sistema público de saúde falido e que gera filas intermináveis. A gestão dos recursos (que tambem são escassos) há muito vem sido apontada como problemática, primeiro por sua falta de racionalidade e por configurar num sistema de 'quebra galho', que resolve pontualmente os problemas de saude (doenças), o que gera urn gasto excessivo e repetido; segundo, pela confusão e desarticulação entre União-Estados-Municípios. Algumas alternativas a esses problemas são esboçadas, como o investimento na medicina preventiva e educação em saúde, além da integração dos sistemas municipais de saúde e uma clara definição legislativa das (mútuas) responsabilidades da União, dos Estados e municípios. Na área rural, a situação se apresenta de maneira cruel e negligenciada, a comerçar pela quase inexistência de dados específicos da saúde no campo, já que nas pesquisas comuns de amostragem, a população rural costuma ser suplantada e desaparecer nos dados e interpretação destes. As avaliações e políticas públicas de saúde ainda são pensadas exclusivamente numa ótica urbana, o que gera grande descompasso entre planejamento e formulação teórica com a prática e a gestão. Sabe-se que hoje existem em torno de 6 mil assentamentos (com destaque na região nordeste), que suportam cerca de 760 mil famílias. A desnutrição atinge 41,6% das crianr;as com menos de 5 anos no meio rural (sendo 25,7% no meio urbano); dados como o índice de massa corpórea, a estatura média, anos médios de estudo e acompanhamento pré-natal (este em especial desigual, enquanto as mulheres do meio urbano que não realizam pré-natal totalizam 7,6%, no meio rural esse índice chega a 30,3%) ressaltam ainda mais a desigualdade entre meios urbanos e rurais. Diante desse quadro geral, e sabendo-se da grande falta de informarçõess mais precisas sobre a saúde no campo, evidencia-se a urgência de políticas públicas e financiamento para iniciativas que atendam de maneira específica (mantendo intenigação com a discussão no meio urbano e político nacional) a população rural. Essas iniciativas não podem ser em mão única, como se nada existisse no campo e precisasse começar-se do zero. Uma atenção especial incluía o resgate dos conhecimentos próprios desse lugar social, conhecimentos que atravessam gerações e justamente por serem locais e desenvolvidos em situações de resistência, muito tem a contribuir com a consciência de saúde como um todo.

Objetivo: OBJETIVO GERAL: Continuar colaborando, através de acompanhamento "in loco" e processos e eventos de capacitação, para que as secretarias estaduais e os coletivos estaduais/locais de sa´due do MST tenham conseguido executar todas as suas atividades de maneira satisfatória e em consonância com as políticas públicas de saúde do MS e do MST.

Metodologia: Para cumprir com o objeto do projeto de desenvolvimento institucional serão realizadas viagens de acompanhamento 'in loco' em cada estado para verificação do trabalho desenvolvido bem como para o levantamento de indicadores de desenvolvimento, de processo e de eficácia para fins de avaliação final. Tambem, como estratégia já consolidada, serão realizados encontros de capacitação em saúde com ênfase em DST AIDS a fim de avaliar o andamento dos projetos apoiados há vários anos pela C. DST AIDS dos estados. Também, de forma participativa, faremos um processo de monitoramento com a colaboração dos técnicos da Coordenação Nacional de DST AIDS e Coordenação Nacional do Setor de Saúde do MST. Durante os encontros de capacitação do coletivo nacional de saúde uma ênfase será dada para a questão das metodologias em educação em saúde. Como estratégia vamos iniciar um processo de discussão nacional para desembocar nos encontros regionais durante o mês de junho, onde faremos várias experiências para sistematizar os métodos e técnicas que utilizamos no campo para a discussão da saúde, corpo, sexualidade, prevenção, aids, terapias, acompanhamento e como tudo isto está de alguma forma articulado com o SUS dentro da Atenção Básica a fim de aumentar o acesso dos camponeses/as aos insumos de prevenção e ao diagnóstico, acompanhamento e terapias. Queremos continuar com mais intensidade a discussão com os coletivos locais da questão do acesso ao preservativo e a discussão da prevenção. As barreiras culturais e os mitos são grandes neste assunto e queremos discutir e trocar experiencias sobre o assunto e o fato para consolidar técnicas de abordagem e de influência comportamental, em parceria e estreita colaboração entre as secretarias e coletivos do MST e as Coordenações Estaduais. Para desenvolver essa ênfase na metodologia e técnicas pensamos em contar, continuar contando, com a presença e participação da Secretaria de Educação Popular do MS e da Coordenação Nacional do DST AIDS. Também esperamos contar com o resultado de um trabalho realizado por Patrícia Aucélio sobre o assunto nas nossas áreas por dois anos. Nossa participação na ANEPS tem sido de muita ajuda para a organização e para os trabalhos desenvolvidos. Já fizemos algumas publicações e pretendemos continuar o trabalho de oficinas mais regionais e locais e fazer algum curso de aprofundamento para o coletivo mais antigo.

Concorrência: Estratégico

População Alvo: População em assentamentos e acampamentos rurais

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: CAPACITAÇÃO E FORMAÇÃO EM PESQUISA

Produção Científica


Projeto: Ações firmadas, Direitos Humanos em DST/AIDS, para Negros, na Região Metropolitana de Belo Horizonte.
Coordenador: ANA VITORIA DIAS LOPES
Resumo: Chegado ao século XXI, mais de cem anos ap6s a abolição legal da escravatura, as ações afirmativas da população negra permanecem praticamente inalteradas e, em alguns aspectos, ate retrocedida, em relação aos séculos XIX e XX, como na questão da DST/AIDS. Dado o processo abolicionista, que não adotou medidas posteriores que assegurassem aos escravos e seus descendentes o direito pleno a cidadania, aqui entendida como aquele que participa dos negócios da cidade; saíram da situação de sujeitos para a de cidadão, que introduziu a democracia, com os componentes de seu estatuto, que limita o posicionamento do poder: diálogo, participação, proteção contra o arbítrio. O cidadão participa do poder. As sociedades humanas são feitas para os indivíduos, para permitir a sua felicidade. Cada homem tem uma identidade, irredutível aquela que pertence aos outros, sendo que o direito deve reconhecê-la e protegê-la. A primazia do individuo completa-se pela idéia de que todos os membros da sociedade são iguais por essência. Essa igualdade, devido à natureza humana comum, e uma igualdade de direitos, que deixa de lado a igualdade de fato. A igualdade dos indivíduos e apenas teórica, de direitos. A concorrência favorece os fortes, criando desigualdades. Aparece uma sociedade desequilibrada. Surgem as ações afirmativas, por um intervencionismo multidisciplinar, destinado a respeitar a democracia, reduzir as desigualdades de fato e proteger os fracos contra os fortes. O Estado e a instituição criada para proteger os direitos inatos, no que se refere ao conceito de liberdade individual e ilimitada. O Estado de Direito tem a necessidade de reconhecer ao cidadão os direitos de liberdade ou os direitos fundamentais, que constituem salvaguarda contra os abusos. Os cidadãos devem reivindicar os direitos a sua liberdade de escolha a que se procede em uma sociedade pluralista, associativa. Chegado o Terceiro Milênio, a fraca auto-estima dos afro-descendentes, que constitui cerca da metade da população brasileira, e uma triste realidade. Essa circunstancia e agravada pela completa alienação dessa massa em relação à verdade histórica, a de ancestrais africanos e a de seus irmãos nas Américas e no mundo. Com a Constituição de 1988, o Estado Brasileiro se viu na obrigação de adotar políticas públicas de reconhecimento de direitos dos negros e descendentes, implementadas por lei específicas (Decreto 4228 e 13/05/2002) para dar respostas à epidemia do HIV/AIDS, a partir da operacionalização de ações afirmativas e AIDS, num trabalho inter, multi e transdiciplinar. A Universidade do Estado de Minas Gerais implantou 0 sistema de cotas em seu vestibular para o ano letivo de 2005, com 20% das 790 vagas destinadas aos alunos negros, beneficiários da ação afirmativa de correção e injustiças e garantia de direitos a esse segmento da sociedade. Assistências e direitos humanos: somente a política de cotas não resolve a inclusão social. A permanência, a terminalidade, esta associada ao nível sócio-econômico do estudante. Relevante se faz envolve-los em atividades de extensão, monitoria e iniciação científica voltadas para o social, como o programa DST/AIDS do Ministério da Saúde. Tendências apontam para a negritude, a feminização da epidemia, a pobreza, etc. A população negra necessita buscar alternativas para a assistência e prevenção a AIDS. A UEMG tem o fito de fortalecer a resposta de ações afirmativas para negros e, após adotar o sistema de cotas em seu acesso coletivo - o vestibular - adere agora ao AFROATITUDE programa de ações afirmativas para universitários negros, que deverá dar ênfase a construção de respostas a epidemia HIV/AIDS, a partir da operacionalização dos três eixos: intervenção comunitária e posteriormente monitoria e iniciação científica, atividades direcionadas para as estratégias do programa. A Pró-Reitoria de Extensão - PROPEX, por meio do Núcleo de Estudos Afro-Brasileiros - NEAB, em parceria com a Faculdade de Educação - FAE - Campus de Belo Horizonte, organizou a equipe de coordenação: Profª Claudia Ornelina da Costa Santos, coordenadora do NEAB; Profª Maria das Graças Pereira Costa, da Faculdade de Educação; Clever Alves Machado e Adriana Pereira Rodrigues, do Conselho de Integração e Participação da Comunidade Negra de BH/SEDESE; discentes da Faculdade de Educação, Escola de Musica, Escola Guignard e Escola de Design/UEMG/Campus BH; apoio, para dinamizarem e organizar as ações de: seleção dos alunos cotistas. Após os primeiros resultados, por meio de relatórios parciais, demanda e envolvimento dos alunos cotistas, verificar-se a probabilidade de dar continuidade ao projeto, chegando ao prazo máximo estabelecido de 48 meses.

Objetivo: O Plano de Trabalho pretende estimular o protagonismo da população negra, no sentido de pensar e executar ações pertinentes a desconstrução do racismo e do preconceito, quanta as pessoas vivendo com AIDS; de modo interdisciplinar - uma estratégia que envolve diferentes atores sociais.

Metodologia: Por tratar-se do primeiro vestibular com cotas para negros na Universidade do Estado de Minas Gerais - UEMG com processo seletivo para o mês de janeiro/2005, o primeiro procedimento será verificar a quantidade de alunos que ingressaram pelo sistema de cotas nas quatro unidades do Campus de Belo Horizonte, ou seja, a Faculdade de Educação, Escola de Música, Escola Guignard e Escola de Design. Em um segundo momento, far-se-á a divulgação do AFROATITUDE e a seleção dos alunos que manifestarem interesse em participar do projeto. Os alunos negros, cotistas, serão selecionados com base no mérito e entrevista junto a coordenação de acordo com sua proposta. Iniciar-se-á o projeto pelas atividades de intervenção e monitoria para, num momento subseqüente, chegar-se a iniciação científica, quando haverá a produção de conhecimentos e pesquisa específicos sobre o tema: Ações Afirmativas e DST/AIDS, em negros na região metropolitana. Os estudantes negros, sob o regime de cotas, selecionado, atuarão junto a comunidades pobres, sob o enfoque conceitual de ações afirmativas, interdisciplinares. Serão orientados para elaboração de instrumentos e coleta de informações estatísticas, com tratamento crítico de dados (tabulação, gráficos e relatórios), métodos qualitativos e quantitativos, importantes para o monitoramento da equidade em saúde e outras variáveis. Aos sujeitos participantes serão recrutados na UEMG, e nas instituições parceiras. Como pesquisando, serão os negros localizados nos locais parceiros, na proporção em que fizerem presentes.

Concorrência: BRASIL AfroAtitude

População Alvo: População Negra

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: CAPACITAÇÃO E FORMAÇÃO EM PESQUISA

Produção Científica


Projeto: Programa Brasil Afroatitude
Coordenador: RITA DE CASSIA GUIMARAES ESMANHOTO DE
Resumo: Com a implantação na UFPR da política de cotas (Resolução n.º37/04-COUN/UFPR) e o programa de bolsas, estarão envolvidos no projeto alunos do primeiro ano. A proposta de política de cotas insere-se num programa que interfira positivamente na erradicação da pobreza e redução das desigualdades com vistas a construir uma sociedade justa e solidária, de democratização do acesso e estabelecimento de condições que garantam a permanência dos alunos na universidade. Os resultados apresentados no vestibular UFPR/2005 apontaram para a situação abaixo descrita. Dos 4.167 aprovados, 573 são cotistas afrodescendentes e 930 da escola publica. Como era esperado a maioria dos cotistas são de classes pobres. Outros dados apresentados no resultado do vestibular dizem respeito aos candidatos que só conseguiram acessar a universidade após várias tentativas, porque foi implantado 0 sistema de cotas e ainda, pessoas que retornaram ao concurso vestibular pois a UFPR permitiu-lhes novamente sonhar com o ingresso numa universidade publica. Há outros indicadores de pobreza: embora a maioria dos aprovados resida em Curitiba, somente 6.38% dos não cotistas residem na Região Metropolitana, subindo para 16,58% entre os afro-descendentes e atingindo 21,18% entre os de escola publica. Neste sentido, optou-se por associar o AFROATITUDE a duas ações prioritárias da UFPR: Rede Integrada de Escolas Públicas e Vale do Ribeira. A justificativa para a escolha da região de atuação pauta-se nos dados da realidade atual, especialmente aqueles que afetam diretamente os jovens oriundos das regiões onde estão situadas a maioria das escolas publicas que fazem parte da RIEP, realidade esta marcada por situações de violência, desagregação social, de droga, DST e outros. Ainda, a densidade populacional media da região do Vale do Ribeira e relativamente baixa com 139,89 hab./Km2. Os municípios da região tem suas economias atreladas a agricultura familiar, a extração mineral e vegetal e animal, formando assim aglomerações rurais com grande potencial a se desenvolver. Esse desenvolvimento esta vinculado a distância das cidades que fazem parte do Vale do Ribeira a Capital do Estado (Curitiba), e a conclusão da pavimentação da BR 476 e manutenção das estradas vicinais que irão facilitar o escoamento da produção da região. Na região, a renda familiar baixa e a falta de perspectivas e de oportunidades de negócios, vem favorecendo o aparecimento de bolsões de pobreza, tanto na área rural quanta na urbana, o que resulta em situação de risco.

Objetivo: Fortalecimento do combate a epidemia de AIDS, violência e discriminação, em geral, existentes na população atendida, bem como oportunizar aos estudantes cotistas negros permanência no ensino superior através de benefício financeiro e ao mesmo tempo contribuir com sua formação acadêmica através da pesquisa-acão.

Metodologia: Articulação com os estudantes e pesquisadores (docentes e técnicos) da UFPR; Participação na criação de Rede de Universidades com Programas de Ação Afirmativa; Promoção, sensibilização e capacitação de jovens universitários e população em geral para a problemática de da epidemia do HIV/AIDS e sua relação com 0 desenvolvimento, promoção dos direitos humanos e respeito a diversidade; Seminários, oficinas, reuniões de trabalhos, painéis e encontros sobre as temáticas do combate a descriminação, da superação do racismo, da homofobia e outras formas de Intolerância; Intercambio entre as universidades sobre o trabalho de superação as descriminações: racial, sexual, de gênero e aos portadores de vírus HIV IAIDS; Seminários sobre os procedimentos do funcionamento do Programa de Ação Afirmativa; Levantamento de Dados; Tratamento e analise dos resultados; Publicação Serão distribuídas 50 bolsas nas seguintes modalidades: 25 bolsas destinadas a alunos cotistas que trabalharão como multiplicadores de princípios de Direitos Humanos e de diversidade cultural junto à 13 escolas de Ensino médio que compõem a RIEP. Objetiva-se, com isso, disseminar os propósitos da política de inclusão social e Racial desenvolvida pela UFPR e levantamento de dados sobre profissionalização, mecanismos de acesso e políticas de superação as descriminações, em geral, principais duvidas sobre DST/AIDS e formas de prevenção. Além do reconhecimento de prevenção associada ao consumo de drogas, a DST/AIDS, a violência relacionada a criança e ao adolescente, bem como a gravidez indesejada, enfatizando a educação e a promoção da cultura pela paz. Pretende-se que estes bolsistas desenvolvam, sob a supervisão de professores da UFPR, linguagens e formas de abordagens mais próximas dos adolescentes e jovens. Outro segmento será o de divulgação sobre a complexidade da epidemia de DST/AIDS, preferencialmente junto a população do vale do Ribeira, região que e reconhecida como de baixa permeabilidade as campanhas de saúde publica. Para tanto, serão disponibilizadas 15 bolsas. Outras 05 bolsas serão destinadas ao Núcleo de Estudos Afrobrasileiros e 05 ao Centro de Estudos em Segurança Pública e Direitos Humanos, ambos da UFPR. Todos os alunos bolsistas deverão iniciar seu trabalho em maio/2005 e, durante os dois primeiros meses, serão capacitados nos assuntos relativos ao programa. A partir do mês de julho desenvolverão pesquisa-ação junto a população-alvo. O programa mínimo da capacitação constara de: Análise da diversidade cultural, social e econômica do Brasil; Políticas afirmativas; Noções de Direitos Humanos; Movimentos culturais: gênero, raça, religião, sexuais e outros; Técnicas de abordagens a grupos específicos: doentes, estudantes, analfabetos, e outros.

Concorrência: BRASIL AfroAtitude

População Alvo: População Negra

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: CAPACITAÇÃO E FORMAÇÃO EM PESQUISA

Produção Científica


Projeto: Apoio à Permanência de Estudantes Negros na UFBA e à Prvenção das DST/AIDS em Salvador e Lauro de Freitas
Coordenador: PAULA CRISTINA DA SILVA BARRETO
Resumo: Em dezembro de 2004 foram divulgadas informações sobre o número de casos de AIDS na população segundo a cor. Os resultados indicam que embora haja concentração de maior proporção de casos entre os brancos, homens e mulheres, comparados a pretos pardos, no período de 2000 a 2004 tem ocorrido um aumento do número de casos entre estes ultimos, principalmente, entre as mulheres, e uma queda entre os brancos, homens e mulheres (MS/SVS/SINAN/PN DST e AIDS). Em que pese o sucesso das iniciativas do Governo Federal na prevenção a AIDS no Brasil, reconhecido internacionalmente, o quadro descrito acima demonstra que é necessário dar continuidade aos programas já implementados e, ao mesmo tempo, ampliar as ações de prevenção, principalmente, entre os segmentos da população em que se observa que há crescimento do número de casos, como entre as mulheres e afrodescendentes. Fazer isso através de um projeto que preve o envolvimento direto de jovens estudantes universitários negros, beneficiários dos programas de ação afirmativa existentes em diversas universidades públicas brasileiras, como é o caso da Universidade Federal da Bahia, mais do que apropriado é necesário, por emonstrar a possibilidade de reforço mútuo e articulação de políticas públicas que até então se mantinham separadas em esferas distintas do Governo Federal.

Objetivo: O final do Projeto espera-se ter alcançados os seguintes objetivos: 1) os estudantes diretamente envolvidos estejam motivados a se inserirem em projetos de prevenção às DSTs/AIDS já em execução no Instituto de Saude Coletiva, nas Faculdades de Medicina, Enfermagem e Odontologia da UFBa; 2) os estudantes diretamente envolvidos estejam estimulados para participar ativamente no trabalho realizado por organizações não-governamentais que atuam nestas areas; 3) a permanência dos estudantes cotistas seja garantida nos cursos em que estes foram aprovados no Exame Vestibular de 2005; 4) os estudantes bolsistas, a comunidade universitária em geral e a população dos bairros selecionados de Salvador e Lauro de Freitas sejam sensibilizados para a importância dos programas de ação afirmativa no ensino superior, e para a importância da prevenção às DSTs/AIDS no Brasil; 5) as organizações parceiras e os órgãos municipais de saúde sejam apoiados no desenvolvimento de suas atividades, 6) a comunidade universitária da UFBa, bem como a população residente nos bairros selecionados dos Municípios de Salvador e Lauro de Freitas sejam sensibilizadas para a importancia do combate a desigualdade racial e da implementação de políticas de ação afirmativa para os afrodescendentes brasileiros.

Metodologia: Em 2005 estará ingressando na UFBa a primeira turma de estudantes beneficiados pelo sistema de cotas para negros e oriundos de escolas públicas, composta por cerca de 670 estudantes. 50 destes estudantes serão incorporados no Projeto em atividades de pesquisa e iniciação científica, intervenção comunitária e monitoria. Planeja-se atividades em grupos de pesquisa já existentes, incorporando esses alunos com o objetivo de levá-Ios a uma melhor capacitação intelectual e futuro ingresso na pós-graduação. As técnicas a serem adotadas dependerão das especificidades e estratégias dos diferentes projetos de pesquisa. Além disso, serão realizadas atividades dentro das organizações não-governamentais parceiras (GGB, GAPA, CAASA e ANAl), e atividades de monitoria diretamente ligadas a coordenação geral do Projeto, relacionadas com a documentação e divulgação do conjunto de atividades realizadas no âmbito do Projeto. Todos os estudantes bolsistas participarão de urn programa de formação que incluirá: 1) urn Ciclo de Seminários, realizados quinzenalmente, abordando temas como: Prevenção às DSTs/AIDS no Brasil; 2) Ação Afirmativa e Políticas Anti-Racistas; 3) Desigualdade Racial; 4) Reforma Universitária; 5) Metodologia de Pesquisa em Saúde Pública; 6) Juventude e Cidadania etc. O Ciclo de Seminários contará com a participação dos professores envolvidos diretamente no Projeto, bem como de outros convidados, e incluirá a exibição de documentários. Além disso, ocorrerão mensalmente os Encontros Culturais, organizados por comissões formadas pelos próprios estudantes, com o objetivo de promover a formação de laços de amizade e as trocas de experiências. Serao envidados, ainda, esforços no sentido de garantir a formação em língua estrangeira de todos os estudantes bolsistas. Quanto a avaliação, esta prevista a realização de entrevistas individuais trimestralmente, onde se verificará o coeficiente de rendimento, assim como o interesse e participação nas atividades dos projetos tanto de pesquisa quanta aqueles voltados para as atividades de extensão junto aos bairros periféricos e para a monitoria. Semestralmente, será realizada uma reunião com toda a equipe para discutir as experiencias e dificuldades encontradas no decorrer do Projeto.

Concorrência: BRASIL AfroAtitude

População Alvo: População Negra

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: CAPACITAÇÃO E FORMAÇÃO EM PESQUISA

Produção Científica


Projeto: Brasil Afroatitude
Coordenador: JORGE LUÍS DE SOUZA RISCADO
Resumo: O Programa Políticas de Ações Afirmativas para Afro-descendentes no Ensino Superior da Universidade Federal de Alagoas (UFAL) e constituído por um conjunto de ações com objetivo de eliminar as desigualdades sociais históricas. Este programa, dentro de suas ações, instituiu o sistema de cotas para população afrodescendente, oriunda de escolas públicas, no preenchimento de vagas relativas aos cursos de graduação, a fim de propiciar ações que viabilizem o acesso e permanência da população negra na UFAL. Após a sua aprovação pelo CONSUNI e CEPE, o Programa ficou estruturado em 04 (quatro) subprogramas: 1- Políticas de Cotas, 2- Políticas de Acesso e Permanência, 3- Políticas Curriculares e de Formação de Professores e 4 - Políticas de Produção de Conhecimento. Esses 04 (quatro) subprogramas estão sendo coordenados por uma Comissão Permanente do Programa de Ações Afirmativas da UFAL. A Universidade Federal de Alagoas, enquanto instituição federal, encontra-se diante de um desafio particular: exercer mais fortemente sua missão social, enquanto agente de desenvolvimento, em seu contexto periférico de grandes limitações, contrastes e precariedades. De fato, os indicadores educacionais, sociais e econômicos estaduais são desfavoráveis, fazendo com que Alagoas continue sendo o estado brasileiro com menor desenvolvimento social - IDH = 26° lugar. Dois de seus municípios - Traipu e São José da Tapera, este com 11 casos notificados de AIDS - encontram-se no ranking de baixíssimo IDH, dos municípios brasileiros. Verifica-se que o processo de eliminação do preconceito racial e bastante complexo e envolve outros fatores, além das cotas na área da educação. É papel do Estado regular essas distorções históricas e a Universidade Federal de Alagoas (UFAL), como universidade pública, adota essa perspectiva. Situação atual de AIDS em Alagoas: o primeiro caso foi notificado em 1986 com um paciente do sexo masculino por via de transmissão sexual; dos casos notificados de 1986 a novembro de 2004 são de 1.691 em Alagoas, onde 1.254 são do sexo masculino e 437 são do sexo feminino; o primeiro caso de gestante foi notificado em 1994, de 1994 a 2004 notificou-se 89 casos com a faixa etária mais atingida entre 20 e 34 anos, nas crianças em tratamento 11 são do sexo masculino e 12 do sexo feminino; a faixa etária mais atingida esta entre 20 a 49 anos com 1.539 casos notificados; nos pacientes em tratamento, 766 são do sexo masculino e 336 são do sexo feminino; quanto ao nível de escolaridade, 348 estão entre 04 e 07 anos de estudo, 263 estão entre 08 e 11 anos, 220 entre 01 e 03 anos de estudo, 145 estão com 12 anos e mais e 162 não possuem nenhuma escolaridade, (SESau-AU CE-DST/AIDS, 2004). Ainda conforme a fonte acima apontada, os casos de sífilis congênita, os dados de 1995 a 2003 representam 51 municípios com 1 a 10 casos; 6 municípios entre 11 e 30 casos e 1 município com 170 casos. Segundo a Coord. Estadual de DST/AIDS - SESau/AL (2004), os municípios com maior número de casos: Maceió: 1.195; Arapiraca: 86; Rio Largo: 26; São Miguel dos Campos: 21; União dos Palmares: 21; Palmeira dos índios: 15; Santana do Ipanema: 14; Coruripe: 14; Delmiro Gouveia: 13; Marechal Deodoro: 12; Penedo: 11; São José da Tapera: 11.Municípios com populações mais vulneráveis: Paripueira: 5; Barra de Santo Antonio: 6; São Luiz do Quitunde: 7; Matriz de Camaragibe: 2; Passo de Camaragibe: 3; São Miguel dos Milagres: 1; Porto de Pedras: 2; Porto Calvo: 4; Maragogi: 3; Barra de São Miguel: 2; Coruripe: 14; Jequiá da Praia: 2; Roteiro: 1. Área de fluxo de caminhoneiros: Maceió: 1.195; Arapiraca: 86; Rio Largo: 26; São Miguel dos Campos: 21; Palmeira dos Índios: 15; Delmiro Gouveia: 14; Porto Real do Colégio: 2; Novo Lino: 2. Região Ribeirinha: Piaçabuçu: 4; Penedo: 11; São Brás: 1; Pão de Açúcar: 6; Piranhas: 2. Área Indígena: Já com dois casos de AIDS notificados nesta população, aldeiados. Pão de Açúcar: 6; Porto Real do Colégio: 2; Pariconha: 1; Joaquim Gomes: 6; São Sebastião: 5; Palmeira dos Índios: 15. Área com maior fluxo de HSH: Maceió: 1.200; Pão de Açúcar: 6; Porto Real do Colégio: 2; Matriz de Camaragibe: 2; Porto Calvo: 4; Cajueiro: 4; União dos Palmares: 22; São José da Laje: 4; Delmiro Gouveia: 14; Piaçabuçu: 4. Como já foi abordado anteriormente, é baixíssimo o índice de Desenvolvimento Humano (IDH) no estado de Alagoas, temos casos de AIDS nos municípios pobres, a situação socioeconômica dos bairros do entorno da Universidade Federal de Alagoas é baixa e sinaliza a pauperização, assim como encontra-se um agrupamento de Sem- Tetos numa área invadida. Ainda somos abrangidos por três penitenciárias e todo um movimento de caminhoneiros que circula do nordeste ao sul do país e processo de interiorização. Com as nossas ações buscaremos visualizar o aumento da demanda de camisinhas nas Unidades Básicas de Saúde (UBS), assim como aumento das requisições para os testes antiHIV, anti-sífilis congênita e hepatites virais B e C. Ainda enquanto impacto, buscaremos o aumento de consultas as unidades de referencias, além da qualidade dos registros médicos (prontuários) e das notificações. Projetamos ainda, uma melhoria dos egressos do curso de saúde para o Programa de Saúde da Família, assim como a contribuição na formação dos ingressos do PAAF.

Objetivo: OBJETIVOS GERAIS: - Contribuir com a permanência e a produção do conhecimento para os alunos do PAAF-UFAL; - Melhorar na qualidade da informação e conhecimento sobre DST, HIV/AIDS e Hepatites Virais por parte dos ingressos nas cotas, dentro do Programa Brasil AfroAtitude; - Conhecer e promover práticas sexuais seguras tanto entre os ingressos negros quanto toda a comunidade acadêmica; - Promover de Direitos Humanos das pessoas vivendo com HIV e AIDS; - Aumentar de demanda de camisinhas nas UBS; - Aumentar do fluxo de usuários para prevenção e tratamento das DST e da AIDs nos CTAs e ambulatórios especializados; - Aumentar do fluxo de usuários para testes anti-HIV nos CTAs e anti-sílifis congênita; - Qualificar os profissionais de saúde para o PSF, dentro da temática; - Qualificar o PACS em relação à temática; - Melhorar a atenção à gestante HIV positiva e as crianças expostas ao HIV/Sífilis Congênita; - Promover a atenção e apoio para melhoria às pessoas vivendo com HIV e AIDS; - Promover da atenção e apoio odontológico para melhoria as pessoas vivendo com HIV e AIDS; - Diagnosticar: resultados (dados) de estudos sobre a saude da população negra; - Diagnosticar: resultados (dados) de estudos sobre redução de danos pelo use de drogas; - Diagnosticar: resultados (dados) de estudos sobre a violência contra a mulher, as DST e a AIDS; - Diagnosticar: resultados (dados) de estudos sobre corpo, mulher, DST e AIDS; - Fazer pesquisa Epidemiológica sobre o conhecimento de HIV/AIDS entre calouros do curso da área de saúde da UFAL - Diagnosticar: resultados de estudo sobre Mulheres Quilombolas: saúde reprodutiva, práticas sexuais, sexo protegido, conhecimento sobre DST/AIDS e práticas populares de saúde.

Metodologia: Será adotado para a 1ª fase do processo de construção coletiva do Projeto Matricial, o método ZOPP (conhecido no Brasil como meta). A Oficina de capacitação terá respeitada a metodologia do PBL, sistematizada e unificada pela Unidade de Treinamento do PN-DST/AIDS-MS. Para monitoramento será construído um instrumento para coleta de informação à partir dos indicadores e referenciais. Da mesma forma o sistema de avaliação: verificação dos nós críticos e da possibilidade de continuidade, etc. Para as reuniões de Coordenadores e bolsistas realizaremos o método da Roda. Quanto aos relatórios parciais - para troca de experiência -, lançaremos mão do instrumento "chat" para comunicações dialogadas na rede de informação com outras Universidades Públicas de Ensino Superior (UPES), previamente agendada por e-mail e constando da Home page (www.ufal.br/universidaids/paaf).

Concorrência: BRASIL AfroAtitude

População Alvo: População Negra

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: CAPACITAÇÃO E FORMAÇÃO EM PESQUISA

Produção Científica


Projeto: Caracterização antigênica e prevalência de mutações associadas à resistência aos anti-retrovirais em vírus de indivíduos com infecção recente por HIV-1 no Estado de Santa Catarina.
Coordenador: MAURO SCHECHTER
Resumo: Até 31 de dezembro de 2002, 257.780 casos de AIDS haviam sido notificados ao Ministério da Saúde. O Rio de Janeiro, com 36.462 casos notificados e o segundo estado mais afetado do país (Boletim Epidemiológico da CN-DSTI AIDS-MS - Ano XVI n°l). As estimativas de prevalência da infecção por HIV baseiam-se, em grande parte, em projeções feitas a partir dos casos notificados de AIDS e em vários estudos envolvendo populações sentinela. Há, no entanto, re1ativamente poucos estudos que tenham, direta ou indiretamente, avaliado a incidência da infecção por HIV-I em nos só meio. No Rio de Janeiro, em estudo prospectivo por nós conduzido entre 1995 e 1998, estimou-se ser de 3,1% a incidência de infecção por HIV entre homens que relatavam fazer sexo com outros homens (Harrison 1999). Em outro estudo, também por nós conduzido, e que utilizou metodologia semelhante à proposta no presente estudo, estimou se ser de 1,9 e de 2,8 por 100 pessoas-ano a taxa de incidência entre homens e mulheres heterossexuais, respectivamente (Schechter 2000). No Brasil, o subtipo B e responsável pela maioria dos casos de infecção por HIV -1 (WHO 1994; Morgado 1994; Da Costa 1995; Sabino 1996). Estudo realizado por nosso grupo sugeriu que, no Rio de Janeiro, o subtipo F havia sido introduzido mais recentemente e infectava mulheres mais comumente (pinto 1998). Dados mais recentes sugerem que subtipos não-B podem ser responsáveis por ate 30% das infecções, especialmente no sul do país (Brindeiro 2003). Vários estudos conduzidos em países desenvolvidos, onde predominam as infecções por subtipo B, documentaram a presença de cepas de HIV-1 resistentes aos anti-retrovirais (ARV) em ate 29% dos indivíduos recentemente infectados (Alexander 1999; Boden 1999; Little 1999; Yerly 1999; Brenner 2000; Briones 2001). Por outro lado, não existe dados na literatura que demonstrem conclusivamente haver relação direta entre a prevalência de mutações de resistência aos ARV em indivíduos tratados, a transmissão de cepas virais resistentes e a freqüência de resistência primaria detectada em indivíduos com infecção recente (UK. Group 2001; Kahn 2001). No entanto, e provável que o uso em larga escala de drogas ARV esteja associado à transmissão de vírus resistentes a estes medicamentos. No Brasil, a prevalência de cepas resistentes aos ARV em indivíduos virgens de tratamento e inferior a 5% (Brindeiro 2003; Tanuri 1999; Dias Tavares Manuscrito em preparação). No entanto, não e conhecida, no Brasil, a prevalência de cepas resistentes aos ARV em indivíduos com infecção recente. Os resultados obtidos com o presente projeto poderão ser de grande importância para o desenho de estudos de avaliação da eficácia de vacinas, que provavelmente serão testadas no Brasil nos próximos anos. Os dados obtidos, além de auxiliarem nas estimativas de tamanho amostral de estudos vacinais, poderão ajudar no direcionamento de campanhas de prevenção, por permitirem monitorar, em tempo real, a incidência da infecção por HIV-1. Os dados obtidos com a investigação da distribuição de subtipos virais em infecções incidentes poderão orientar na escolha dos produtos vacinais a serem testados e/ou no desenho destes estudos, no tocante a avaliação de proteção cruzada entre subtipos. Os dados obtidos com a estimativa de relevância de mutações associadas à resistência aos anti-retrovirais em infecções recentes e relevantes para o Brasil e para países em desenvolvimento que estejam se preparando para expandir o acesso à terapia ARV e pode ser importante no de lineamento de futuras estratégias terapêuticas.

Objetivo: Objetivo geral: O principal objetivo deste projeto é descrever importantes características de vírus obtidos de indivíduos com infecção recente por HIV -1, identificados em um centro de testagem para o HIV na cidade do Rio de Janeiro. Objetivos específicos: - Estimar a incidência da infecção por HIV -1; - Investigar a distribuição de subtipos de HIV -1 entre indivíduos recentemente infectados; - Estimar a prevalência de mutações associadas à resistência aos ARV entre os indivíduos com infecção recente.

Metodologia: O presente estudo irá analisar amostras obtidas de todos os indivíduos que procurarem o Centro de Orientação e Apoio Sorológico (COAS) do Hospital Esco1a São Francisco de Assis (HESFA) entre agosto de 2003 e maio de 2004 e que preencham os critérios de inclusão e de exclusão do estudo. Critérios de inclusão e de exclusão Serão inc1uidos todos os homens e mu1heres com idade igua1 ou superior a 14 anos que procurarem realização de sorologia para HIV -1 no COAS-HESF A entre agosto de 2003 e maio de 2004 e que concordarem em participar do estudo. Não poderão participar do estudo indivíduos que não queiram ou não sejam capazes de prover consentimento informado. A não participação no estudo não interferi com os serviços prestados pe10 COAS-HESF A. Estimativa da incidência de infecções pelo HIV-1 As amostras consideradas positivas ou indeterminadas para infecção pelo HIV, de acordo com os critérios do Ministério da Saúde, serão submetidas a dois testes ELISA adicionais com sensibilidades diferentes [sensitivelless sensitive EIA method (SILS)]. O primeiro teste, mais sensive1 é capaz de detectar níveis baixos de anticorpos, e positivo para todos os indivíduos com anticorpos anti-HIV. O segundo, menos sensive1, é capaz de detectar apenas níveis e1evados de anticorpos e via de regra, só é positivo nos indivíduos com uma resposta humoral p1enamente desenvo1vida (Janssen 1998). Esta metodologia, denominada "detuned" (Janssen 1998), e capaz de discriminar, com e1evadas sensibi1idade e especificidade, indivíduos com infecção recente (ocorrida ha menos de 170 dias) de indivíduos com infecção mais antiga (ocorrida ha mais de 170 dias). Assim, para fins do presente estudo, uma infecção por HIV-1 será considerada como sendo recente ('incidente") em pacientes com ELISA positivo, Western Blot positivo ou indeterminado e um teste SILS não reator. Da mesma forma, a infecção por HIV-1 será considerada como "não recente" ("preva1ente") em pacientes com ELISA, Western Blot e teste SILS positivos. A incidência anual (1) será calcu1ada através da formula: I = preva1ência = n x 365 x 100 Duração N T Onde N denota o número de pessoas com teste negativo em um determinado período de tempo (T) mais o número de indivíduos com infecção recente (n). Distribuição de subtipos HIV-1 Amostras coletadas de indivíduos com infecção recente por HIV-1 serão submetidas a amp1ificação gênica e seqüenciamento genético. Resumidamente, o RNA viral extraído será retro transcrito e amplificado, e os produtos gerados, de 320bp e 1,8kb, para as regiões da transcritas reversa (RT) e da protease (PR) do gene pol e C2-V3 do gene env, respectivamente, serão seqüenciados automaticamente, baseado na técnica de Sanger. Os fragmentos seqüenciados têm redundância suficiente para promover leituras nos dois sentidos (forward e reverse) permitindo a montagem e o alinhamento das seqüências obtidas e posterior comparação com as seqüências de referencia obtidas do NCBI's HIV-J Subtyping Tool (www.ncbi.n1m.nih.gov/retroviruses/hiv) para a determinação do subtipo viral.

Concorrência: Pesquisas Científicas - Abr/2002

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: BÁSICA OU FUNDAMENTAL

Produção Científica


Projeto: SESI Prevenção às DST/AIDS.
Coordenador: Ione Maria Fonseca de Melo
Resumo: A UNAIDS estima que cerca de 40 milhões de pessoas vivem com o HIV/Aids, 26 milhões tem entre 15 e 49 anos de idade. Dessas pessoas, 71,0% concentram-se na África Subsahariana, 16,5% na Ásia e 3,8% na America Latina, ou seja, 91 % dos casos encontram-se nos países em vias de desenvolvimento. A epidemia do HIV/Aids atinge todos segmentos da sociedade, independentemente ,de gênero , sexo, idade,escolaridade e condições econômicas. No Brasil em 2003 foram diagnosticados 310 mil casos de Aids, sendo que, aproximadamente ,83% dos casos notificados ao Ministério da Saúde, encontram-se na faixa etária de 15 a 49 anos de idade de ambos os sexos, o que corresponde a população de maior força produtiva do pais. As regiões Sudeste e Sul apresentaram 84% dos casos, correspondendo a maior concentração no período entre 1980 e 2003. Houve uma tendência de aumento no número de casos em alguns estados das regiões Norte e Nordeste relacionado as alterações nos padrões socioeconômicos da doença, que passa a atingir os segmentos mais pobres da população. Outro segmento importante que afeta diretamente o setor produtivo se refere aos casos de Aids entre os usuários de drogas injecíveis. Em relação a categoria de exposição os dados evidenciam uma evolução significativa no número de casos associados a transmissão heterossexual. A media no período de 1980-1991, de 17,4% passou para 56,1% em 2002. Este fato deve-se ao aumento da incidência da doença entre as mulheres. Estudo brasileiro de 2003, analisando 152.252 casos de aids, no período de 1991-1998, mostra que 89% dos casos atingiam homens empregados e 44% atingiam mulheres. Ate 1992, do total de casos em que se conhecia a escolaridade do portador era de pessoas com nível de escolaridade superior ou com mais de 11 anos de estudo. Já em 2002, entre aqueles com escolaridade conhecida, 74% eram analfabetos ou tinham ate oito anos de escolaridade e apenas 26%, tinham 11 anos ou mais de escolaridade. A correlação entre escolaridade e pobreza evidencia uma maior incidência de casos de Aids nos grupos mais pobres. Quanto as taxas de mortalidade por Aids evidencia-se um declínio a partir de 1995, que coincide com a oferta no mercado de esquemas anti-retrovirais mais potentes, em conjunto com a política brasileira de acesso universal e gratuito a esses medicamentos. Os indicadores sobre conhecimentos e atitudes para a adoção de práticas seguras no local de trabalho devem ser melhorados, pois em muitos setores convive-se com a realidade da desinformação do preconceito e de comportamentos de risco, principalmente naqueles ramos de produção onde os trabalhadores são mais suscetíveis a crise econômica. Diante do exposto, e considerando a necessidade de fortalecer o trabalho da instituição que há 16 anos vem desenvolvendo em parceria com o Ministério da Saúde, da cultura institucional voltada para o enfoque da saúde centrado na qualidade de vida, e que o SESI sentiu a necessidade de ampliar a sua margem de ação o e cobertura para garantir uma resposta nacional e assegurar uma identidade própria relativa a intervenção no mundo do trabalho. O SESI reconhece que há muito a ser realizado para atingir os objetivos de Desenvolvimento do Milênio propostos pelas Nações Unidas, que o Programa Brasileiro de DST/ Aids e exemplo para o mundo, mas acredita, que só com a união de esforços, entre governo, sociedade civil e setor privado, poderão juntos, aumentar a cobertura e reduzir o impacto da epidemia no Pais. Serão beneficiados pelo projeto 500.000 trabalhadores do segmento industrial brasileiro e suas famílias. Segundo o Ministério da Saúde em 2003, aproximadamente, 83% dos casos de Aids notificados encontravam-se na faixa etária de 15 a 49 anos de idade, 0 que corresponde a população ao de maior força a produtiva do pais.

Objetivo: Geral: Expandir a capacidade de resposta do SESI, no que se refere ao Programa de DST/HIV/AIDS, para conter a epidemia entre os trabalhadores do setor industrial e seu entorno social. Específicos: Aperfeiçoar os atuais mecanismos gerenciais do programa e desenvolver tecnologias de prevenção que sejam apropriadas a realidade do setor, culturalmente referenciadas e direcionadas a suprir as necessidades das pequenas e médias empresas do setor industrial; Ampliar a cobertura das ações e focalizá-las nos segmentos mais vulneráveis, tais como mulheres trabalhadoras, jovens e trabalhadores com baixos níveis de escolaridade e precarização do trabalho; Produzir conhecimentos e informações sobre a situação da epidemia entre os trabalhadores da indústria, ramos mais afetados, impacto econômico e social e situação das pessoas já afetadas, acesso aos medicamentos e insumos básicos de prevenção, para auxiliar a tomada de decisões na área; Componentes: O Projeto será operacionalizado contemplando dois componentes: 1) Desenvolvimento de programas de prevenção nas empresas e na comunidade; 2) Geração de informações e pesquisas; Componente 1:- Programas de Prevenção Empresa/Comunidade Este componente responde pelas ações estarão direcionadas na implantação de programas de prevenção nas empresas e na comunidade, a partir de um enfoque que privilegia a formação de multiplicadores, a sensibilização do empresariado e a intervenção na comunidade, principalmente, ações que estejam voltadas para os jovens nas escolas do SESI, nos programas de educação dos trabalhadores e nas atividades extramuros em parceria com a sociedade civil e com o governo. No âmbito das empresas dar-se-a prioridade para uma maior focalização nos grupos de trabalhadores mais vulneráveis, nas questões de gênero, e para o desenvolvimento de uma proposta específica para atender a demanda das pequenas empresas. Nas ações que envolvem a comunidade, o SESI dará prioridade a integração multisetorial com outras áreas sociais visando ampliar sua capacidade de resposta, a partir da inserção de temas relativos a prevenção às DST/AIDS e drogas nos programas de educação de adultos e nas escolas do ensino básico mantidas pelo SESI. Nas escolas próprias do sistema SESI/SENAI o objetivo seria de conceber uma proposta modelo de educação sexual e de saúde reprodutiva para todo o sistema. Componente 2 - Informação e Pesquisa O desenvolvimento de conhecimentos e de informações são condições imprescindíveis para a tomada de decisões. Nesta área, o SESI tem adquirido uma experiência muito significativa, pois tem realizado números estudos em diferentes áreas, o que lhe confere autoridade e qualificação para tal empreendimento. O SESI pode se constituir em uma referência para o Programa de DST/AIDS e outras agendas na geração de pesquisas de opinião, estudos de diagnósticos rápidos e estudos de avaliação, estudos qualitativos, direcionados para as questões das DST/AIDS no mundo do trabalho. Nesta área há ainda muito que fazer, pois os estudos em apenas contemplado uma dimensões do problema, qual seja, de estarem centrados nas atitudes, conhecimentos e práticas. Há, portanto, dimensões ainda não exploradas, como as representações sobre a sexualidade, gênero e AIDS no mundo do trabalho, configurações de práticas homossexuais, estudos avaliativos sobre os programas de DST/AIDS no local de trabalho, entre outros temas relevantes. O Projeto será monitorado com vistas a avaliar a eficácia, ou seja, a relação entre os objetivos propostos e seus resultados alcançados. A avaliação se dará por meio de reuniões técnicas, pesquisa de opinião, relatórios e visitas in loco. Será realizada avaliação de processo e de resultados.

Metodologia: Para o desenvolvimento do projeto serão realizados: Encontro entre os Departamentos Regionais, Coordenadores Estaduais de DST/Aids e representantes dos Fóruns Estaduais de Organizações da Sociedade Civil para sensibilizá-los para atuação conjunta na área. Pesquisa sobre a situação da epidemia entre os trabalhadores da indústria, aspectos comportamentais e vulnerabilidade as DST/Aids e qualidade de atenção a saúde dos trabalhadores; reuniões técnicas para planejamento das ações da pesquisa; treinamento da equipe de pesquisadores; tabulação e análise dos dados; relatório final; editoração, publicação e seminário de divulgação.

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: CAPACITAÇÃO E FORMAÇÃO EM PESQUISA

Produção Científica


Projeto: Estudo de Equivalência na Determinação da Carga Viral do HIV-1 Utilizando Diferentes Metodologias
Coordenador: MARIA INÊS DE MOURA CAMPOS PARDINI
Resumo: A carga viral plasmática reflete a dinâmica da infecção pelo HIV-1, uma vez que quantifica as partículas virais que estão sendo produzidas e lançadas na circulação. Assim, é de grande utilidade na decisão médica no momento de indicar, monitorar e modificar o esquema antiretroviral de um paciente. Neste sentido, o maior obstáculo a ser superado e a decisão sobre qual metodologia utilizar para a realização do teste. Atualmente existem três metodologias disponíveis para a realização do exame de carga viral: RT - PCR (Amplicor HIV-1 MonitorTM), desenvolvido pela Roche Diagnostic Systems; NASBA (NuciisensTM HIV-1 QT), desenvolvido pela Organon Teknika; Branched - DNA (Quantiplex®), desenvolvido pela Chiron. Os três métodos vêm sendo muito discutidos no que diz respeito à sensibilidade, especificidade e reprodutibilidade. Muitos estudos vêm sendo publicados no sentido de comparar estes parâmetros para as três metodologias empregadas na determinação da carga viral de um paciente infectado pelo HIV-1. Desde 1996, ano em que os testes de carga viral estavam sendo introduzidos no mercado, já se desenvolviam pesquisas buscando ressaltar a eficácia das metodologias, suas vantagens e desvantagens. Estas pesquisas mostraram que os três ensaios geravam resultados equivalentes, possuindo desempenho similar na detecção e quantificação do RNA do HIV-1, concluindo, assim, que os três métodos tem eficácia e desempenho semelhantes e são muito reprodutíveis. Hoje existe nova tecnologia capaz de quantificar os resultados gerados em uma reação de PCR: o Real Time PCR ou PCR em tempo real. Com esta nova metodologia apta a ser padronizada para a quantificação do RNA plasmático do HIV-1, uma nova alternativa para a determinação da carga viral tornou-se disponível que por ser realizada in house se torna menos dispendiosa. Por outro lado, são necessários estudos que comprovem sua eficácia para a determinação da carga viral plasmática, bem como que demonstrem que esta nova metodologia e capaz de gerar resultados equivalentes aos kits comerciais atualmente disponíveis no mercado. Neste contexto se enquadra o presente estudo buscando verificar a equivalência das metodologias utilizadas em nível nacional, incluindo aqui a tecnologia mais recente do PCR- Real Time.

Objetivo: OBJETIVO GERAL: Validar a tecnologia de PCR em tempo real, desenvolvidos "in house" após estudo comparativo com 3 tecnologias disponíveis no mercado nacional (NASBA, RT -PCR, b-DNA).

Metodologia: Método/Tipo de Estudo : A quantificação da carga viral do HIV pode atualmente ser realizada por três metodologias distintas disponíveis no mercado nacional: PCR/Amplicor; Nasba/Nuclisens; b-DNA Quantiplex e a quarta metodologia que e considerada hoje no mercado como padrão ouro, que estará sendo validada neste estudo. Princípios Metodológicos: Amplicor HIV-1: amplificação direta de acido nucléico (seqüência alvo de 142 bases da região do gene gag do HIV-1 por meio da reação da polimerase em cadeia de PCR. Gera cópias múltiplas de uma seqüência específica de nucleotídeos de um determinado organismo e constitui-se de 3 etapas: desnaturação, hibridação extensão. Nuclisens HIV-1: amplificação direta da região do gene gag do HIV isotérmica e continua que utiliza RNA sintéticos como controles internos e detecção por eletroquimioluminecência. São usados 3 RNAs sintéticos (Qa concentração alta, Qb concentração média, Qc concentração baixa), distintos do RNA do HIV selvagem em uma seqüência de 20 nucleotídeos, localizada na parte central da região a ser amplificada. A metodologia compreende na liberação, isolamento do RNA viral, amplificação e detecção do material amplificado. Quantiplex b-DNA: Inicia-se com a precipitação do HIV a partir de centrifugação do plasma, seguida pela liberação do RNA genômico dos virions. Sondas alvo de oligonucleotídeos sintéticos são utilizadas para capturar o RNA do HIV-1, ligando-se a diferentes regiões do gene pol do RNA viral. Em seguida ocorre a hibridação desse complexo imobilizado com um segundo conjunto de sondas de DNA marcadas com fosfatase alcalina. Para amplificar o sinal, cópias múltiplas de uma sonda marcada com fosfatase alcalina se hibridizam à sonda imobilizada. A incubação desse complexo com um substrato quimioluminescente fornece condições de detecção, uma vez que a luz emitida e diretamente proporcional à quantidade de RNA viral presente na amostra e registrada através de contagens luminescentes por um leitor de placas. PCR real time: Gera cópias múltiplas de uma seqüência específica de nucleotídeos e amplifica o RNA viral do HIV em tempo real. A PCR em Tempo Real consiste em um sistema desenvolvido pela Applied Biosystems para detectar o produto da PCR a medida que este vai sendo sintetizado na rea9ao, tornando a metodologia quantitativa. o sistema e baseado no uso de uma sonda, dirigida contra uma região interna da seqüência que se deseja amplificar, e que tem dois fluorocromos, um em cada extremidade da sonda (um DNA fita simples). Na extremidade 5' ha um fluorocromo (rep6rter) que só fluoresce se estiver distante fisicamente do fluorocromo na posição 3'(quencher). Este segundo fluorocromo funciona como capturador de energia e não deixa com que a energia luminosa utilizada para excitar a sonda chegue em quantidade suficiente para excitar o primeiro fluorocromo (repórter). À medida que a Taq polimerase avança sintetizando a fita nova, ela vai degradando a sonda à sua frente (atua como exonuclease no DNA de fita simples), liberando o fluorocromo repórter da sonda e permitindo que absorva energia e emita luz. A energia para a excitação dos fluorocromos provem de um feixe de laser que atravessa a amostra e o equipamento que realiza este processo denomina-se PCR em Tempo Real (Real Time PCR) ou Taqman. A leitura é realizada por um aparelho, que traça um gráfico com a absorção obtida após cada ciclo de PCR. O ciclo em que o patamar (limite) de negatividade e ultrapassado está diretamente relacionado à quantidade de DNA na mistura. A fim de comparar os resultados obtidos utilizando PCR em tempo real com as três metodologias disponíveis no mercado nacional, serão realizadas análises estatísticas para comparação quantitativa (Análise de Medidas Repetidas) e qualitativa utilizando categorização da carga viral (Teste de Concordância). Plano de coleta e análise de dados: Plano de coleta dos dados: Coleta de sangue periférico de paciente assintomáticos e sintomáticos do serviço público de saúde (SUS) obtidos no setor de coleta de cada uma das DIRs envolvidas no estudo. Tal coleta será realizada por profissional capacitado, funcionário do próprio setor. As amostras coletadas serão transportadas adequadamente, segundo as normas de biossegurança, até o Hemocentro de Botucatu, onde serão processadas pelos profissionais que já fazem parte dos recursos humanos do referido Hemocentro. Plano de Analise de dados: Análise estatística e validação de metodologia conforme descrito na metodologia.

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: ESTUDOS E PESQUISAS

Subnatureza: BÁSICA OU FUNDAMENTAL

Produção Científica


Projeto: Desenvolvimento de um método novo e econômico para quantificar a carga viral do HIV: PCR em tempo real
Coordenador: CARLOS ROBERTO BRITES ALVES
Resumo: O presente projeto representa um desdobramento do projeto anteriormente financiado pelo Ministério da Saúde - DESENVOLVIMENTO E VALIDAÇÃO DE NOVO TESTE PARA DETERMINAÇÃO DE CARGA VIRAL PLASMÁTICA EM PACIENTES INFECTADOS PELO HIV, BASEADO EM TECNOLOGIA DE AMPLIFICAÇÃO DE ÁCIDOS NUCLÉICOS EM TEMPO REAL - com vistas à sua utilização na rede pública. Depois de ter demonstrado no projteo anterior a excelente corelação dos resultados de quantificação da carga viral do HIV via PCR em tempo real baserado em fragmentos de LTR do HIV-1, quando comparado com os testes NASBA, b-DNA , e AMPLICOR, com métodos comercialmente disponíveis. Este protocolo tem como objetivo produzir aproximadametne 1.500 testes diagnósticos utilizando a tecnologia de PCR em tempo real para fins de validação externa.

Objetivo: OBJETIVO GERAL: Determinar a acurácia do protocolo de PCR em tempo real para quantificação da carga viral do HIV em comparação à métodos comerciais utilizando laboratórios de validação externa. OBJETIVOS ESPECÍFICOS: - Produzir um plamídeo contendo a sequência de controle interno e aquisição de Armored RNA; - Otimizar o protocolo nas máquinas de PCR em tempo real ABI 7500 e, comparar com os resultados obtidos com o equipamento alternativo Corbett Rotor Gene 3000; - Produzir 1.500 testes aplicando a tecnologia PCR em tempo real em forma de kit para validação externa; - Desenvolver a capacidade física para garantir o fornecimento contínuo de standards de HIV para quantificação de amostra via PCR em tempo real; - Investir na capacidade de produzir kits em grande escala.

Metodologia: O projeto ser realizará nas etapas seguintes; 1) Aquisição dos insumos para otimizar o protocolo em duas máquinas de PCR em tempo real e fornecer 1.500 testes para validadção externa. Otimização do protocolo nas máquinas de PCR em tempo real ABI 7500 e Corbett Rotor Gene 3000, adequando a concentação de MG, Primers, Sondas, dNTPs a cada máquina; 2) Aquisição dos insumos necessários para fornecer os standard de HIV para quantificação , produção e lifilização dos mesmos; 3) Sequenciar o RNA das amostra que tiveram resultados discordantes do projeto anterior para avaliar o petencial do novo método em quantificar RNA do HIV em amostras negativas (RNA não detectável) pelos métodos comercialmente disponíveis; 4) Preparação de um plasmídeo contendo a sequência do controle interno (sequência alvo do HIV, contendo uma parte do genoma do vírus da febre amarela como mutação, sendo esta a região onde a sonda hibridiza); 5) Envio do plamídeo para a empresa Ambion, E.U.A. e aquisição de 1,9 X 10 partículas de armored RNA; 6) Fabricação de 3 kits com 480 reações cada prontos para uso em laboratórios de rede brasileira e envio para o MInistério da Saúde. Ao mesmo tempo, haverá investimento material e intelectual para poder responder a uma eventual demanda do Ministério da Saúde para a produção de kits em grande escala. O protocolo foi desenvolvido e otimizado na máquina de PCR em tempo real ABI 7700 da empresa Applied Biosystems. Esta máquina já não está a venda, por isto o protocolo será otimizado no Brasil na máquina ABI 7500 da mesma empresa. O ABI 7500 representa algumas modificações em comparação com o ABI 7700, pricinpalmente referente à fonte de luz (laser no ABI 7700 e lâmpada halógna no ABI 75000) e à câmera CD (mais sensível n ABI 7500) Trata-se de um equipamento que utiliza um termobloco, dando espaço para microplaca de PCR de 96 poços. Isto garante a capacidade de testar um grande número de amostras simultaneamente (high throughput), imprescindível para o contexto brasileiro e não oferecida igualemne pela máquina Corbett Rotor Gene 3000, um sistema capaz de processar até 72 amostras simultaneamente, o que ainda garante testagem em grande escala. A vantagem principal deste protocolo não foi desenvolvido neste equipamento, será necessária severa otimização do protocolo nesta máquina, consumndo insumos e tempo. A empresa Ambion é a unica fornecedora do produto armored RNA, sendo impossível abrir uma cotação para este tipo de RNA, que servirá como controle interno altamente estável.

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: DESENVOLVIMENTO TECNOLÓGICO

Subnatureza: TECNOLÓGICA

Produção Científica


Projeto: Estudo da Prevalência de Alterações Antômicas e/ou metabólicas em protadores do HIV/AIDS em 5 centros Brasileiros. Grupo Multidisciplinar para i estudo das alterações metabólicas e/ou anatômicas em portadores de HIV/AIDS - GEAM
Coordenador: OLAVO HENRIQUE MUNHOZ LEITE
Resumo: Os efeitos estéticos, psicológicos e sociais das alterações anatômicas e as consequências das alterações metabóilcas nos sistemas cardiovasculares, neurológicos e ósseo, entre outros, justificam um estudo de prevalência desta alterações em nosso meio. Não existe no país uma avaliação sistematizada e multicêntrica dessas alterações. O conhecimento desta prevalência é fundamental para o planejamento de intervenções preventivas e terapêuticas para essas alterações. As informações obtidas nesse estudo serão utilizadas para programas de intervenções para a prevenção, determinação de fatores de risco, métodos de diagnósticos e políticas de tratamento e prevenção das complicações associadas ao tratamento anti-retroviral e da infecção pelo HIV.

Objetivo: OBJETIVO GERAL: Descrição da prevalência de alterações metabólicas e anatômicas (síndrome lipodistrófica) em 1.700 pacientes infectados pelo HIV/AIDS, selecionados aleatoriamente em 5 centros brasileiros especializados no tratamento e seguimentos desses pacientes e representantivos da realidade brasileira.

Metodologia: Para fins desse estudo foi calculada uma amostra de 1.700 pacientes de um universo de aproximadamente 15.000 pacientes em seguimento em 5 unidades de atendimento a portadores de HIV/Aids das cidades de São Paulo e Rio de Janeiro. A aleotorização foi feita a partir de banco de dados de cada uma das instituições com informações sobre o registro do paciente, sexo e data de nascimento. Os pacientes selecionados são convidados a participar do estudo e em caso de recusa, óbito ou abandono foram também aleatorizados sustitutos para completar a amostra prevista. As prevalências de alterações anatômicas e matabólicas serão determinadas após a coleta de dados em questiona´rios desenvolvidos para a pesquisa e que, após monitoria e correções, serão digitados em um banco de dados desenvolvido para esse projeto. Os questionários foram divididos em 8 partes e constam de: Instrumentos 1, 2, 3, 4 e 5 Avaliação clínica dos pacientes (dados demográficos, epidemiológicos, antecedentes familiares e pessoais, co-morbidades, auto-avaliação física, complicações já desenvolvidas, esquemas anti-retrovirais, exames laboratoirais, contagem de células T CD+ e Carga Viral do HIV históricos), exame físico direcionado, medidas de pressão arterial e Eletrocardiograma. Avaliação das pregas e circunferências corpóreas, bioimpedância e recordatório alimentar. Coleta de sangue para análise hormonais e metabólicas específicas. Instrumentos 6, 7 e 8 Foi feito cálculo de uma subamostra de 380 pacientes que realizarão, além dos itnes descritos anteriormente, os seguintes exames: - Ultrasonografia de face MMSS e MMSS para avaliação de acúmulo e perda de gorduras dessas regiões; - Tomografia Computadorizada de Abdômen para avaliação de Gordura Viceral e Gordura Subcutânea; - Ecocardiografia para avaliação de alterações anatômicas e funcionais cardíacas. As alterações encontradas em mais de 5% dos pacientes serão analisados de acordo com as variáveis previstas no projeto e correlacionadas.

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: 11º Workshop Internacional em Evolução e Epidemiologia Molecular Viral
Coordenador: MARCELO ALVES SOARES
Resumo: Métodos em análise filogenética molecuar e em genética de populações são amplamente utilizados por virologistas para estudar a epidemiologia e a evolução de vírus humanos, animais e de plantas. O desenvolvimento exponencial nos últimos dez anos de novos algoritmos para realizar análises filogenéticas e estudos de genética de populações de epidemias virais vem criando uma lacuna entre biólogos teóricos e virologistas interassados em epidemiologia molecular. O Workshop proposto visa preencher esta lacuna, dando a jovens virolgistas o background teórico, seguido de sessões práticas que demonstram as principais ferrametnas de bioinformática utilizadas em análise filogenética de sequência virais. O worksop objetiva ter por participantes pesquisadores e estudantes de Pós-Graduação em evolução e epidemiologia molecuarl de vírus, oriundos das áreas clínicas, laboratorial e de epidemiologia e saúde pública. A abrangência deste Workshop é internacional, portanto participantes do mundo inteiro poderão se inscrever e participar do processo seletivo para a participação no mesmo.

Objetivo: OBJETIVO GERAL: O Workshop tem por objetivo prover a seus participantes o treinamento necessário e a capacidade de conduzir análise filogenética, em diversos níveis de complexidade, de sequências virais para seus estudos de epidemiologia molecular e evolução viral. OBJETIVOS ESPECÍFICOS: - Expor e ensinar aos estudantes os diversos softwares de Biologia Molecular aplicados à análise de sequências (Clustal, Dambe, SplitsTree.PAML, etc); - Aprimorar a capacidade de análise de dados dos participantes, utilizando seus próprios conjuntos de dados, de forma a extrair o máximo de informação a partir de seus dados gerados; - Promover a colaboração científica entre os participantes (entre si) e com os instrutores do curso; - Estimular a publicação de trabalhos cinetíficos originados das análises dos participantes conduzidas no curso, em periódicos internacionais de alto índice de impacto; - Propriciar a oportunidade, sem precedentes, de trazer o Brasil corpo docente de tamanho gabarito, promovendo um treinamento de altíssimo nível a pesquisadores e profissionais de sáude brasileiros.

Metodologia: Os estudantes serão treinados em analisar conjuntos de dados reais retirados da literatura. Além disso, estimularemos os participantes a discutir com os instrutores a aplicação da análise filogenética a problemas epidemiológicos específicos que eles encontram durante sua própria pesquisa, e a praticar as técnicas recém-aprendidas aos seus próprios conjuntos de dados. Durante as seções práticas os estudantes aprenderão como obter informação de sequências para sua análise filogenética a partir de bases de dados e a de sítios da Internet, que eles têm de combinar com seus próprios dados para poderem conduzir análises apropriadas. Eles instalarão os sotwares apropriados nos computadores, e constrirão árvores filogenéticas utilizando técnicas diversas. Uma atenção particular do Workshop será dada à interpretação correta dos resultados e à avaliação estatística das diferentes hipóteses evolutivas tais como relógios moleculares, pressão seletiva, recombinação viral e modelos de genética populacional de quasispécies virais. O Workshop acontecerá em dois laboratórios de computadores, onde acontecerão duas sessões simultâneas (uma básica e uma avançada), de tal forma que um computador estará disponível para cada aluno. Tutoriais básicos teóricos e práticos ensinarão os fundamentos da Evolução Molecular, ao passo que nos últimos dias e para a turma avançada, tópicos como o teste de hipóteses evolutivas com técnicas de máxima verssimilhança, a detecção de eventos de recombinação, a utilização de redes para estudar evolução reticulada, e o estudo de dinâmica populacional de quasispécies virais com modelos de máxima verossimilhança baseadas em teoria de coalescência serão ministrados. Cada palestra teórica será seguida por uma seção prática incluindo exercícios e demonstrações dos pacotes de software. O conceito é tal que as interações entre os estudantes e com os intrutores é maximizado para estimular colaborações científicas.

Concorrência: Eventos

População Alvo: Outras populações-alvo

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: APOIO A EVENTOS, SEMINÁRIOS, CAPACITAÇÕES E FORMAÇÕES CIENT.

Produção Científica


Projeto: Infecções recentes para o HIV: Estudo Comparativo
Coordenador: KATIA CRISTINA BASSICHETTO
Resumo: É reconhecido, atualmente, que o monitoramento da epidemia de AIDS na cidade de São Paulo, pautada principalmente pela notificação de casos de AIDS precisa estar associada a identificação precoce da infecção, para que se possa produzir respostas mais eficazes. Para tanto, deve-se seguir as diretrizes que ampliam o conceito de vigilância epidemiológica para a obtenção de um "padrão epidêmico", denominada "Vigilância de Segunda Geração". Trata-se de implementar a busca por dados que caracterizem de forma mais abrangente possível a população vulnerável ao HIV (1). A identificação da presença da infecção pelo HIV tem se dado a partir da demanda espontânea da população quando procura serviços de testagem e aconselhamento (CTA), serviços da rede especializada em DST/AIDS e outros serviços da rede básica que recentemente passaram a desempenhar também esta função, entre outros. Estes serviços constituem assim, importantes fontes de dados, que permitem caracterizar o perfil epidemiológico dos indivíduos infectados, anos antes que preencham os critérios para sua notificação como casos de AIDS. A rede especializada em DST/AIDS da Cidade de São Paulo, já vem funcionando com a proposta de incentivar o conhecimento do status sorológico de grupos populacionais, que normalmente não buscariam estes serviços, aumentando, assim, o número de testes realizados e permitindo a melhor caracterização das pessoas vulneráveis a infecção. Do ponto de vista da coleta, armazenamento e análise de informações, os serviços estão passando por uma fase de transição de um modelo específico de sistema de notificação para AIDS, em ambiente não Windows, não integrados aos demais sistemas, para um modelo em ambiente Windows, integrado as demais doenças de notificação compulsória e flexível, permitindo a vigilância do HIV e de gestantes infectadas pelo HIV e crianças expostas (SINAN W-versão 4.1). A análise de dados de produção tem decorrido de iniciativas individualizadas de alguns 'serviços ficando evidente a necessidade de investir na padronização e definição de periodicidade, permitindo a real utilização destes dados no planejamento das ações e a identificação de tópicos que precisam de melhor elucidação através de pesquisas. O SI-CTA vem ao encontro desta necessidade, possibilitando tanto a vigilância da infecção pelo HIV, quanta a realização de investigações científicas especiais. Nos CTA da Cidade de São Paulo, utilizando-se dados de questionários aplicados no pré e pós-teste, pode-se citar a tentativa de análise integrada de todos estes serviços (2), que poderá facilitada com a utilização do novo sistema em operação (SIC-TA).

Objetivo: Comparar o perfil sócio-comportamental das pessoas soropositivas não recém-infectadas e recém-infectadas.

Metodologia: Quanto à geração de conhecimento científico estes serviços têm sido importantes fontes de dados em pesquisas por possibilitar a caracterização da população soropositiva para o HIV, AA estimativa de prevalência, e de incidência com a utilização da técnica de testagem dupla (detuned). Este conjunto de procedimentos, proposto em 1999, compara resultados do teste Elisa usual (mais sensível) com o teste padrão menos sensível, permitindo identificar indivíduos que adquiriram o vírus num período de ate 129 dias, precedente ao teste (3). A utilização desta técnica tem sido proposta como alternativa aos estudos de coorte, reconhecidamente onerosos e de difícil operacionalização, permitindo estimativa da incidência de HIV, a partir da identificação de casos, com infecção recente, por este vírus. Esta em curso na Secretaria Municipal de Saúde de São Paulo, em parceria com a Universidade Federal de São Paulo, sob coordenação desta última, o projeto de pesquisa que tem como objetivo. principal identificar casos recentes de infecção pelo HIV (4). Este projeto aborda principalmente aspectos clínicos e laboratoriais, havendo necessidade de ampliar o conhecimento sobre as características socio-comportamentais destas pessoas. O estudo será realizado em complementação ao projeto de pesquisa já em andamento: "Avaliação da Resposta Imunológica em Pacientes Recentemente Infectados pelo HIV-I, Identificados pela Técnica Sorológica de Ensaio Imunoenzimático com Estratégia de Testagem Dupla (detuned)", coordenado pelo Dr. Esper Georges Kállas, da Universidade Federal de São Paulo (UNIFESP). Não serão estabelecidas hipóteses, uma vez que o estudo e de natureza, exploratória. O desenho e de corte transversal, onde serão utilizadas informações coletadas a partir de maio/2002 (retrospectivamente) e prospectivamente ate a inclusão de 60 casos, segundo protocolo já em andamento (4). A distinção entre os grupos e feita no momento da identificação dos receminfectados, pela UNIFESP, sendo envolvidas, pela SMS, as mesmas unidades incluídas no estudo em andamento, com possibilidade de ampliação. No estudo já em curso (4), para cada pessoa que busca a testagem nestas unidades e oferecida à possibilidade de participar da referida pesquisa, em caso afirmativo, somente os reagentes e confirmados para HIV são testados pela técnica de detuned (3). E produzida uma listagem que contem estes resultados, a qual será acompanhada dos respectivos questionários para entrada de dados. Serão utilizados dados de questionários padronizados (anexo 1), colhidos de rotina no pré e pós teste, atualmente substituído pelo formulário padronizado (anexo 2), do Sistema de Informação para CTA (SICTA) (5). Compõem o formulário variável: demográficas, sócio-comportamentais, de utilização do serviço, relativas a forma de contaminação, entre outras. Será construído banco de dados em programa informatizado especifico (BPI-DATA) (6) e analisados utilizando programa estatístico apropriado (STATA) (7). Para a comparação dos grupos, considerar-se-á como variável resposta (dicotômica), o tipo de infecção (recente e não recente). Como variáveis explanatórias serão consideradas todas as variáveis que compõem o formulário. Será realizada análise univariada e multivariada. A análise univariada incluirá a verificação de existência de associação das variáveis explanatórias e variável resposta utilizando-se como medida de associação, o odds ratio para variáveis qualitativas e teste de Student (ou equivalente não paramétrico) para variáveis quantitativas e intervalo de confiança de 95%. Será utilizada na analise multivariada, dentro das possibilidades impostas pelo tamanho da amostra, regressão logística não condicional. Potenciais fatores de confundimento a serem incluídos no modelo serão decididos com base nos resultados de outros estudos e nos resultados da análise uni e bivariada. Área de intervenção geográfica: Serão incluídas as seguintes unidades: Serviço de Atendimento Especializado em DST/AIDS (SAE) Campos Elíseos, CTA Pirituba, Centro de Prevenção e Aconselhamento (CPA) Lapa e CTA Henfil (mapa I, Anexo 3). População Alvo: Pessoas que utilizam os serviços de testagem e tem resultado positivo para a sorologia HIV. Avaliação crítica e riscos em relação aos objetivos do projeto: Como este projeto esta vinculado ao projeto anteriormente citado, que identifica os casos recém-infectados para o HIV, se o mesmo for interrompido, inviabilizaria a realização deste. Entretanto já foram identificados ate o presente momento, 29 casos recém infectados, o que já permitiria elaborar um estudo piloto. Considera-se, ainda, pouco provável a interrupção do projeto detuned, uma vez que já ocorreu a aprovação para sua continuidade, com financiamento pela Coordenação Nacional de DST/AIDS (CN DST/AIDS) do Ministério da Saúde (MS) (projeto 001-01-LI-DIPA). Os resultados deste estudo podem contribuir para a aumentar o conhecimento sobre grupos populacionais mais vulneráveis podendo indicar os comportamentos e redes de risco encontradas nestes grupos. Um reflexo adicional se espera na melhoria da qualidade das informações e do sistema de atenção as DST, HIV e AIDS. Os resultados podem o subsidiar o planejamento de ações de controle e prevenção da epidemia. Identificação de variáveis associadas à infecção recente.

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: Determinação dos Valores referenciais das subpopulações de Linfócios T em indivíduos doadores de sangue na Bahia
Coordenador: CARLOS ROBERTO BRITES ALVES
Resumo: Os linfócitos T se subdividem em populações funcionalmente distintas, das quais as mais bem definidas são as células T CD4+ também conhecidas como auxiliares ou "helper" em as células T CD8+, citolíticas ou citotóxicas. As principais funções dos linfócitos T são regular todas as respostas imunes aos antígenos protéicos e servir como células efetoras para a eliminação das micróbios intracelulares. As imunodeficiências de célula T são diagnosticadas pela diminuição ou aumento do número destas células no sangue periférico, baseado no conhecimento da contagem absoluta considerada norma em indivíduos saudáveis, tomando como parâmetro para análise em pacientes que apresentam alterações linfocitárias. A infecção pelo HIV resulta, em última análise no comprometimento da função dos sistemas imunes. A maioria das manifestações de imunodeficiência, incluindo infecções e tumores, é devida a uma carência de células T CD4+. O marco da progressão da doença induzida pelo HIV é a dimunição destas células no sangue periférico de até dez vezes os valores considerados normais, de acordo com padrão norte-americano , na AIDS completamente desenvolvida.

Objetivo: OBJETIVO GERAL: Avaliar distibuição das subpopulações de linfócitos T CD3+, T CD4+ e T CD8+ em adultos saudáveis no município de Salvador. OBJETIVOS ESPECÍFICOS: - Definir valores de referência para linfócitos T CD4+, CD8+ e CD3+ em população adulta de Salvador, Bahia. - Avaliar variação dos valores das subpopulações dos linfócitos T de acordo com dados demográficos e constitucionais.

Metodologia: Tipo de estudo: analítico. Amostra: Voluntários saudáveis doadores de sangue do Hemocentro da Bahia. Serão recrutados num período de 05 meses, com seguimentos de 6 meses, sendo o estudo completado em 11 meses. Critérios de inclusão: - Voluntários saudáveis, maiores de idade, doadores de sangue aprovados pelo Hemocentro do Estado da Bahia. Critérios de exclusão: - Menores de 18 anos de idade; - Indivíduos rejeitados na triagem para doação de sangue pelo HEMOBA. Tamanho da amostra: Serão analisadas 1000 amostras de sangue periférico de doadores de sangue com triagem negativa para as todas as infecções testadas no Hemocentro do Estado da Bahia. Estes pacientes serão doadors de sangue deste Hemocentro, portanto maiores de idade e com massa corpórea superior a 50Kg, sem histórico clínico de infecções pelo vírus da hepatite e da imunodeficiência adquirida. Descrição do procedimento: As amostras serão coletadas em tubos de 4,5 ml contendo anticoagulante EDTA com a prévia autorização do paciente documentado em consentimento informado. Serão analisadas e quantificadas por técnica de citometria de fluxo em 03 parâmetros fluorimétricos com anticorpos monoclonais, utilizando o citômetro FACSCalibur (Becton Kickinson), em software Multiset. Serão coletadas 50 ml de sangue de cada paciente, será marcada com anticopros monoclonais apropriados para análise de leucócitos. Após período de incubação as amostras serão subemetidas à lise das hemácias em 450ml de solução diluída de FACS Lysing 10x concentrada. Após nova incubação as amostras serão adquiridas e analisada em sistema de software Multiset (Becton Dickinson).

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICA

Produção Científica


Projeto: EPIDEMIOLOGIA DA CO-INFECÇÃO PELO HCV EM PORTADORES DO HIV EM PORTO ALEGRE E GENOTIPAGEM DO HCV.
Coordenador: FERNANDO HERZ WOLFF
Resumo: O melhor controle do HIV desde o início do tratamento antirretroviral de alta ação (HAART) vem aumentando significativamente a sobrevida dos pacientes infectados. Dessa forma, doenças crônicas ou de evolução lenta, como a hepatite C, vem se tornando motivo de morbimortalidade significativos em indivíduos co-infectados. No Brasil e no mundo, estudos mostram taxas de co-infecção pelos vírus da AIDS e pelo vírus da hepatite C (HCV) que variam de 18 a 70%, dependendo da área estudada e dos fatores que levaram a contaminação pelo HIV. Mesmo com taxas de resposta inferiores a da população não co-infectada, o tratamento da hepatite C em HIV positivos vem se mostrando eficaz em erradicar o vírus e, assim, impedir a evolução da hepatite crônica para cirrose e carcinoma hepatocelular. A decisão quanto ao tratamento para hepatite C em co-infectados dependerá do status imunológico, do controle do HIV, do grau de hepatopatia presente na biópsia hepática. No planejamento terapêutico, terá também papel fundamental o conhecimento do genótipo do HCV, já que este resultado determinará o tempo (24 ou 48 semanas) e drogas utilizadas (Interferon ou Interferon Peguilado). Sendo assim, o projeto justifica-se por permitir o conhecimento de uma situação altamente prevalente entre os pacientes de HIV/AIDS, capaz de alterar a evolução desses indivíduos e que crescentemente vem sendo diagnosticada. O conhecimento da prevalência de co-infecção, fatores de risco associados à co-infecção e genótipo do HCV poderá permitir o planejamento das ações de saúde pública, tanto em termos de prevenção, quanto de diagnóstico e tratamento.

Objetivo: OBJETIVO GERAL: Verificar a prevalência e genótipo da infecção pelo vírus da hepatite C, definida pela presença de anti-HCV positivo e confirmado por PCR, em uma amostra de indivíduos HIV positivos que procuraram voluntariamente centros de testagens gratuitas para o HIV. OBJETIVOS ESPECÍFICOS: - Descrever a prevalência dos genótipos 1, 2 e 3 do HCV e as características dos portadores; - Descrever a prevalência de co-infecção pelos vírus HIV e HCV e as características demográficas, socioeconômicas e comportamentais associadas à co-infecção pelos vírus HIV e HCV, comparativamente aos infectados apenas pelo HIV.

Metodologia: A Secretaria Estadual da Saúde do Rio Grande do Sul mantém três centros de testagem gratuita para o HIV e aconselhamento, Sanatório Partenon, Serviço de Dermatologia Sanitária e Centro Municipal. No total, há cerca de 270 indivíduos rastreados mensalmente e, em média, 15% dos indivíduos testados tem resultado positivo do anti-HIV. Desenho do estudo: Este estudo consiste em um estudo transversal, onde será descrita a prevalência de co-infecção pelo HCV em pacientes HIV positivos e as características associadas aos genótipos 1,2, e 3. O estudo de associação utilizará um delineamento de casos e controles, aninhado ao estudo anterior. Na avaliação das características associadas à co-infecção, serão considerados casos os pacientes HIV positivos co-infectados pelo HCV, e como controles os pacientes infectados apenas pelo HIV. Os seguintes critérios de elegibilidade serão utilizados: indivíduos com 12 anos ou mais, de ambos os sexos, incluídos no cadastro a partir de 1995, em seguimento no Serviço. Entre estes será selecionada uma amostra aleatória sistemática, priorizando os pacientes cadastrados mais recentemente. População em estudo e cálculo do tamanho da amostra: Atualmente, cerca de 2000 pacientes HIV positivos estão cadastrados e em tratamento no Sanatório Partenon, em Porto Alegre. Neste estudo, serão investigados os pacientes HIV positivos cadastrados a partir de 1996. Os pacientes com infecção peIo vírus C da hepatite terão o diagnóstico confirmado por PCR e serão genotipados. Partindo da estimativa de 2000 pacientes HIV positivos, supondo que 25% sejam HCV positivos, com um erro e +/- 3%, serão necessários 572 participantes para estimativa da prevalência de co-infecção com intervalo de confiança de 95%. Entre os 500 co-infectados (estimando-se 25% do total de 2000), supondo-se que 60% sejam portadores do genótipo 1 do HCV, com um erro de +/- 3%, calculou-se a necessidade de 367 indivíduos para estimativa da prevalência dos genótipos com intervalo de confiança de 95%. Para avaliar as características associadas com a presença de co-infecção será utilizado um estudo de casos e controles, onde além dos 400 pacientes HCV-HIV positivos (casos) será investigada uma amostra de 400 pacientes sem co-infecção pelo HCV. Na falta de dados sobre as exposições, utilizaram-se resultados de um estudo transversal realizado previamente nesta população. Estima-se que a prevalência de exposição ao uso de cocaína injetável, por exemplo, seja de 15 % entre os pacientes sem co-infecção e 25% entre os co-infectados, com um nível de significância de 5% e poder de 80%, serão necessários 540 indivíduos para detectar uma odds ratio de 1,89 como estatisticamente significativa. A fim de manter-se o poder do estudo caso as exposições sejam diferentes das estimadas e para a análise multivariada, serão incluídos 350 casos e 350 controles. atendimento médico necessário para a doença que tenha sido diagnosticada. Sendo também agendado um retorno para seguimento em ate dois meses.

Concorrência: Estratégico

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: Capacitação em Métodos de Pesquisa Clínico - Epidemiologia para profissionais de saúde brasileiros com componentes presencial e à distância
Coordenador: MAURO CUNHA RAMOS
Resumo: Este projeto é uma expansão de projetos bem sucedidos de treinamentos em Métodos de Pesquisa Clínica, realizados inicialmente como cursos de seis semanas no Center for AIDS/Prevention Studies da Universidade da Califórnia, São Francisco. Muitos treinandos brasileiros participaram destes treinamentos, assumindo posições de destaque na pesquisa e na gerência de programas de DST/AIDS em diversos níveis no Brasil. Muitos com os projetos desenvolvidos durante estes treinamentos submetidos a programas de pós-graduação no Brasil foram aprovados e estabeleceram profícua produção científica no país. Muitos ainda ingressaram em programas de pós graduação (J.P.H. e PhD) na Universidade da Califórnia em Berkeley. Entre estes treinandos podemos mencionar Pedro Chequer, Luiz Loures, Nemora Barcelos, Mauro Ramos, Paulo Telles, Telma Gonzáles, Angélica Espinosa, Lílian Lauria, Andréa Sereno, Regina Loureiro, para citar somente alguns. A Coordenação Nacional de DST/AIDS, percebendo a importância desta iniciativa, implementou treinamentos intensivos desta natureza, em um período de duas semanas, inicialmente no Rio de janeiro, em Florianópolis e por duas vezes em Porto Alegre. Desde 2000, o Centro de Estudos de AIDS do Rio Grande do Sul, com o apoio da CNDST/AIDS, participa como colaborador para o desenvolvimento de um programa de treinamento intensivo com duas semanas de duração. Nos três anos iniciais, os treinamentos foram sobre métodos de pesquisa clínica e, nos dois últimos anos, sobre análise de dados e redação científica. Estes treinamentos têm sido extremamente bem sucedidos. Tornou-se disciplina obrigatória do Programa de Pós-Graduação da Fundação Federal Faculdade de Ciências Médicas de Porto Alegre. Como um todo, incluindo alunos do referido programa de pós-graduação e instituições parceiras locais, atingiu mais de 94 profissionais de saúde. Da parte prática, financiada pelo projeto com UCSF, participaram profissionais de saúde de 12 estados brasileiros, gerando 18 projetos de pesquisa, com 12 deles em andamento bob tutoria e supervisão do Dr. Erno Harzheim. Esse projeto é financiado por verba de treinamento do Instituto Nacional de Saúde - Fundação Fogarty, tendo como investigador principal o Dr. George Rutherford e como principal colaborador internacional o Dr. Mauro Cunha Ramos. Conforme avaliação e solicitação da CNDST/AIDS, foi identificada necessidade de descentralização das atividades de treinamento em pesquisa. Identificou-se, ainda, que os treinandos devem ser oriundos de diversas formações e de diversas localidades do país. Existe ainda a possibilidade de, se houver interesse da Coordenação, expandir esta oportunidade de treinamento aos países constantes do programa de cooperação técnica internacional. O projeto será executado por uma colaboração entre o Centro de Estudos de DST/AIDS do Rio Rio Grande do Sul (PUCRS) e o Center for AIDS Prevention Studies (CAPS) da Universidade da califórnia, São Francisco (UCSF).

Objetivo: OBJETIVO GERAL Capacitar profissionais de saúde para o desenvolvimento de projetos de pesquisa de interesse da CNDST/AIDS OBJETIVOS ESPECíFICOS - Formalizar colaboração entre CEARGS, PUCRS, CNDS/AIDS e UCSF, estabelecendo o uso de EAD para este e futuros projetos de treinamento. - Capacitar 16* profissionais de saude e pesquisadores da área de DST/AIDS. - Desenvolver, ao longo do curso, 16 projetos de pesquisa que atendam o interesse e as necessidades de pesquisa da coordenação nacional de DST I AIDS AIDS para o desenvolvimento de projetos de pesquisa. - Prover apoio técnico para implantação e coleta de dados

Metodologia: METODOLOGIA E CONTEUDO PROGRAMATICO DOS TREINAMENTOS Dezenove horas de carga horária com capacitação à distância (5 semanas, duas aulas por semana) 1) Capacitação à distância Conteúdo: Introdução à metodologia do ensino à distância Metodologia: exposição teórica com tutoria disponível Horas: 1h 2) Capacitação à distância Conteúdo: Importância da pesquisa local em DST/AIDS; Prioridades de Pesquisa da CNDST/ADIS Metodologia: Exposição teórica com tutoria disponível Horas: 1h 3) Capacitação à distância Conteúdo: Aspectos éticos de pesquisa envolvendo seres humanos Metodologia: Exposição teórica com tutoria disponível Horas: 2h 4) Capacitação à distância Conteúdo: Epidemiologia das DST/HIV/AIDS no Brasil e no mundo Metodologia: Exposição teórica com tutoria disponível Horas: 1h 5) Capacitação à distância Conteúdo: Escolhendo uma pergunta de pesquisa Metodologia: Exposição teórica com tutoria disponível Horas: 1h 6) Capacitação à distância Conteúdo: Medicina Baseada em evidências. Pesquisa bibliográfica e recursos da Internet Metodologia: Exposição teórica com tutoria disponível Horas: 1h 7) Capacitação à distância Conteúdo: Organização geral do projeto de pesquisa Metodologia: Exposição teórica com tutoria disponível Horas: 1h 8) Capacitação à distância Conteúdo: Mensurações para a pesquisa quantitativa. Vieses de seleção e aferição Metodologia: Exposição teórica com tutoria disponível Horas: 1h 9) Capacitação à distância Conteúdo: Panorama sobre os diferentes delineamentos de pesquisa Metodologia: Exposição teórica com tutoria disponível Horas: 1h 10) Capacitação à distância Conteúdo: Estudos transversais Metodologia: Exposição teórica com tutoria disponível Horas: 1h 11) Capacitação à distância Conteúdo: Estudos de Coorte Metodologia: Exposição teórica com tutoria disponível Horas: 1h 12) Capacitação à distância Conteúdo: Estudos de casos e controles Metodologia: Exposição teórica com tutoria disponível Horas: 1h 13) Capacitação à distância Conteúdo: Experimentos Metodologia: Exposição teórica com tutoria disponível Horas: 1h 14) Capacitação à distância Conteúdo: Populações de estudo e amostragem Metodologia: Exposição teórica com tutoria disponível Horas: 1h 15) Capacitação à distância Conteúdo: Desenvolvimento de instrumentos (questionários) Metodologia: Exposição teórica com tutoria disponível Horas: 1h 16) Capacitação à distância Conteúdo: Controle de qualidade e estudo piloto Metodologia: Exposição teórica com tutoria disponível Horas: 1h 17) Capacitação à distância Conteúdo:Fundamentos da análise de dados e apresentação de resultados Metodologia: Exposição teórica com tutoria disponível Horas: 1h 18) Capacitação à distância Conteúdo: Controle de qualidade: piloto, pré-teste, controle de qualidade, manual de campo e caderno de pesquisa Metodologia: Exposição teórica com tutoria disponível Horas: 1h Quarenta e cinco horas de carga horária com capacitação presencial ( uma semana) 19) Capacitação presencial Conteúdo: Boas vindas, apresentações, objetivos do treinamento Metodologia: Horas: 1h 20) Capacitação presencial Conteúdo: Apresentação dos projetos individuais de pesquisa Metodologia: Exposição pelos treinandos e discussão Horas: 4h 21) Capacitação presencial Conteúdo: Divisão em grupos, discussão das situações individuais, objetivos e perguntas de pesquisa Metodologia: oficina Horas: 1h 22) Capacitação presencial Conteúdo: Orientação para uso dos computadores locais Metodologia: Exposição dialogada Horas: 45 minutos 23) Capacitação presencial Conteúdo: Estabelecimento da versão final pergunta de pesquisa Metodologia: Atividade em pequenos grupos Horas: 1h 24) Capacitação presencial Conteúdo: Otimizando o uso do editor de texto. Programa de gerenciamento bibliográfico. Montando o esqueleto do trabalho. Metodologia: Exposição dialogada. Treinamento prático Horas: 1h 30 minutos 25) Capacitação presencial Conteúdo: Desenvolvendo a introdução para o protocolo Metodologia: Exposição dialogada Horas: 45 minutos 26) Capacitação presencial Conteúdo: Redação da introdução para o protocolo e revisão bibliográfica Metodologia: Tarefa individual Horas: 2h 27) Capacitação presencial Conteúdo: Discussão da justificativa e revisão bibliográfica Metodologia: Discussão em pequeno grupo (revisão pelos pares) Horas: 2h 28) Capacitação presencial Conteúdo: Desenvolvendo a seção de metodologia incluindo população de estudo, critérios e inclusão e exclusão Metodologia: Exposição dialogada Horas: 1h 15 minutos 29) Capacitação presencial Conteúdo: Cálculo de tamanho da Amostra (uso de fórmulas, tabelas e software) Metodologia: Exposição dialogada Horas: 1h 30) Capacitação presencial Conteúdo: Cálculo de amostra situações individuais Metodologia: Exercício individual com tutoria Horas: 2h 31) Capacitação presencial Conteúdo: Mensurações, dados a serem coletados e plano de coleta Metodologia: Exposição dialogada Horas: 1h 32) Capacitação presencial Conteúdo: Redação da seção de metodologia Metodologia: Exposição dialogada Horas: 1h 33) Capacitação presencial Conteúdo: Desenvolvendo instrumentos de coleta de dados (e. g. questionários) Metodologia: Exposição dialogada Horas: 1h 34) Capacitação presencial Conteúdo: Redação do instrumento Metodologia: Atividade individual Horas: 2h 35) Capacitação presencial Conteúdo: Discussão dos questionários Metodologia: Atividade em pequenos grupos Horas: 1h e 30 minutos 36) Capacitação presencial Conteúdo: Elaboração do banco de dados I Metodologia: Exposição dialogada Horas: 45 minutos 37) Capacitação presencial Conteúdo: Elaboração do banco de dados II Metodologia: Trabalho individual com tutoria Horas: 2h 38) Capacitação presencial Conteúdo: Escolhendo testes estatísticos e plano de análise Metodologia: Exposição dialogada Horas: 45 minutos 39) Capacitação presencial Conteúdo: Desenvolvendo um orçamento e cronograma Metodologia: Exposição dialogada Horas: 45 minutos 40) Capacitação presencial Conteúdo: Elaboração do orçamento e cronograma Metodologia: Trabalho individual com tutoria Horas: 1h e 30 minutos 41) Capacitação presencial Conteúdo: Redação da versão final do protocolo Metodologia: Tarefa individual Horas: 2h 42) Capacitação presencial Conteúdo: Revisão pelos pares I Metodologia: Trabalho individual com tutoria Horas: 6h 43) Capacitação presencial Conteúdo: Voltando para casa, pessoas chaves e achando tempo para pesquisa Metodologia: Exposição dialogada Horas: 1h 44) Capacitação presencial Conteúdo: Avaliação da capacitação Metodologia: Plenária Horas: 1h 45) Capacitação presencial Conteúdo: Epiinfo I ou outro programa estatístico (atividade opcional) Metodologia: Treinamento prático Horas: 1h e 30 minutos 46) Capacitação presencial Conteúdo: Epiinfo II ou outro programa estatístico (atividade opcional) Metodologia: Treinamento prático Horas: 1h 47) Capacitação presencial Conteúdo: Epiinfo IIIou outro programa estatístico (atividade opcional) Metodologia: Treinamento prático Horas: 1h

Concorrência: Estratégico

População Alvo: Profissionais de Saúde e Educação

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: CAPACITAÇÃO E FORMAÇÃO EM PESQUISA

Produção Científica


Projeto: Estudo de Sobrevida da AIDS Pediátrica no Brasil - 1999 a 2002
Coordenador: LUIZA HARUNARI MATIDA
Resumo: É de grande importância o conhecimento dos tempos de sobrevivência dos pacientes com AIDS. Além de se prestar para o dimensionamento das necessidades, no que se refere a assistência e ao estabelecimento de políticas públicas, e fundamental para a avaliação das estratégias de intervenção que visam ao prolongamento da vida destes pacientes. O tempo entre o diagnóstico e a morte possui uma distribuição de probabilidades que muda dinamicamente. Vários fatores podem explicar essa mudança nas curvas de probabilidade de morte a partir da data de diagnóstico; parte do decréscimo de risco e devido ao desenvolvimento de novas terapias no tratamento da AIDS, que causam mudanças na curva de sobrevivência. Comparada com a AIDS do adulto, a criança geralmente apresenta uma progressão mais rápida da doença. Em relação a sobrevida, esta vem aumentando nos países desenvolvidos devido principal mente ao aprimoramento de serviços e de meios diagnósticos e Terapêuticos. No Brasil, 0 programa de acesso universal a terapia antiretroviral (ARV), somado a outras iniciativas, tais como: o avanço diagnóstico, o uso mais difundido de quimioprofilaxia para as principais infecções oportunistas e a disponibilização de modalidades alternativas de assistência, possibilita a redução das necessidades e dos custos das internações hospitalares e a redução de infecções oportunistas. Em relação a redução das mortes observou-se, nos últimos anos, uma redução expressiva na mortalidade ocasionada por AIDS. Em 1995, a taxa de mortalidade por AIDS atingiu 12,2 em cada grupo de 100 mil pessoas; em 1999, a taxa havia recuado para 6,3/100 mil, o que representa uma queda de aproximadamente 48,4%. Em grandes centros urbanos como São Paulo e Rio de Janeiro (cidades onde se concentram mais de 33% dos casos conhecidos de AIDS nos pais), a redução na mortalidade foi ainda mais expressiva, sendo de aproximadamente 70% (SP - 54% e RJ - 73%), no período 1995-2000. Após o diagnóstico de AIDS, idade e presença ou ausência de doenças relacionadas com a AIDS são fatores preditores de sobrevivência. Alguns trabalhos apontam para uma mortalidade de 25 a 50% no primeiro ano de vida e 85 a 95%, ate os 5 anos de idade (Grosse, 1993; Bernstein, 1992). Dados recentes da hist6ria natural da infecção perinatal do HIV indicam que a sobrevida media tem aumentado para 6 a 9 anos de idade (Grubman et al., 1995). A letalidade de crianças com AIDS nas pesquisas européias e norte-americanas foi de aproximadamente 5% ate os 15 meses de idade. Entretanto, em Kinshasa, Brazavile e Kigali, a letalidade ate 1 ano de idade foi de 12-39%, dependendo do nível sócio-econômico e do estágio da doença da mãe. As principais causas do óbito destas crianças foram prematuridade, diarréia, pneumonia, AIDS (de acordo com a definição da doença pela OMS) e meningite. Para o Brasil como um todo, Chequer et al. (1992) registraram o tempo mediano de sobrevida de 5,1 meses, entre 2.135 casos notificados no período de 1982 a 1989. Para o Estado de São Paulo, que notifica 47% do total de casos de AIDS no pais, Grangeiro et al. (1995) obtiveram um tempo médio de sobrevida, de 1985 a 1991, de 232 dias, com variação de 201 dias (transmissão materna infantil) a 259 dias (hemofílicos) em 7.480 casos notificados. Na cidade de Nova loque, os óbitos por AIDS, entre os adultos, apresentaram uma redução de 72% entre os anos de 1994 e 1998 (Fordyce EJ et ai, 2002). Um estudo publicado pelo Italian Register for HIV Infection in Children, apresenta 1142 crianças infectadas pelo HIV por transmissão vertical, nascidas entre Novembro de 1980 e Dezembro de 1997 e acompanhadas ate Junho de 1999, e descreve que 421 (36,9%) foram a 6bito com a mediana de 3,3 anos (39,6 meses) de idade (de Martino M et al., 2000). Em 2001, foi publicado o estudo de uma coorte de 1028 crianças e adolescentes infectados pelo HIV, acompanhados desde o nascimento até 20 anos de idade, em clínicas de atendimento dos Estados Unidos, abrangendo casos desde o início da epidemia e seguidos prospectivamente ate dezembro de 1999. Em função do inicio do usa do inibidor da protease na terapia combinada, houve a redução de 67% no risco de morte (Gortmaker SL et al., 2001). Em um estudo de coorte não concorrente (coorte retrospectiva), financiado pelo PN-DST/AIDS do Brasil, Matida e colaboradores observaram a mediana de sobrevida geral de 52,8 meses (IC 95%: 41,9 - 60,8) em 1154 casos notificados de AIDS no período de 1983 a 1998 e com seguimento ambulatorial ate 30/06/2002.

Objetivo: Conhecer o tempo de sobrevida em crianças de 0 a 12 anos de idade, segundo os casos diagnosticados e notificados ao Sistema de Vigilância Epidemiológica do Programa Brasileiro de DST/AIDS no período de 01/01/1999 a 30/12/2002, de acordo com: categoria de transmissão; ano do diagnóstico; sexo; ano do nascimento; idade da criança ao diagnóstico; principais doenças indicativas; terapêutica utilizada e local de atendimento, com o estudo nacional que analisou os casos diagnosticados no período de 1983 a 1998 (Matida et al.). Conhecer o tempo de sobrevida de crianças infectadas pelo HIV, diagnosticadas no período de 01/01/1999 a 30/12/2002, de acordo com: categoria de transmissão, ano do diagnóstico, sexo, ano do nascimento, idade da criança ao diagnóstico, medidas profiláticas adotadas na mãe (no caso de transmissão vertical), intervenções profiláticas utilizadas. Avaliar a sobrevida de acordo com fatores demográficos, epidemiológicos, clínicos e diagnósticos. Avaliar possível impacto dos esquemas de intervenção terapêutica e profilática na sobrevida. Avaliar a possível repercussão do grau de complexidade dos serviços notificantes, na sobrevida dos doentes. Avaliar a sobrevida a partir da data de nascimento, no caso das crianças notificadas como casos de AIDS por transmissão vertical. Avaliar o tempo decorrido entre a data de nascimento e a data de diagnóstico de AIDS, no caso das crianças notificadas como casos de AIDS por transmissão vertical. Avaliar o tempo de sobrevida das crianças infectadas pelo HIV, identificadas nos serviços selecionados. Revisar e avaliar comparativamente: as datas de nascimento, de diagnóstico, de óbito notificados no Banco de Dados Nacional de AIDS - SINAN com as mesmas datas coletadas nos prontuários hospitalares/ambulatoriais. Avaliar o tempo de sobrevida das crianças observadas como vivas no estudo de sobrevida anterior (casos diagnosticados entre janeiro de 1987 a dezembro de 1998).

Metodologia: No corpo do subprojetos menciona: Plano amostral em anexo. Mas, não foi encontrado o Plano Amostral junto à documentação.

Concorrência: Estratégico

População Alvo: Crianças e Adolescentes vivendo/portadoras do HIV

Natureza: ESTUDOS E PESQUISAS

Subnatureza: EPIDEMIOLÓGICA

Produção Científica


Projeto: AIDS E CONTROLE SOCIAL. UM ESTUDO SOBRE REPRESENTAÇÃO E PARTICIPAÇÃO DE MOVIMENTOS SOCIAIS DE LUTA CONTRA A AIDS EM INSTÂNCIAS DE CONTROLE SOCIAL DO SISTEMA ÚNICO DE SAÚDE
Coordenador: AMELIA COHN
Resumo: Uma das características da resposta brasileira no enfrentamento da epidemia de Aids é a forte presença da sociedade civil, de Organizações Não Governamentais (ONGs) e de portadores de HIV-Aids na definição e na execução das políticas públicas. Existem hoje mais de 400 ONGs envolvidas com a questão da Aids. Elas compõem uma rede heterogênea e complexa, dos mais variados perfis e campos de atuação: executam projetos financiados pelo poder público ou por outras entidades nacionais ou internacionais; trabalham na prevenção dirigida a populações vulneráveis e na assistência nas casas de apoio; ou atuam em outras questões relacionadas à saúde e aos direitos humanos. Somam-se, assim, à rede de soropositivos, movimentos de minorias e associações comunitárias e religiosas. Além da organização na luta contra a Aids propriamente dita - atualmente há fóruns estaduais de ONGs, Articulação Nacional de Fóruns, Encontro Nacional de ONGs (ENONG), Rede Nacional de Pessoas Vivendo com HIV e Aids (RNP) -, os movimentos priorizaram, ao longo do tempo, a participação em instâncias específicas - geralmente consultivas - de acompanhamento das políticas de HIV e Aids, a exemplo das Comissões ligadas aos Programas de Aids das Secretarias de Saúde e do Ministério da Saúde. Em seguida veio a necessidade de maior integração entre as políticas voltadas ao HIV e Aids e o Sistema Único de Saúde (SUS), o que levou ao aumento da participação dos movimentos de luta contra a Aids nas instâncias formais de controle social do SUS, especialmente nos conselhos de saúde dos três níveis de governo. Considerando-se o caráter permanente, deliberativo e consultivo dos conselhos de saúde - uma forma de controle público do sistema de saúde, previsto na Constituição de 1988 e regulamentado no Brasil pela Lei 8.142, de 1990 - que visam "examinar e aprovar as diretrizes da política de saúde", podendo também "aperfeiçoá-las, propor meios aptos para sua execução ou mesmo indicar correção de rumos" (Brasil, 2003), chama-se a atenção para o caráter particular da integração de Organizações Não Governamentais de luta contra a Aids (ONGs/Aids) nesses conselhos. Constituídos a partir de interesses de grupos sociais específicos - portadores de HIV-Aids e homossexuais, dentre outros - esses movimentos passaram a definir diretrizes para as políticas de saúde, voltadas para prevenção e enfrentamento da doença. A transição de uma prática política autônoma e descentralizada, segundo interesses específicos, para uma possível conjunção de interesses nos conselhos, visando à elaboração de diretrizes de políticas de saúde, aponta para algumas questões a serem analisadas da perspectiva do controle social, tendo em vista a relação estabelecida entre esses movimentos sociais e o Estado: poder de pressão, formas de negociação, legitimidade e dilemas enfrentados. Vários estudos sobre movimentos sociais, realizados nas décadas de 70 e 80, visavam compreender o papel desses movimentos na sociedade, uma vez que, ao proporem novas formas de luta e resistência, eles acabavam por estabelecer também novas formas de política através da ampliação de espaços tradicionais de representação (Laclau, 1986; Sader, 1988). Especificamente na área da saúde, vários autores analisaram movimentos sociais emergentes, que tinham na saúde sua principal reivindicação. De acordo com essas análises, a partir de respostas e ações adotadas pelo Estado frente às expectativas e demandas da população, esses movimentos acabaram por redefinir a noção de direitos sociais e cidadania (Jacobi, 1989; Costa et al., 1989; Cohn et al., 1991). Para esses autores, o grande desafio consistia em pensar a relação entre Estado e movimentos sociais num plano que integrasse o quadro estrutural, o universo institucional e as práticas e representações dos movimentos sociais. A principal questão a ser estudada era a contradição entre demandas populares e capacidade de resposta do Estado, caracterizada como uma "crise de legitimação", segundo Habermas (1980) apud Jacobi (1989, p. 7). Tratava-se de entender a relação estabelecida entre a lógica de intervenção estatal e a dinâmica dos movimentos e agentes envolvidos - tarefas e exigências estas dificilmente conciliáveis -, que colocava em risco a própria legitimidade atribuída pela população ao Estado quanto à sua capacidade de respeitar e promover direitos (Durham, 1984). Com relação à participação de ONGs e de movimentos sociais de luta contra a Aids em instâncias de controle social do SUS, a questão da legitimidade não se restringe à esfera estatal, mas diz respeito também à própria afirmação do perfil dessas organizações e à manutenção de sua orientação política e social na luta por seus direitos. Trata-se, neste caso, de compreender como se sustenta a legitimidade dessas organizações, mantendo interesses e demandas específicas dos grupos que representam nesses espaços de negociação política, que são os conselhos de saúde. Se nos estudos sobre movimentos sociais ressaltava-se que as formas de mobilização ocorriam fora dos espaços tradicionais de representação e na especificidade de suas demandas, segundo Jacobi (1989), no caso das ONGs/Aids busca-se compreender a manutenção da especificidade das demandas dentro de espaços de representação tradicionais, tais como os conselhos de saúde, que são regulamentados pelo Estado. Baseada em estudos sobre movimentos sociais, a questão que aqui se apresenta refere-se à necessidade de analisar o caráter transformador desses movimentos - que configuram formas específicas, autônomas e legítimas de representação social e política - da perspectiva dos direitos sociais, da cidadania e do controle social exercido nos conselhos de saúde. Contribui para essa análise o fato de que - devido aos interesses envolvidos - o setor saúde tem se destacado, ao longo dos anos, pela politização e forte presença de grupos de pressão. E, nesse sentido, a relação que se estabelece entre Estado e movimentos sociais é movida menos pela presença de setores populares identificados como carentes nas políticas sociais do que por sua atuação enquanto "partícipes da cidadania" (Cohn et al., 1991, pp. 7-10). Por serem pouco conhecidas, as questões e os dilemas apontados quanto à atuação e participação das ONGs/Aids nos conselhos de saúde exigem um estudo mais aprofundado tanto sobre as formas de participação e de representação dessas entidades nos conselhos de saúde, como sobre os diferentes perfis de sua orientação política e social. Ressalte-se que não foram encontrados estudos específicos sobre a atuação de ONGs/Aids em conselhos de saúde; no entanto, existem análises sobre as formas de participação desses movimentos, suas contradições e possibilidades de intervenção política como grupos de pressão (Silva, 1998; Galvão, 1998; Scheffer, 2000, Scheffer, 2003). Da perspectiva da análise proposta, cabe ressaltar portanto a importância de se abordar a legitimidade da participação e a pressão exercida por representantes de ONGs/Aids junto aos conselhos de saúde na proposição de diretrizes para as políticas de saúde, identificando-se o lugar que eles ocupam nas decisões políticas, ao mesmo tempo em que constituem e consolidam esses conselhos como espaços legítimos de representação. A atuação de ONGs/Aids nos conselhos de saúde tem garantido a participação popular e o controle social na elaboração e execução de políticas de saúde específicas. Entretanto, questiona-se a capacidade de pressão desses movimentos e sua legitimidade na defesa de interesses específicos. Acredita-se que certas fragilidades e dificuldades possam surgir no exercício do controle social quando esses movimentos passam a apresentar demandas dentro de espaços de representação tradicionais, em especial aqueles regulamentados pelo Estado. Esta pesquisa poderá contribuir para aprofundar a compreensão sobre formas de controle social do SUS e de mecanismos de participação e de pressão social exercidos por grupos específicos de usuários. Ao qualificar a representação de grupos específicos - ONGs/Aids - nos conselhos de saúde, a pesquisa permitirá identificar os pontos frágeis apresentados por essas ONGs no exercício do controle social e as principais dificuldades enfrentadas em sua relação com o governo. Ao mesmo tempo, ela poderá contribuir para apontar recomendações que, se aceitas, podem vir a reforçar e viabilizar o controle social das políticas públicas de HIV e Aids e de saúde em geral.

Objetivo: OBJETIVO GERAL: Analisar a atuação de representantes de Organizações Não Governamentais e de movimentos sociais de luta contra a Aids nos conselhos de saúde, em termos de suas reivindicações e capacidade propositiva, com vistas a mapear os resultados efetivamente alcançados por essas entidades na definição da política de Aids, da perspectiva da afirmação de sua legitimidade e do exercício do controle social. OBJETIVOS ESPECÍFICOS: - Descrever o perfil de ONGs e de movimentos de luta contra Aids atuantes em conselhos de saúde dos três níveis de governo, em termos de sua constituição e de sua proposta de atuação política; - Identificar mecanismos de escolha e de legitimação dos representantes para atuar nos conselhos de saúde, as formas de encaminhamento das questões de interesse de suas entidades tanto no âmbito interno quanto nos conselhos, e os mecanismos formais e informais de interação desses representantes com os seus representados; - Verificar de que maneira diferentes formas de financiamento das ONGs/Aids (financiamento público ou de ONGs nacionais ou internacionais) interferem na atuação dos seus representantes junto aos conselhos de saúde; - Verificar se, e em que grau, os resultados obtidos pelo controle social estão em consonância com os interesses dos representados.

Metodologia: A seleção de outros conselhos municipais de saúde no estado de São Paulo que poderão compor a amostra desta pesquisa será definida com base nos seguintes critérios: 1) levantamento, junto aos Fóruns de ONGs, de quais são os espaços ocupados por seus representantes em conselhos, no momento inicial da pesquisa; 2) cruzamento deste levantamento com dados epidemiológicos que revelam os locais de maior concentração da epidemia. A base de dados será o Boletim Epidemiológico do Ministério da Saúde, ano XVII, nº 01 a 52; Semanas Epidemiológicas, janeiro a dezembro de 2003, especialmente a TABELA XIII - Municípios brasileiros com maior número de casos de Aids notificados, segundo ano de diagnóstico, Brasil, 1980-2003. Quanto ao perfil de entidades e de representantes de ONGs/Aids atuantes nos conselhos, os dados necessários para seu levantamento serão colhidos junto ao Fórum de ONGs/Aids, ao Setor de Articulação com a Sociedade Civil do Programa Nacional de DST/Aids e, eventualmente, junto aos próprios Conselhos de Saúde. Também serão aplicados questionários estruturados, com questões fechadas, a todos os representantes de ONGs/Aids. A atuação desses representantes será analisada através das atas das reuniões dos conselhos e de entrevistas em profundidade, com roteiro semi-estruturado, a serem realizadas com membros das entidades representadas, suas principais lideranças e outros informantes-chave identificados. Também deverão ser realizados acompanhamentos e observações sistemáticas de reuniões dos conselhos - no mínimo uma reunião mensal durante seis meses, para cada instância analisada. A análise dos questionários sobre o perfil dos representantes será realizada através de programa estatístico apropriado. As informações obtidas nas entrevistas, complementadas pelas observações e exame das atas de reuniões dos conselhos, serão analisadas da perspectiva da atuação dos representantes nos conselhos. Os depoimentos serão fragmentados em categorias fundamentais, a fim de se estabelecer relações de complementaridade, de oposição ou de contradição entre elas. A compreensão desses vários níveis de relações entre as categorias permitirá elaborar um quadro analítico que pode vir a revelar a dinâmica social e política da atuação dos representantes de ONGs/Aids nos conselhos. Os depoimentos e as observações permitirão reconhecer quem fala, de onde fala e, sobretudo, o quê se fala, podendo portanto revelar formas de pressão e de legitimação de interesses específicos.

Concorrência: Chamada de Pesquisa - 2004

População Alvo: População em Geral

Natureza: ESTUDOS E PESQUISAS

Subnatureza: SOCIAL

Produção Científica


Projeto: INVESTIGAÇÃO DA SÍFILIS CONGÊNITA E AVALIAÇÃO DA QUALIDADE DO ATENDIMENTO MATERNO-INFANTIL: UMA PROPOSTA DE INTERVENÇÃO.
Coordenador: MARIA RITA DE CAMARGO DONALISIO
Resumo: A sífilis congênita é uma doença perfeitamente prevenível com agente etiológico, modo de transmissão conhecidos e terapêutica efetiva. Não se justifica deixar de diagnosticar e tratar precocemente crianças e gestantes que transitam pelos serviços de saúde na região. Identificou-se aumento das notificações de sífilis congênita no serviço de neonatologia do Hospital Estadual de Sumaré a partir do 2o semestre de 2003 até novembro de 2004. A investigação das fichas de notificação e prontuários médicos mostrou grande freqüência em gestantes maiores de 30 anos (45,5%), a maioria 18 (81,8%) residentes no município de Sumaré. Dos 22 casos notificados 86,4% referem ter realizado pré-natal, sendo que 77% tinham pelo menos um exame sorológico pedido no decorrer do pré-natal. Constatou-se a precariedade das informações sobre o tratamento anterior da mãe e somente 1 registro de tratamento do companheiro. Os escassos dados coletados indicavam a necessidade de uma investigação mais aprofundada sobre a situação epidemiológica das sífilis congênita, bem como de outras DST na rede básica de Sumaré, e de outros municípios da micro-região. A equipe do Núcleo de Saúde Pública do hospital, o serviço de neonatologia, obstetrícia, laboratório, em conjunto com a Vigilância Epidemiológica do município de Sumaré iniciaram investigação epidemiológica dos registros e prontuários. Um diagnóstico mais preciso com informações da rede básica e de outros hospitais da micro-região poderá direcionar e racionalizar a intervenção. Ressalta-se o papel do hospital como instituição estratégica na identificação de eventos de saúde indesejáveis/inaceitáveis/preveníveis, os quais podem refletir problemas na assistência e prevenção de agravos em outras instâncias de atendimento. A revisão do fluxo de pacientes e de informações nas diversas etapas do atendimento pode facilitar a identificação de pontos vulneráveis do sistema de saúde para direcionar investimentos e monitoramento mais próximo. Indicadores epidemiológicos e de qualidade de serviços poderão identificar de forma sistemática e contínua grupos de maior risco de transmissão da sífilis congênita e de outros agravos do período perinatal. Será realizado estudo retrospectivo descritivo do perfil epidemiológico da sífilis congênita nos 5 municípios da micro-região de Sumaré SP. Serão revistos prontuários, fichas epidemiológicas e realizadas visitas domiciliares para coleta das informações não disponíveis. Dados sobre os serviços da micro-região, fluxos habituais de pacientes, coberturas e produção dos programas, além de infra-estrutura e equipamentos disponíveis serão mapeados. Serão realizadas oficinas de trabalho utilizando-se técnicas do planejamento estratégico e situacional para avaliação dos serviços e identificação de pontos para intervenção. Também serão organizadas reuniões técnicas para revisão dos protocolos e das rotinas do pré-natal, assistência ao parto e à criança e do sistema de vigilância epidemiológica, tendo-se como foco a transmissão perinatal do Treponema pallidum. Farão parte destas oficinas, técnicos e profissionais estratégicos dos serviços ambulatoriais e hospitalares envolvidos na assistência obstétrica, pediátrica e da vigilância epidemiológica da região. As equipes médicas e de enfermagem da rede básica de serviços de cada um dos 5 municípios serão treinadas nestes tópicos mencionados. A infecção pelo Treponema pallidum será analisada como uma "situação traçadora" que procura identificar pontos frágeis do atendimento e encaminhamento dos pacientes. Também serão montados indicadores para monitoramento do sistema quanto à infecção para sífilis congênita, segundo algumas categorias de análise: integralidade do atendimento à gestante, abordagem familiar na assistência, retaguarda laboratorial, papel da vigilância epidemiológica, agilidade do fluxo de informações para garantir o seguimento dos pacientes e a intervenção oportuna. A identificação de pontos vulneráveis do sistema irá direcionar as intervenções, particularmente centradas em treinamentos e reciclagens aos profissionais de saúde, mas também na reorganização do sistema para agilizar e dar qualidade ao atendimento.

Objetivo: OBJETIVO GERAL: Identificar pontos vulneráveis do programa de pré-natal, assistência ao parto, puerpério e atenção à criança relacionados com a incidência de sífilis congênita na micro-região. Propõe-se organizar uma agenda de intervenção na qualidade da tenção obstétrica e pediátrica, particularmente para interferir na transmissão da sífilis congênita, porém certamente esta intervenção terá reflexos no controle de outras infecções perinatais, como pelo HIV, infecção pelo Estreptococo do grupo B entre outras, além de detecção e intervenção precoce de situações de risco obstétrico. A intervenção será centrada em treinamento das equipes de saúde da rede básica e hospitalar dos 5 municípios da região.

Metodologia: Será realizado estudo retrospectivo descritivo do perfil epidemiológico da sífilis congênita nos 5 municípios da micro-região de Sumaré SP. Serão revistos prontuários, fichas epidemiológicas e realizadas visitas domiciliares para coleta das informações não disponíveis. Dados sobre os serviços da micro-região, fluxos habituais de pacientes, coberturas e produção dos programas, além de infra-estrutura e equipamentos disponíveis serão mapeados. Serão realizadas oficinas de trabalho utilizando-se técnicas do planejamento estratégico e situacional para avaliação dos serviços e identificação de pontos para intervenção. Também serão organizadas reuniões técnicas para revisão dos protocolos e das rotinas do pré-natal, assistência ao parto e à criança e do sistema de vigilância epidemiológica, tendo-se como foco a transmissão perinatal do Treponema pallidum. Farão parte destas oficinas, técnicos e profissionais estratégicos dos serviços ambulatoriais e hospitalares envolvidos na assistência obstétrica, pediátrica e da vigilância epidemiológica da região. As equipes médicas e de enfermagem da rede básica de serviços de cada um dos 5 municípios serão treinadas nestes tópicos mencionados. A infecção pelo Treponema pallidum será analisada como uma "situação traçadora" que procura identificar pontos frágeis do atendimento e encaminhamento dos pacientes. Também serão montados indicadores para monitoramento do sistema quanto à infecção para sífilis congênita, segundo algumas categorias de análise: integralidade do atendimento à gestante, abordagem familiar na assistência, retaguarda laboratorial, papel da vigilância epidemiológica, agilidade do fluxo de informações para garantir o seguimento dos pacientes e a intervenção oportuna. A identificação de pontos vulneráveis do sistema irá direcionar as intervenções, particularmente centradas em treinamentos e reciclagens aos profissionais de saúde, mas também na reorganização do sistema para agilizar e dar qualidade ao atendimento.

Concorrência: Chamada de Pesquisa - 2004

População Alvo: Mulher - Criança (TV)

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: RISCO EXPONENCIAL, 'LACUNAS' DA SEGURIDADE SOCIAL BRASILEIRA E HIV/AIDS
Coordenador: KENNETH ROCHEL DE CAMARGO JR.
Resumo: Segundo estimativas do PN/DST/AIDS, a partir da oferta de políticas combinadas (prevenção, assistência e tratamento) o número de óbitos no país reduziu drasticamente, a epidemia diminuiu sua velocidade de crescimento e a incidência da doença caiu 46% de 1998 para 2002 . Uma constatação que coincide com a decisão política do "(...) início da utilização da terapia anti-retroviral no país". (UNAIDS, 1996) . Hoje, mais de 130.000 pessoas têm acesso aos ARV. Entre 1996 e 2002, a política implantada evitou mais de 60.000 casos de hiv/aids; 90.000 mortes e 358.000 internações hospitalares. O gasto nacional com ARV, se comparado com a redução dos gastos em saúde, auxiliou o Estado a poupar US$ 200 milhões no período de quatro anos. Em 2000, o país contabilizou a prevalência de 0,6%, contra uma estimativa do Banco Mundial de 1,2% . Os resultados positivos alcançados pelo Programa Nacional de Dst e Aids é resultado de várias especificidades, dentre as quais destacam-se: sua estratégia combinada de ações de prevenção assistência e tratamento em saúde; a previsão administrativa da descentralização da resposta e, finalmente, a existência de uma rede assistencial de unidades e serviços de saúde. Apesar desta epidemia ser dotada de um potencial reorganizador do sistema nacional de saúde e capacitada a estabelecer novos parâmetros e tendências na elaboração de respostas públicas, estes não podem ainda, em diversas regiões do país e/ou em determinadas situações específicas, ser considerados plenamente adequados para responder ao impacto gerado pelo hiv/aids. Isto porque as modificações no padrão epidemiológico da população mais afetada pela epidemia - usualmente traduzidas pelas expressões feminização, interiorização e pauperização indicam a necessidade de ampliação do leque de medidas e a incorporação da lógica social aos processos de planejamento, avaliação e controle das ações na esfera pública, governamental ou Não-governamental. A incorporação da lógica social para compreender o comportamento das doenças ou da situação saúde - ou em outras palavras, a inter-relação das doenças com as condições de reprodução social e material --, vem sendo discutida, de forma mais sistemática, pela epidemiologia social desde a segunda metade do século XIX com o advento da revolução industrial (Silva e Barros, 2002). Naquele momento, profundas mudanças societárias afloraram nas grandes cidades, o loccus da modernização, e impuseram a necessidade de entender e dirimir as desigualdades sociais com dois objetivos básicos: o primeiro, de garantir as condições sanitárias mínimas da classe trabalhadora (e por conseguinte, da produção) e, em segundo lugar, mas não em importância, promover medidas para redução dos conflitos entre classes. Desde então, diversos modelos de estudo e variados indicadores sociais tem sido utilizados, estudados e/ou criados numa tentativa de compreender o papel e em qual intensidade as condições sociais e produtivas inferem no padrão de comportamento das doenças (Barata, 1997; Silva e Barros, 2002). Estes estudos não se esgotaram ainda e já se questiona se os usuais indicadores sociais, coletados em média a cada década, são realmente capazes de apreender as transformações das condições de reprodução material e social imediatas -- devido à velocidade das transformações societárias, típica da pós-modernidade --, e se estes mesmos indicadores podem acompanhar a evolução tecnológica da medicina, que modifica (e é modificada) pelos novos padrões de morbimortalidade e pelo perfil demográfico.(Laurell,1997; Goldbaum, 1997). Além disso, a crescente desigualdade e empobrecimento dos grupos sociais de menor renda e poder tem ocasionado a superposição de: iniqüidade social, riscos e agravos à saúde (Bastos e Szwarcwald, 2000; Carmo, Barreto e Silva, 2002). Este recente fenômeno tem capacidade de potencializar os efeitos destes mesmos riscos, agravos e iniqüidades e/ou favorece a vulnerabilidade/ suscetibilidade a outros riscos. A ocorrência de superposições de diferenciadas formas de exclusão, na qual existe uma probabilidade maior de ocorrência de agravo das condições de vida e de saúde, denominamos, em estudo anterior, de risco exponencial . É por estes fatores que a transição epidemiológica do hiv/aids e a evolução técnico-científica que a acompanha, ao ser associada aos novos determinantes sociais, infere a premência de revermos se a resposta brasileira à epidemia está informada para o reconhecimento e o adequado enfrentamento das necessidades de seus destinatários. Este projeto considera que é fundamental dispor de informações mais abrangentes sobre a reprodução social e material das pessoas vivendo e afetadas pelo Hiv/ aids (pvaha) para a formulação, implementação e avaliação de políticas sociais para o enfrentamento da iniqüidade social e dos novos riscos. Os dados sociodemográficos sobre as pessoas soropositivas, disponibilizados pelo DATASUS e divulgados amplamente pelo Programa Nacional (PN/DST e AIDS) se restringem à faixa etária, sexo e escolaridade. Outros dados disponíveis sobre a epidemia, encontrados nos Sistemas de Informações em Saúde (SIS), referem-se aos seus aspectos epidemiológicos, a orientação e ao comportamento sexual da população e/ou de controle dos custos e dos serviços providos pela assistência em saúde. Tal insuficiência e/ou dificuldade de acesso aos dados vem inviabilizando a decomposição e o entendimento das epidemias de AIDS no Brasil, (Cohn, 1997) bem como, podem minimizando a potencialidade de respostas locais específicas por insuficiência de informação (Couto, 2002). A apreensão mais detalhada das condições de vida e de saúde das pessoas vivendo e/ou afetadas pelo hiv/aids (pvaha) podem ser mais bem observados a partir de surveys de base na comunidade, que dêem especial atenção à abordagem dos grupos excluídos (Parker e Camargo Jr., 2000) Além disto, tais ensaios podem fornecer rico material de análise e avaliação do alcance das políticas públicas existentes, para as pessoas que vivem abaixo da linha de pobreza (Couto, 2002). Hoje a epidemia de hiv/aids se configura enquanto desafio ao desenvolvimento das nações e por isso, tornou-se imprescindível (re) conhecer como os novos determinantes sociais - impostos pela reestruturação produtiva (o mundo e a forma do trabalho) (o mundo e a forma do trabalho) e pela transformação na proteção social --, interagem e agem sobre ela (idem). Assim como, é preciso identificar qual o nível de acesso das PVHA aos serviços, direitos sociais e informações específicas. Por mais perverso que o raciocínio a seguir possa parecer, no passado os efeitos da epidemia para os países em desenvolvimento eram considerados como equivalentes a eventos isolados de um processo econômico que as economias nacionais poderiam absorver, escapando do controle dos planejadores. Acreditava-se que a prevalência da epidemia em 10% da população de um país em desenvolvimento significaria 0,5% de redução no crescimento econômico/ano. Pensava-se, então, que o Produto interno Bruto (PIB) per capita aumentaria se a diminuição do PIB fosse menor que a diminuição da população . Mas o que se constatou mais tarde foi que os efeitos da epidemia de AIDS se estenderão por gerações, em longo prazo e em escala mundial. Isto significa que a morte prematura reduz os incentivos para investir no futuro. E que uma resposta insuficiente à epidemia, mesmo em países com baixa prevalência, equivale a maior possibilidade de favorecer: a destruição dos sistemas educativos e das demais instituições; a perda de capital humano e da capacidade de transmiti-lo; ao aumento do índice de empobrecimento geral; a redução do poder de consumo; a diminuição do ingresso e elevação do absenteísmo no trabalho; a elevação dos gastos com provisão Pública e/ou Privada; a quebra da cadeia geracional (sobrecarga do grupo familiar e das instituições da sociedade). Por outro lado, fornecer a medicação e ofertar tratamento é uma ação combinada capaz de: retardar (ou evitar) infecções oportunistas; diminuir o número de óbitos; viabilizar a capacidade para o trabalho; reduzir gastos públicos e/ou privados com seguros e serviços e preservar capital humano e social. Mas há um outro exemplo da possibilidade de ocorrência de exponenciamento de risco, que talvez seja o que mais interessa abordar neste estudo, a interrupção do curso de uma medida protetiva, ou em outras palavras, quando o acesso aos serviços e aos insumos de saúde necessários para a prevenção, assistência e tratamento, não são suficientes para o enfrentamento da interseção pobreza, aids e exclusão. A prática cotidiana das instituições tem evidenciado a existência de lacunas entre as ações das políticas da seguridade social, e a interrupção do curso de uma medida de proteção social, em determinadas situações, pode propiciar o agravo das condições de vida e de saúde e, mais que isso, tem potencial para minimizar os efeitos benéficos de uma política bem sucedida, como é o caso da resposta pública ao hiv/aids (Couto, 2002). As políticas sociais têm como objetivo compensar eventuais necessidades e riscos dos cidadãos quando estes não conseguem resolvê-los por suas próprias habilidades individuais e/ou recursos. No entanto, a fragilidade político-institucional, a redução progressiva dos recursos disponíveis e o caráter residual das ações destas mesmas políticas, as tem condenado a assegurar um patamar mínimo de reprodução social para atenuação dos efeitos devastadores da crescente desigualdade e exclusão. Em outras palavras, o que se vê hoje é a efetivação de medidas e ações de alcance reduzido que estão inviabilizando, a consolidação da seguridade social brasileira conformada em 1988, e, conseqüentemente, a garantia dos direitos sociais. A potencialidade da resposta governamental brasileira ao hiv/aids, configurada pela combinação da universalidade e a equidade prevista no Sistema Único de Saúde, pode estar sendo minimizada em razão da existência destas "lacunas" durante o curso das medidas e ações de proteção e recuperação atualmente ofertadas pelas políticas e ações da assistência e previdência social. A identificação das diferentes formas de exclusão e a probabilidade de exponenciamento de risco se fará a partir do estudo socioeconômico e demográfico e do levantamento da rede de proteção social disponível (que foi acionada ou não) para responder aos riscos e agravos sociais e de saúde no momento em que estes se configuraram enquanto demandas concretas. A comparação com a rede social de apoio que estava disponível e que foi, ou não, acionada no momento em que estes riscos se configuraram, numa tentativa de responder se estes recursos foram ou não acionados e se conseguiram ou não responder às demandas colocadas. Neste sentido, caminha-se aqui numa tentativa de contribuir para a sistematização de reflexões preliminares sobre a importância da produção de indicadores que favoreçam tanto a elaboração e a avaliação das políticas públicas em hiv/aids, quanto à tomada de decisões neste campo. Ao mesmo tempo, procura-se demonstrar que a integralidade da atenção em hiv/aids exige respostas públicas governamentais que ultrapassem os muros da saúde, ou seja, respostas que tragam ações conjuntas da seguridade social, incluindo a assistência e a previdência, para enfrentar a epidemia. Tendo em vista a complexidade das questões sociais contemporâneas que têm gerado crescente empobrecimento, desigualdade e exclusão as transformações na seguridade social brasileira, no modo de produção e acumulação -- seus rebatimentos no mundo do trabalho, mais especificamente, nas perdas de direitos sociais -- serão abordadas com o intuito de reforçar o caráter progressivo da perda de direitos, do nível de empobrecimento e do surgimento de novos riscos e agravos nas condições de vida e de saúde da população-alvo deste estudo. A partir da realização de entrevistas tendo como norteador um questionário construído para este fim (em anexo), se pretende desvendar quais as conseqüências (diretas e indiretas) da interseção exclusão e aids, seus rebatimentos na qualidade de vida e de saúde das pessoas afetadas. Este estudo ora proposto resulta de outros anteriores, o primeiro foi o estudo preliminar do perfil dos usuários soropositivos entrevistados e/ou que estavam em acompanhamento pelo Programa de Atenção Integral do Serviço Social do Hospital Universitário Pedro Ernesto da Universidade do Estado do Rio de Janeiro. O segundo consistiu na abordagem teórica sobre o mesmo tema do primeiro sob a ótica das transformações do mundo do trabalho e da proteção sócia, para atender às exigências da conclusão do curso de mestrado. (Couto, 1998 e 2002). No primeiro estudo, foram analisadas 253 entrevistas realizadas no intervalo temporal de 1995 a 1998 (inclusive). Posteriormente, após a tabulação dos dados encontrados estes foram comparados com dados equivalentes e disponíveis da PNAD/IBGE (estado do Rio de Janeiro e Brasil) e com aqueles disponíveis e coincidentes sobre a epidemia de hiv/aids, consolidados pelo DATASUS. A pesquisa se deu a partir da análise das seguintes variáveis: sexo, intervalo etário, nível de escolaridade; uniões civis, não-civis e/ou do mesmo sexo; situação trabalhista; vínculo previdenciário e moradia (própria, alugada ou cedida). Resultados encontrados no primeiro estudo: Ao se observar as uniões civis, não-civis e/ou do mesmo sexo, verifica-se entre os usuários a predominância de homens solteiros (49,4%) e de mulheres casadas (36%). Esta variável não é contemplada pela PNAD, que classificou "a condição das pessoas na família", em relação à pessoa de referência ou ao seu cônjuge , não definindo exatamente o número de mulheres e homens casados ou solteiros. O Ministério da Saúde também desconsidera tal questão, não havendo índices a esse respeito. Alheia às relações formais e informais de trabalho, a PNAD considera somente se as pessoas - independentemente do gênero - estão ocupadas ou desocupadas . Em virtude disso, no Brasil estimou-se que 65,46% dos homens e 90,41% das mulheres possuem ocupação e no Rio de Janeiro, 52,68% dos homens e 68,66% das mulheres, estariam desocupados. Com interesses diversos da PNAD, o PAIS procurou aferir indícios do patamar de proteção social em que a ocupação implica. Assim, procurou-se identificar se o usuário encontrava-se empregado ou desempregado no momento em que se deu a realização da entrevista, observando se sua inserção no mercado era formal ou informal (a partir do registro de contrato na Carteira de Trabalho e Previdência Social - CTPS). A partir destes critérios, observou-se que 58,8% dos homens atendidos no ambulatório estavam trabalhando, 35,30% deles formalmente, 15,90% informalmente e 7,6% sem informação. As mulheres que exerciam atividade remunerada compunham 47,70% do total, mas destas, apenas 35,30% encontravam-se empregadas formalmente. As relações entre intervalo etário e estado conjugal demonstraram em 1998, que a maior parte das trabalhadoras estão sozinhas (separadas, viúvas ou solteiras), com idade entre 20-29 anos, o que refletiu o perfil do mercado de trabalho ocupado por mão de obra feminina. No tocante à moradia, o dado trabalhado pela PNAD que mais se assemelhou às informações obtidas pelo roteiro de entrevista, referiu-se ao tipo de domicílios. Apesar de não trazer o detalhamento quanto ao gênero masculino ou feminino, obteve-se dados gerais a respeito da moradia própria, alugada ou cedida . Assim, por meio dos dados da PNAD apreende-se que grande parte dos brasileiros reside em casa própria (75,80%), 12,24% pagam aluguel e 11,49% moram em residências consideradas cedidas. No RJ, os números permanecem em conformidade com os nacionais, compondo respectivamente 76,24%, 14,31 % e 8,03% do total. Do total de homens atendidos, a maioria relativa (30,60%) residia em moradia própria, 13,50% em casa alugada e 22,40% com familiares. As mulheres seguiam a mesma tendência, porém com os respectivos percentuais: 33,7%, 7% e 20,9%. A partir de tal informação, foi possível aferir que um número significativo de pessoas não possuíam gastos com aluguel, portanto, se a maioria residia em moradia própria e/ou de familiares, tinham assegurado seu direito básico à habitação. Não obstante, é preciso considerar os custos inerentes à manutenção da moradia (IPTU, taxas de condomínio, etc.). Por outro lado, é preciso atentar para as questões interpessoais existentes nas relações daqueles que residem com familiares ou em casas cedidas, pois, o preconceito e a dificuldade de conviver com uma pessoa portadora do hiv, pode trazer tensionamentos que venham a desencadear situação de fragilidade, desamparo e desproteção.(COSTA-COUTO, 1998). Os resultados encontrados nesta pesquisa, bem como a comparação destes com dados provenientes de bases de informação/indicadores nacionais (PNAD/RJ, PNAD/BR e DATASUS) suscitaram alguns questionamentos. Como por exemplo: saber se os dados disponíveis nos Sistemas de Informações em Saúde (SIS) realmente fornecem informações para a elaboração de políticas sociais eficientes e eficazes para a resposta pública ao hiv/aids? Este sistema pode informar ou fornecer indicadores de avaliação para políticas voltadas para a população em exclusão? O atual acumulado de informações permite aperfeiçoar a resposta do Programa Nacional rumo à integralidade da atenção em saúde? Estariam nossas políticas aptas a enfrentar os signos atuais desta epidemia (feminização, pauperização e interiorização)? Poderia o Programa Nacional desenvolver novas políticas intersetoriais com base nestas mesmas informações? Qual os serviços assistenciais disponíveis e que foram acionados? Tais políticas conseguiram responder a demanda colocada? Em que medida as demais políticas auxiliam a continuidade do tratamento em saúde? As pvha podem contar com o amparo da primeira rede de proteção social, seu grupo sócio-familiar? A satisfação das necessidades em saúde se relaciona diretamente e é inferida pelo conjunto de condições de reprodução social e material disponíveis que permite, ou não, o desenvolvimento individual e coletivo de capacidades e potencialidades. (Laurell, 1997:86) Feita esta constatação é preciso inferir outra: a de que o Programa Brasileiro de Dst/Aids tem disponibilizado, da melhor forma possível, serviços e insumos necessários para a satisfação das demandas em saúde das pessoas que vivem com hiv ou aids. O problema entre estas duas assertivas é o saldo negativo de sua inter-relação, haja vista que nos últimos tempos, a epidemia vem atingindo prioritariamente as pessoas que se tornaram vítimas do fenômeno mundial de pauperização de massa e, que em virtude disso, tiveram suas condições de reprodução social e material amplamente reduzidas. Neste cenário, as investidas para o desmonte dos equipamentos, a descontinuidade dos serviços e das ações da assistência social podem estar reduzindo a efetividade do Programa Nacional, mas com os instrumentos disponíveis este não está apto a reconhecer em que momentos e por quais razões, o curso de sua intervenção foi interrompido ou não foi iniciado devido à iniqüidade presente nas demais políticas que compõem a seguridade social. A corrente de pensamento neoliberal tem afirmado que o problema do recrudescimento da pobreza não encontrará solvência se persistir a dependência da intervenção estatal. O retorno ao modelo de proteção social baseado no apoio comunitário e familiar é a solução hegemônica para este e outros problemas como a retração do público. Entretanto, o empobrecimento e a desigualdade de massa levantam dúvidas a cerca da capacidade do grupo sócio-familiar atuar enquanto primeira rede de proteção social. E, ao mesmo tempo, a crescente demanda aos serviços determinam a incapacidade destes. Estas são as razões de investigar as condições de vida e saúde e qual o alcance dos mecanismos de proteção social quando à ocorrência da interseção pobreza, aids e exclusão.

Objetivo: OBJETIVO GERAL: Identificar situações de risco "exponenciado" para auxiliar na análise e difusão de informações necessárias à implementação/ implantação de políticas integradas de assistência, prevenção e tratamento; dirigidas à população afetada pelo hiv/aids. OBJETIVOS ESPECÍFICOS: - Identificar situações de risco social e de saúde; - Identificar situações de superposições de diferentes formas de exclusão de modo a reconhecer riscos exponenciais sociais e de saúde; - Identificar a rede de proteção social existente, bem como, seu uso e acesso; - Identificar as potencialidades, dificuldades e facilidades da proposta de integração entre a política de saúde e as de assistência e previdência social.

Metodologia: Levantamento de dados primários por meio de entrevista semi- estruturada cujo instrumento preliminar encontra-se em anexo. O controle do processo investigativo bem como, os dados serão armazenados no banco de dados criado para este fim pelos coordenadores de campo -- pesquisadores sênior e júnior -- diretamente no ato da entrevista na unidade de saúde. Tabulação e análise comparativa dos dados primários com dados secundários coletados pelo Instituto Brasileiro de Geografia e Estatística e do sistema de Informações em Saúde coletados pelo Departamento de informática do SUS - DATASUS. Os indicadores específicos serão selecionados na primeira etapa da pesquisa. Uma das abordagens/aproximações metodológicas escolhidas para realizar este estudo é a análise dos dados coletados tabulados sob a luz da bibliografia concernente aos temas correlatos. A separação efetuada das temáticas e dos autores que a respaldam não será estanque, porque as questões apontadas na justificativa sinalizam a inter-relação dos temas e se faz presente nos respectivos referenciais teórico-conceituais dos autores a saber: - epidemia de hiv/aids e sua relação com a pobreza e a exclusão (Camargo Jr.,1994, 2002 a, 2002b ; Galvão, 2000; Parker, 1997, 1999 e Parker e Camargo Jr., 2000) - novos determinantes sociais postos a partir do projeto neoliberal (Antunes,1999; Castel,1999; Carcanholo, 2000; Esping-Andersen, 1991,1995, e 1999; Mattoso,1996 e1999; Fiori, 1995, 1997 a e b ,2001; Anderson, 1995 e Senneth, 1999); - seguridade social brasileira conformação, fragmentação e corte nos seus recursos (Behring, 2002; Vianna, 1998 e 2002 e Soares, 1999 a e b e 2000) - políticas sociais, o delineamento da agenda governamental (o que influencia seus processos de decisões e escolhas) Meny e Thoening,1992; Viana,1996 a e b; e Marshall, 1977; Bravo, 1996; Bravo e Pereira, 2001; - Desenvolvimento, desigualdade e eqüidade (Fleury, 1995, 1997; Sen, 2000; Salama e Valier, 1997; Cohn, 1997) Etapas do Estudo: Este estudo tem previsão de duração de doze meses, será realizado em duas fases, compreendendo as atividades a seguir: 1. Estudo exploratório das bases de dados já existentes com relação ao hiv/aids nos Sistemas de Informações em Saúde - DATASUS. 2. Desenho/elaboração do instrumento para coleta de dados (utilizando em alguns campos/categorias de investigação o mesmo formato utilizado pela PNAD/IBGE, de modo a garantir a comparabilidade de dados); 3. Validação e testagem do instrumento para coleta de dados com amostragem de 30 pessoas; 4. Elaboração da versão final do instrumento 5. Elaboração do software de gerenciamento dos dados gerados a partir da aplicação deste instrumento; 6. Realização de estudo-piloto com amostra de usuários dos serviços públicos de HIV/aids da cidade do Rio de Janeiro, a definir; 7. Tabulação, análise e cruzamento dos dados coletados 8. Comparação dos resultados encontrados com outros bancos de dados com informações similares do Instituto Brasileiro de Geografia e Estatística (PNAD- Pesquisa Nacional por Amostra de Domicílios, PME - Pesquisa Mensal de Empregos; Pesquisa de Orçamentos Familiares; Indicadores Sociais, entre outros); 9. Divulgação dos resultados; 10. Sugestão da criação de indicadores para avaliar o acesso das pvaha aos serviços de assistência, promoção e proteção social; 11. Sugestão da criação de indicadores para avaliar o risco exponencial das pvaha em situação de risco social e de exclusão para orientação e avaliação das políticas ofertadas. Teste: A aplicação do instrumento em amostragem de pessoas em acompanhamento pelo Sistema Único de Saúde, com sorologia positiva para o vírus da imunodeficiência humana independente de apresentação ou não de sintomatologia, no ato da entrevista. Os indivíduos que não estiverem em condições de saúde de participar do estudo poderão efetivar sua participação quando julgarem conveniente.

Concorrência: Chamada de Pesquisa - 2004

População Alvo: População em Geral

Natureza: ESTUDOS E PESQUISAS

Subnatureza: SOCIAL

Produção Científica


Projeto: PADRONIZAÇÃO DA TÉCNICA DE DETECÇÃO DO DNA PROVIRAL DO HIV-1 EM AMOSTRAS DE SANGUE SECO UTILIZANDO PCR EM TEMPO REAL.
Coordenador: RICARDO SOBHIE DIAZ
Resumo: A transmissão vertical é a principal via de infecção pelo HIV na população infantil. No Brasil 85,5 % dos casos notificados na população menores de 13 anos são por infecção perinatal. Grandes avanços têm sido alcançados no Brasil para diminuir os índices de transmissão materno-fetal, como a oferta em rede pública do teste anti-HIV, o uso de terapia antiretroviral assistida para gestantes durante todo o período gestacional, durante o trabalho de parto e recém-nascido e substituição do aleitamento materno através de bancos de leite. Para avaliar o desempenho das medidas adotadas faz-se necessário o acompanhamento contínuo da prevalência da infecção nas gestantes e principalmente a prevalência da infecção no recém nascido que seria o indicador de impacto das ações profiláticas desenvolvidas. Além disto, um diagnóstico de certeza de infecção pelo HIV em recém nascidos diminuiria muito a ansiedade dos tutores relacionadas a longa espera pelo diagnóstico e evitaria manipulações desnecessárias ao recém nascido não infectado, como uso de antimicrobianos profiláticos e consultas freqüentes com especialistas. Como o diagnóstico da infecção do recém nascido deve ser feito através de detecção do acido nucléico viral devido à persistência dos anticorpos maternos até um ano ou mais, o objetivo do projeto é a padronização e estabelecimento da técnica de detecção do DNA viral do HIV-1 em amostras de sangue seco. Desta forma utilizar-se-ia o PCR em tempo real, produzindo-se um teste simples, sensível e específico. As amostras coletadas em papel de filtro podem ser transportadas e estocadas em temperatura ambiente o que tornaria possível o acompanhamento e testagem de grávidas e recém nascidos de todas as regiões do Brasil de forma prática e barata.

Objetivo: OBJETIVO GERAL: Estabelecer a técnica de detecção do DNA proviral do HIV-1 em amostras de sangue seco utilizando PCR em tempo real.

Metodologia: Coleta de amostras para padronização do método. Para a padronização do teste serão coletadas 100 amostras de pacientes infectados pelo HIV -1, que fazem seguimento regular no ambulatório de pacientes infectados pelo HIV-1 da UNIFESP, que tenham assinado consentimento informado. As amostras negativas serão provenientes de banco de sangue. Armazenamento do sangue em papel de filtro. Após a coleta das amostras de sangue total, uma pequena quantidade de sangue (aproximadamente 5 l) será imediatamente aplicada em papel de filtro (cartão FTA;). O sangue periférico aplicado no cartão após seco completamente será armazenado em embalagens apropriadas contendo a dessecante sílica. Purificação do DNA proviral do HIV-1 Para purificação do DNA provirá,l um disco de aproximadamente 3 mm retirado do centro do cartão contendo a amostra de sangue seco é colocado em um tubo de 0,2 ml e lavado por 3 vezes com o reagente de purificação FTA (fornecedor) e 2 vezes com Tampão Tris EDTA. O filtro de papel é então seco em temperatura ambiente e usado na próxima etapa de amplificação. Amplificação DNA proviral do HIV-1 por real time PCR. Utilizaremos a PCR em tempo real com a metodologia Taqman ® para a detecção do DNA proviral do HIV-1. Esta metodologia baseia-se na clivagem de uma sonda interna aos primers pela atividade exonuclease da Taq DNA polimerase durante a amplificação. Esta sonda é marcada nas suas extremidades 5`e 3` por fluorocromos que funcionam um como "repórter" e outro como"quencher" respectivamente. No inicio da reação não há fluorescência devido à proximidade entre os dois fluorocromos e o "quencher" absorve a energia do "repórter".Em cada ciclo de extensão a sonda é clivada pela Taq e agora em suspensão o "repórter" emite fluorescência que é detectada pelo aparelho.A escolha dos iniciadores e sonda será realizada pelo Primer Express ® (Applied Biosystem) e amplificarão a região de baixa variabilidade do gene pol integrase. Para controlar a presença de inibidores da reação de PCR amplificaremos como controle interno a Beta globina humana. Determinação da sensibilidade do método. Para determinar a sensibilidade do método utilizaremos a linhagem celular H9. Esta linhagem contém uma cópia do DNA proviral do HIV-1 por célula. Estas células serão diluídas em plasma negativo para o HIV-1 para a construção de padrões que serão testados nas concentrações de 20 a 0,2 cópias por l de sangue.

Concorrência: Chamada de Pesquisa - 2004

População Alvo: Outras populações-alvo

Natureza: ESTUDOS E PESQUISAS

Subnatureza: TECNOLÓGICA

Produção Científica


Projeto: Ampliação das atividades de genotipagem e subtipagem do Núcleo de Bioinformática para suporte ao monitoramento do HIV-1/Aids e patógenos co-infectantes no Estado do Rio Grande do Sul.
Coordenador: SABRINA ESTEVES DE MATOS ALMEIDA
Resumo: A pesquisa, diagnóstico e monitoramento de doenças infecciosas causadas por microorganismos patogênicos e fundamental em Saúde Pública. A incorporação dos recentes avanços do setor de biotecnologia, aplicados no entendimento dos fenômenos biológicos tem permitido avanços importantes na identificação e no manejo de diferentes agentes infecciosos. A utilização de ferramentas da bioinformática tem contribuído de forma decisiva para este processo. A bioinformática representa a integração entre sistemas computacionais e modelos matemáticos e estatísticos (algoritmos) que objetivam avaliar e interpretar os problemas biológicos. Originaria do crescente potencial da informática, ela permite entre inúmeras outras aplicações, uma compreensão abrangente e sistemática da informação molecular e clínico-laboratorial, obtida a partir do isolamento do patôgeno e das características de seu hospedeiro. Dentre as doenças causadas por agentes virais, sem dúvida, a AIDS tem sido o alvo de maior preocuparão das últimas décadas. Essa apreensão não esta apenas relacionada a gravidade da doença, mas também a sua crescente disseminação mundial. Hoje a HIV/AIDS e considerada a pandemia de maior importância em saúde pública, afetando aproximadamente 40 milhões de pessoas. A America Latina e a região que ocupa a quarta posição em numero de infectados no mundo, e o Brasil apresenta o maior números de casos desta região, com cerca de 315.000 pessoas infectadas. O subtipo de maior prevalência no Brasil e o B, seguido pelos subtipos F1 e C. Dada a prevalência do subtipo B, ele constitui o subtipo mais estudado até o presente momento; e, em face a prevalência do subtipo C nos estados do sul do Brasil (similar ao que se observa em parses como Índia, China e África do Sul), foram iniciados vários estudos sobre a patogenicidade, perfil de resistência primária e secundaria e resposta as terapias ARV (clínica, virológica, imunológica) deste subtipo. No estado do Rio Grande do Sul observa-se um aspecto característico com relação a epidemiologia molecular da infecção HIV/AIDS. O subtipo viral mais freqüentemente observado nas infecções e o subtipo B, porém a incidência do subtipo C tem aumentado significativamente. Também tem sido identificados o subtipo F e recombinantes (mosaicos) B/C e B/F. O HIV-1 do subtipo C foi inicialmente identificado no Brasil no estado do Rio Grande do Sul, na cidade de Porto Alegre sendo característico em grupos de indivíduos heterossexuais soropositivos com elevada taxa para outras DSTs. A prevalência do subtipo C detectada na cidade de Porto Alegre e de 37% e, considerando os subtipos recombinantes B/C esta taxa aumenta para 45%. Portanto a estado do Rio Grande do Sul é uma área que necessita um forte monitoramento da epidemia molecular do HIV-1. Além disso, as informações obtidas a partir destes isolados, podem vir a contribuir para a desenvolvimento de produtos vacinais contra o HIV/AIDS. Quando aliada a um laboratório público de rotina de diagnóstico, o monitoramento de pacientes HIV positivos pode propiciar o desenvolvimento de projetos que levem ao maior esclarecimento do perfil da epidemia na região sul do Brasil. Uma continua vigilância da evolução do HIV em nosso país, em associação a iniciativas globais, pode permitir monitorar flutuações da epidemia que necessitem de respostas e adaptações das iniciativas em curso, fornecendo informações preciosas sobre a sua situação. Com o objetivo de desenvolver e implantar metodologias que propiciem o diagnóstico eficiente de doenças infecciosas, a Fundação Estadual de Produção e Pesquisa em Saúde do Rio Grande do Sul (FEPPS-RS) instituiu o Centro de Desenvolvimento Cientifico e Tecnológico (CDCT). A proposta principal deste centro é o estabelecimento de parcerias com instituições Estaduais e Municipais para promover atividades científicas e de pesquisa em diferentes áreas de importância epidemiológica em Saúde Pública para nosso país, em resposta as demandas apresentadas pela Saúde Pública no Estado do Rio Grande do Sul e no Brasil. A partir de 2002, com o início do seqüenciamento genético do HIV-1 no CDCT, um grande avanço na caracterização molecular do vírus foi alcançado, contribuindo no aprimoramento do conhecimento cientifico, no desenvolvimento técnico na área laboratorial, no treinamento de profissionais das áreas da saúde, na implementação de infra-estrutura física; possibilitando, sobretudo a produção de informação científica auxiliar no monitoramento clínico-laboratorial dos pacientes infectados pelo HIV-1 acompanhados na Rede Pública de Saúde. Em outubro de 2004 teve início a implantação do Núcleo de Bioinformática (Projeto 186/04) junto ao CDCT/FEPPS-RS; com objetivo principal de suprir as necessidades de analise de dados epidemiológicos do HIV-1 neste estado. Desta forma, o núcleo propõe a contribuir para o entendimento da evolução da epidemia HIV/AIDS, em seus aspectos epidemiológicos, clínicos e moleculares no Estado do Rio Grande do Sul. Atualmente o Núcleo de Bioinformática já conta com infra-estrutura física adequada e também com a participação de profissionais qualificados e treinados para realização das principais técnicas de seqüenciamento e análise molecular. Hoje o Núcleo de Bioinformática do CDCT/FEPPS-RS é o único local na rede pública do estado que esta envolvido na análise e monitoramento da epidemia HIV/AIDS. Portanto para poder dar suporte a demanda da rede pública e municipal, a ampliação do mesmo se faz necessária. Analises realizada pelo Núcleo de Bioinformática das primeiras seqüências geradas no CDCT e oriundas dos três estados da região sul do Pais já originaram dados relevantes acerca do perfil de distribuição e prevalência dos subtipos circulantes em cada um dos estados do Sul. Estes estudos tiveram seus resultados parciais veiculados na comunidade científica em congressos da área, de abrangência tanto Nacional quanto Internacional. Os trabalhos submetidos a estes congressos estão anexados a esta pro posta de Projeto (Anexo E e F). O presente projeto visa a ampliação do Núcleo de Bioinformática do CDCT/FEPPS-RS principalmente a manutenção dos recursos humanos já capacitados pelo projeto de implantação e o desenvolvimento dos processos de análises já estabelecidos, bem como o aperfeiçoamento de metodologias, tanto no âmbito laboratorial quanto na avaliação e divulgação de dados a comunidade cientifica e civil. A melhoria desta infra-estrutura visa a correta extração e conservação das amostras clínicas, para posterior caracterização através de genotipagem e análises computacionais destas seqüências. A análise das seqüências geradas e a sua caracterização molecular são realizadas através de ferramentas de bioinformática e são de extrema importância para estudos de eficácia de vacinas e microbicidas e para a caracterização ao do perfil da epidemia, o que acarreta em melhores estratégias de tratamento dos pacientes soropositivos do Estado. O reforço da infra-estrutura informacional representa um importante ganho de qualidade e potencial de resposta aos problemas atuais de saúde pública. A epidemia de HIV/AIDS necessita de constante monitoramento de sua dinâmica evolutiva, que e responsável pelas questões que as ferramentas de bioinformática têm condições de responder. As atividades do Núcleo de Bioinformática contemplam também a geração de suas próprias seqüências, além da análise de amostras obtidas através de outros projetos em andamento na Instituição, como os pacientes atendidos pela Rede Nacional de Genotipagem (RENAGENO), que constituem uma população ao especifica de doentes com falha terapêutica. Para tanto e necessária a obtenção de insumos laboratoriais para implementação da metodologia in house de extração e amplificação de RNA viral de HIV-1. A escolha desta metodologia se justifica pelo menor custo e grande eficácia em relação ao Kit comercial usualmente empregado. Além da produção de conhecimento e apoio a comunidade científica, a prestação deste serviço tem utilidade direta na população atendida, podendo auxiliar, sobretudo no manejo de pacientes infectados pelo HIV. A ampliação do Núcleo também pretende dar suporte a análise molecular de agentes patogênicos envolvidos nos processos de co-infecção dos pacientes, como os vírus das Hepatites B e C, e o Mycobacterium tuberculosis. Diante desta situação torna-se fundamental a sustentação de projetos que visem a ampliação e fortalecimento da infra-estrutura das instituições Públicas de Saúde, permitindo a execução de análises apuradas e consistentes a fim de obter o melhor entendimento da epidemia de HIV/AIDS, tratamento mais eficaz dos pacientes soropositivos e maior controle desta patologia em um futuro próximo.

Objetivo: Geral: Ampliação das atividades de genotipagem e subtipagem de amostras e monitoramento de pacientes HIV+ provenientes de diferentes Centros de Testagem e Aconselhamento, realizadas pelo Núcleo de Bioinformática no CDCT/FEPPS-RS. Específicos: Coordenação, realização e suporte a estudos de monitoramento do HIV-1; Implementação laboratorial da metodologia de seqüenciamento in house do HIV-1; Caracterização do perfil de infecções recentes do HIV-1; Identificação de causas genéticas a resistência aos ARV; Analisar padrões de mutação e polimorfismo viral para subsidiar a terapia ARV a ser estabelecida nos serviços clínicos associados. Suporte e treinamento na área de Bioinformática; Dar suporte a outros estudos genômicos do COCT, de microorganismos co-infectantes como HCV, HBV e o Mycobacterium tuberculosis; Promover colabora ao técnico-científica com Grupos de Pesquisa Nacionais e Internacionais.

Metodologia: 1) Plano de Coleta: Análise de aproximadamente 500 amostras, subdivididas em populações distintas. Um grupo constituído por pacientes adultos virgens de tratamento com CD4 acima de 350 cels/mm3 e o outro composto por pacientes adultos já em processo terapêutico. Entrevista com assistente social e posterior assinatura do termo de consentimento para a utilização dos dados para pesquisa; Encaminhamento dos pacientes pelos médicos responsáveis dos respectivos CTAs e outras instituições para a coleta de sangue realizada pela FEPPS. 2) Metodologia Laboratorial: Separação de amostras de sangue de pacientes HIV+ encaminhados pelo Centro de Testagem e Aconselhamento (CTA) do Hospital Sanatório Parthenon (HSP); Extração e Amplificação do material genômico do HIV-1; Seqüenciamento do material genético viral extraído das amostras de sangue dos pacientes; Preparação das seqüências para posterior analise com ferramentas de bioinformática. Análise dos Dados: Edição, alinhamento e aplicação dos softwares de análise filogenética para identificação de subtipos, prováveis recombinantes e mutações relacionadas à resistência aos medicamentos ARV; Análises epidemiológica Clínica e Molecular do HIV-1; Desenvolvimento local de um banco de seqüências genéticas das formas circulantes encontradas no estado; Elaboração de laudos com os resultados das analises e encaminhamento a unidade de tratamento do paciente; Elaboração de trabalhos e serem divulgados a comunidade científica e civil.

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: ESTUDOS E PESQUISAS

Subnatureza: BÁSICA OU FUNDAMENTAL

Produção Científica


Projeto: Propriedade Intelectual e Acesso a Medicamentos
Coordenador: ALEXANDRE DOMINGUES GRANGEIRO
Resumo: A lei de propriedade intelectual e de patentes brasileira, aprovada em 1996, trouxe implicações significativas para a pesquisa e o desenvolvimento tecnológico na área de fármacos. Uma das principais conseqüências foi o enfraquecimento do processo de implementação da indústria farmacêutica de genéricos, que permitiria ao Brasil estabelecer, de forma autônoma, uma política de acesso universal a assistência farmacêutica no país. O Programa Nacional de DST/Aids do Brasil, iniciativa bem-sucedida e de reconhecimento internacional, e uma das políticas públicas da área de saúde que mais sofrem as conseqüências dos arranjos legais - nacionais e internacionais - que regulamentam essa área. Ao mesmo tempo, o tema propriedade intelectual permanece hermético e restrito a especialistas, dificultando o envolvimento de gestores públicos, sociedade civil e legisladores, entre outros, neste amplo e complexo campo de debate. Esta situação tem exigido da sociedade brasileira a busca de propostas de políticas públicas a serem adotadas no cenário nacional e internacional, capazes de reverter esta situação. A garantia da qualificação dos atores que participam dessa discussão e fundamental para que o impacto da lei de propriedade intelectual sobre a saúde possa ser efetivamente dimensionado e para que as propostas elaboradas para a superação dos problemas dela decorrentes reflitam as necessidades e o consenso entre os principais segmentos envolvidos nesse processo. A presente proposta visa ao desenvolvimento de um projeto - intitulado Propriedade Intelectual e Acesso Universal a Medicamentos - que tem por principal objetivo subsidiar a formulação de políticas públicas na área de propriedade intelectual e acesso universal a medicamentos, entre outros insumos essenciais a assistência a saúde, a partir da discussão e da difusão de conhecimentos e informações estratégicas existentes nessa área. A organização e sistematização de conhecimentos, informações e dados advindos de fontes como legislação, acordos, estudos, pesquisas, entrevistas, entre outras, nacionais e internacionais, deverão subsidiar a produção de meios - um web site, um livro e uma cartilha que garantam a ampliação do debate sobre as principais questões que permeiam este campo. A abrangência a que se propõe o projeto deverá trazer para este debate autoridades, especialistas e estudiosos, alem de gestores públicos, legisladores, profissionais de saúde, integrantes de ONGs, representantes das universidades, jornalistas, ativistas, entre outros. A execução do projeto Propriedade Intelectual e Acesso Universal a Medicamentos oferecera, a sociedade brasileira, elementos que permitam ao conjunto de seus atores a definição de políticas públicas que garantam o acesso universal a medicamentos e demais insumos voltados a assistência a saúde.

Objetivo: OBJETIVO GERAL: Subsidiar a formulação de políticas públicas na área de propriedade intelectual e acesso universal a medicamentos e outros insumos estratégicos para a preservação, manutenção e recuperação da saúde, promovendo a discussão e a difusão de análises e informações estratégicas entre os atores chaves do processo, tais como gestores públicos, legisladores, profissionais de saúde, integrantes de ONGs, representantes das universidades e formadores de opinião, incluindo jornalistas e ativistas. OBJETIVOS ESPECÍFICOS: Estimular a discussão, a articulação e a difusão da informação entre as atores e as instituições chaves na área, especial mente par meio da organização e publicação de uma web page. Envolver novas atores no debate, especial mente organizações de portadores de patologias, além do movimento de HIV/Aids, de modo a ampliar a debate e a conhecimento da sociedade sabre as impactos das patentes de medicamentos, não apenas sabre a epidemia da Aids, mas também sobre outras doenças, inclusive as negligenciadas. Produzir e publicar uma cartilha com informações essenciais sabre propriedade intelectual e seus impactos na saúde, com a finalidade de aproximar e sensibilizar os cidadãos (Ieigos) quanta a relevância do tema em questão. Produzir e publicar um livro analisando as temas-chave sabre propriedade intelectual e acesso universal a medicamentos e outros insumos essenciais para a controle da epidemia de Aids no Brasil, bem como para outras patologias e necessidades de assistência a saúde, dirigido aos atores envolvidos no debate, formadores de opinião e formuladores de políticas públicas.

Metodologia: O projeto utiliza duas distintas metodologias, a primeira, com vista a possibilitar a disseminação das informações existentes na área, será realizada por meio da revisão da produção de conhecimento já existente e a sistematização e a análise das informações pertinentes produzidas; a segunda, que utiliza a metodologia qualitativa, será realizada par meio de entrevistas abertas e de profundidade com atores chaves. Esta etapa da pesquisa buscara reconhecer e divulgar a pensamento e a posicionamento existente sabre propriedade intelectual e acesso a medicamentos no âmbito das instituições e entre profissionais e militantes que atuam com a temática, sendo exploradas as seguintes dimensões: as diferentes visões existentes sabre a tema, delimitação do campo e da forma de atuação dos principais atores envolvidos e a reconhecimento de informações estratégicas para a compreensão de fatos relevantes para a temática no Brasil, como a definição da Lei de Patentes 9.279/96 e as processos de negociação e de ameaças de concessão de licença compulsória para medicamentos de Aids. Obviamente não se pretende elaborar um mapeamento exaustivo ou a analise critica sabre este pensamento, mas sim explicitá-lo, para que a publico alvo do projeto tenha acesso as diferentes formas de abordagens existentes e ao posicionamento destas instituições e profissionais frente as questões relevantes. Neste contexto, serão privilegiadas entrevistas com membros da sociedade civil, indústria privada, organismos internacionais e órgãos governamentais do executivo. As entrevistas serão disponibilizadas na integra no website e servirão como elemento para elaboração das análises produzidas no livro. Será solicitado a consentimento informado para todos as entrevistados.

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ECONÔMICA

Produção Científica


Projeto: REFERENCIA NACIONAL SOBRE DOCUMENTAÇÃO
Coordenador: ALINE MOREIRA LOPES
Resumo: No ano 2006, a epidemia de AIDS completa um pouco mais de duas décadas. Ao longo desse período, esforços significativos foram realizados, no Brasil e no mundo, para responder à epidemia com projetos e programas de prevenção e controle. Uma das grandes armas contra a AIDS sempre foi à informação: a democratização da informação serviu desde o começo da década dos anos 80 como a estratégia principal na luta contra a AIDS no Brasil. Desde o final dos anos 80, a Associação Brasileira Interdisciplinar de AIDS (ABIA) vem investindo na sistematização de informações sobre a epidemia no seu Centro de Documentação e Recursos (CEDOC) sobre AIDS, com o objetivo de fornecer para a sociedade brasileira uma fonte estratégica de dados e informações relacionados à epidemia. Durante esses anos, o CEDOC buscou se estruturar de forma satisfatória para abrigar o conhecimento produzido no Brasil e no mundo a respeito da epidemia de AIDS. O acervo do CEDOC apresenta registros desde o início da epidemia até os dias atuais, sendo encontrados em artigos de jornais e periódicos, as primeiras informações produzidas para a sociedade com relação ao HIV/AIDS. Encontra-se no acervo atualmente 3.416 livros, cartilhas informativas, relatórios e anais, inseridos na base de "Monografia"; um total de 852 coleções na base de "Periódicos"; 252 títulos de vídeos incorporados na "Videoteca"; 143 produções acadêmicas na base de "Tese", além de recortes de jornais, sobre a epidemia de AIDS e assuntos correlatos, desde o ano de 1982. Devido à importância do conteúdo existente no CEDOC, vimos como necessário dispor parte do acervo em condições adequadas para manuseio dos pesquisadores, disponibilizando publicações importantes, e muitas vezes exemplares raros, em meio digital. Com a grande demanda de informações por parte da sociedade, a distribuição de materiais, em muitos locais, não é feita adequadamente. Assim sendo, cresce o número de pedidos de materiais informativos produzidos pela ABIA. Além disso, nota-se um aumento significativo de pedido de informativos, tanto na sede da ABIA como por e-mail e fax, em épocas de eventos como feiras escolares, Dia Mundial de Luta contra a AIDS, Semana Interna de Prevenção no Ambiente de Trabalho (SIPATs), carnaval, sendo assim um campo abrangente de trabalho de grande importância para a continuidade das ações de informação à população sobre prevenção e preparo para o tratamento adequado e eficaz. Outro foco do atual projeto é solucionar a carência de espaço que existe para o desenvolvimento do acervo do CEDOC, comprometendo também o espaço de pesquisa. Foi analisada a necessidade de instalação do sistema de arquivos deslizantes, que é um móvel com módulos acoplados que se movimentam sobre trilhos, otimizando a área de armazenagem das publicações, além da economia de espaço, facilidade de consulta e segurança na documentação. Seu principal objetivo e organizar e reduzir drasticamente o espaço utilizado por estantes, armários, gaveteiros, ou qualquer outro modo de arquivamento, assegurando as publicações de danos causados por agentes externos. Em virtude da notável visibilidade e importância que o CEDOC/ABIA tomou após o desenvolvimento da primeira parte do projeto "Referencia Nacional sobre Documentação", se apresentando como um grande repositório e espaço de consulta das produções literárias sobre a AIDS no Brasil e no mundo, a cada dia são incluídas novas publicações no acervo, produzidas tanto a nível nacional como internacional. Acreditamos que o armazenamento, tratamento técnico e disponibilidade das informações sobre a epidemia são essenciais dentro das organizações, pois além de reforçar a estrutura das ações desenvolvidas pelas instituições, promove a guarda da produção nacional sobre a epidemia, como também possibilita dar suporte informacional aos pesquisadores, estudiosos e pessoas Iigadas à questão da epidemia de HIV. Completando 15 anos de funcionamento em 2006, podemos dizer que os materiais armazenados no CEDOC já constituem uma parte considerável da memória social da AIDS e das respostas à epidemia no Brasil, permitindo a construção de novos saberes. Devido ao fortalecimento do acervo, a ABIA passou a ser vista como parceira e colaboradora da Biblioteca Virtual de Saúde do Ministerio da Saúde do Brasil- BVS MS, Área temática DST & AIDS. A ABIA foi convidada a participar do I Encontro de Parceiros da Área Temática em DST & AIDS, promovido pela Coordenação-Geral de Documentação e Informação e pelo Programa Nacional de DST e AIDS, ambos do Ministério da Saúde. Realizado na cidade de São Paulo, a reunião teve como objetivo apresentar e promover a interação dos parceiros participantes do projeto, de forma a intensificar essa cooperação inter-institucional e a identificar novas metas de trabalho integrado. Dessa forma, foi analisada a necessidade de mais dois encontros durante o ano de 2006 para a análise e concretização do trabalho desenvolvido pelas instituições integradas ao processo. A ABIA se apresenta como a única instituição do terceiro setor envolvida neste trabalho, devido à importância do conteúdo informacional inserido no acervo do CEDOC. As atividades propostas no projeto se justificam como forma de dar reforço e amplitude ao trabalho de recuperação da memória social sobre a epidemia, além de dar subsídios informacionais para os diferentes segmentos da sociedade através da distribuição de materiais.

Objetivo: OBJETIVO GERAL: Ampliar a capacidade e qualidade do Centro de Documentação e Recursos da ABIA de servir como um centro de referência nacional para a documentação de HIV/AIDS, preservando materiais históricos e atendendo à demanda dos programas governamentais de HIV/AIDS (federal, estadual e local), universidades e outros centros de pesquisa, bem como organizações não-governamentais de toda parte do Brasil disponibilizando no meio eletrônico boa parte do acervo.

Metodologia: A metodologia desenvolvida para execução do projeto se baseará em diferentes atividades, no intuito de disseminar de forma mais abrangente possível a informação. Com a reimpressão dos diversos materiais educativos, será alcançado um número maior de usuários que buscam informação na sede da ABIA ou solicitam via e-mail, correio normal, e via mala direta. Como forma de aumentar ainda mais o intercâmbio com pesquisadores e outros centros de documentação e bibliotecas que organizem informações a respeito da epidemia, durante a execução do projeto serão desenvolvidas diversas atividades interativas com a comunidade para o compartilhamento da informação e do conhecimento, bem como a atualização constante da base de dados on line e da homepage da ABIA.

Concorrência: Estratégico

População Alvo: População em Geral

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: GESTÃO DE BANCO DE DADOS

Produção Científica


Projeto: DESENVOLVIMENTO DE TECNOLOGIA FARMACÊUTICA PARA A PRODUÇÃO DE CINCO ANTIRETROVIRAIS DO COQUETEL HIV/AIDS
Coordenador: NUBIA BOECHAT
Resumo: Far-Manguinhos, Unidade Técnico-Científica da Fundação Oswaldo Cruz, tem como objetivo principal ser a centro de referência para a Sistema Único de Saúde, na área de produção de medicamentos e correlatos. Só no ano passado, a Ministério da Saúde economizou mais de R$ 200 milhões ao adquirir de Far-Manguinhos medicamentos por preços em média 60% mais baixos do que as de mercado. Em 2003, foram produzidas 1.7 bilhão de unidades farmacêuticas (comprimidos, cápsulas, pomadas e cremes), superando em 24% a produção de 2002 e em dez vezes a produção de 1997, quando Far-Manguinhos produzia 170 milhões de unidades. São medicamentos utilizados no tratamento de diabetes, hipertensão, tuberculose, anemias, hanseníase, além de ansiolíticos, antiinflamatórios, analgésicos, antibacterianos, corticóides, neurolépticos e anti-retrovirais e outros. Em 2002, Far-Manguinhos atendeu aproximadamente 47% da demanda de anti-retrovirais do Ministério da Saúde. Dentre os laboratórios públicos oficiais, Far-Manguinhos tem um papel de destaque no Programa Nacional de AIDS. Sua importância e fruto de um longo período de investimento em pesquisa e desenvolvimento tecnológico em fármacos e medicamentos, o que explica a sua atuação como suporte técnico junto ao Ministério da Saúde nas negociações de redução de preços dos ARVs. Um fato que deve ser mencionado e a assessoria prestada par Far-Manguinhos a países africanos e latino-americanos interessados em compartilhar o conhecimento brasileiro no combate à aids. Far-Manguinhos pretende capacitá-Ios na produção de sete anti-retrovirais, reduzindo custos de importação de medicamentos par esses países e auxiliando no tratamento da população atingida pela epidemia de aids. Os cinco medicamentos que pretende-se desenvolver estudos de desenvolvimento tecnológico e que atualmente estão sob patente, fazem parte do grupo de medicamentos utilizados na terapia de pacientes HIV positivo e em conjunto consomem mais de 60 % do orçamento do DST/AIDS. Pretende-se ao final destes cinco desenvolvimentos obter três lotes pilotos de cada medicamento, realizar a acompanhamento da estabilidade pelo tempo necessário e não inferior a dois anos, fazer a levantamento de custos, assim como as testes de equivalência farmacêutica e bioequivalência. Desta forma apoiar as ações do Ministério da Saúde no que for necessário.

Objetivo: OBJETIVOS PRINCIPAIS: - Desenvolvimento de tecnologia farmacêutica para a produção e cinco anti-retrovirais; - realização de estudos de biodisponibilidade relativa/bioequivalência em nove medicamentos, que deverão ser registrados na ANVISA, como genéricos; - absorção de tecnologia de imunocromatografia/ Lateral Flow e produção de 150.000 Testes Rápidos para HIV 1 e 2.

Metodologia: Este projeto dividi-se em três etapas: - Aquisição das matérias-primas sob patentes; - Desenvolvimento Tecnológico da formulação; - Estudos de estabilidade

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: DESENVOLVIMENTO TECNOLÓGICO

Subnatureza: TECNOLÓGICA

Produção Científica


Projeto: Pesquisa de Opinião Pública - Comportamento Sexual e Percepções da População Brasileira sobre HIV/Aids 2004: Plano Amostral.
Coordenador: ELZA BERQUO
Resumo: Pesquisa de opinião pública nacional, totalizando 5.040 entrevistas quantitativas cobrindo a população brasileira na faixa etária de 16-65 anos em 52 micro-regiões do Brasil, segundo a definição do IBGE, estratificados em 5 grupos homogêneas segundo instrução, renda, faixa etária e sexo. O plano amostral foi do estratificado em múltiplos estágios, com probabilidades desiguais. Dentro de cada estrato foram sorteados micro-regiões (mr), setores censitários (sc), domicílios particulares (dom) e população adulta. Estabeleceu-se 5.040 entrevistas como sendo o tamanho viável da amostra. O questionário contemplou perguntas sobre percepção e comportamento sexual relacionados ao HIV/AIDS, além de algumas perguntas sobre o consumo de drogas ilícitas.

Objetivo: Realização de pesquisa de opinião pública nacional em regiões específicas, totalizando 5.040 entrevistas quantitativas cobrindo a população brasileira na faixa etária de 16-65 anos em 52 micro-regiões do Brasil, segundo a definição do IBGE, estratificados em 5 grupos homogêneos segundo instrução, renda, faixa etária e sexo.

Metodologia: Amostragem: O plano amostral será do tipo estratificado em múltiplos estágios com probabilidades desiguais. Dentro de cada estrato serão sorteados micro regiões (mr), setores censitários (sc), domicílios particulares (dom) e populações adulta. Em função dos objetivos a serem alcançados, estabeleceu-se 5.040 entrevistas como sendo o tamanho viável da amostra e devem ser sorteados conforme plano amostral. Serão incluídas perguntas sobre percepção e comportamento sexual relacionados ao HIV/AIDS, além de algumas perguntas sobre o consumo de drogas ilícitas. Considerando que algumas questões e temas abordados podem causar constrangimento, inibição, recusa ou falseamento nas informações técnicas especiais podem ser utilizadas com o objetivo de garantir da melhor maneira possível, a integridade das respostas. O entrevistador deverá te o mesmo sexo do entrevistado. Deverão ser fiscalizados 20% do total de questionários realizados por cada entrevistador para verificação dos critérios de aplicação e adequação da amostra. Durante o período de campo, todos os questionários deverão ser submetidos a um processo de crítica e consistência por parte da Mantenedora, devendo ser desenvolvidos a campo os questionários que apresentarem inconsientência. A equipe o PN-DST/AIDS responsável por essa pesquisa acompanhará pessoalmente um número limitado de entrevistas.

Concorrência: Estratégico

População Alvo: População em Geral

Natureza: ESTUDOS E PESQUISAS

Subnatureza: COMPORTAMENTAL

Produção Científica


Projeto: Estudo de sobrevida dos Pacientes de Aids no Brasil - 1998 a 1999.
Coordenador: IONE AQUEMI GUIBU
Resumo: Avaliar o tempo de sobrevida após o diagnóstico de aids em pacientes com mais de 12 anos de idade diagnosticados no poeríodo de 01/01/1998 a 31/12/1999, e notificados ao Sistema de Vigilância Epidemiológica do Programa Braseleiro de DST/AIDS

Objetivo: Avaliar o tempo de sobrevida após o diagnóstico de aids em pacientes como mais de 12 anos de idade diagnosticados no período de 01/01/1998 a 31/12/1999, e notificados ao Sistema de Vigilância Epidemiológica do Programa Brasileiro de DST/AIDS.

Metodologia:

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: EPIDEMIOLÓGICA

Produção Científica


Projeto: Avaliação da Mortalidade por aids no Brasil - AMA Brasil
Coordenador: MARIA AMELIA DE SOUSA MASCENA VERAS
Resumo: Produzir informações mais detalhadas sobre fatores relacionados ao óbito por AIDS nas deferentes regiões brasileiras, de modo a fornecer subsídios para os programas de controle da epidemia nos seus diversos níveis de atenção.

Objetivo: Avaliar o perfil clínico e epidemiológico dos óbitos por aids ocorridos no ano de 2002 no Brasil.

Metodologia: Desenho: Estudo descritivo, seguido de caso-controle não pareado. Casos: A série de casos é constituída por uma amostra aleatória de óbitos por AIDS ocorridos no Brasil no ano 2002. Controles: Amostra selecionada de pessoas com AIDS, vivas até a data de 31/12/2002, de acordo com SINAN. Amostra: O estudo usa um modelo de amostragem aleatória, probabilística, por conglomerado em um estágio, que inclui todas as regiões brasileiras e visa obter representatividade em relação à epidemia nacional de AIDS.

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: EPIDEMIOLÓGICA

Produção Científica


Projeto: Estudo de Coorte de Homossexuais e Bissexuais Masculinos em Belo Horizonte, Minas Gerais: História Natural, Avaliação da Intervenção Comportamental, Análise de Incidência da Infecção pelo pelo HIV, Caracterização Virológica e Imunológica e Aceitabilidade de Participação em Ensaios com Vacinas Anti-HIV.
Coordenador: DIRCEU BARTOLOMEU GRECO
Resumo: O Projeto Horizonte (componente do Centro de Vacinas anti-HIV de Minas Gerais/UFMG), é um estudo de coorte de homo e bissexuais masculinos, soronegativos, residentes em Belo Horizonte para: avaliar incidência da infecção pelo HIV; avaliar o impacto das medidas preventivas; preparar para ensaios clínicos com vacinas candidatas anti-HIV e avaliar os parâmetros virológicos e imunológicos dos soroconvertores. De 1994 a 2005, 1033 pessoas foram recrutadas e atualmente 488 voluntários estão em acompanhamento. A média de idade é de 26,9 anos, 47,4% têm segundo grau, 44,8%, renda mensal de 1 a 3 salários mínimos e 61,6% são pardos/negros. Eles são avaliados semestralmente através de: entrevista psicossocial, aconselhamento pré e pós-teste anti-HIV e outras DST, avaliação laboratorial e médica. As intervenções educativas ocorrem nos atendimentos individuais e nas atividades mensais em grupo para: discutir sobre vulnerabilidades a DST/aids; construir alternativas de comportamento sexual protegido; contribuir na adesão dos voluntários; e discutir aspectos técnicos e éticos da participação em ensaios de vacina anti-HIV. Os resultados atestam ser viável implementar e manter uma coorte por longo período, estimar a incidência da infecção, investigar as práticas sexuais, discutir e avaliar métodos de prevenção. Além disso, os voluntários têm informações e espaço de discussão para facilitar a tomada de decisão autônoma sobre sua eventual participação em testes com vacinas anti-HIV.

Objetivo: Acompanhar prospectivamente homossexuais e bissexuais masculinos, HIV negativos: História Natural com avaliação da prevalência e incidência da infecção pelo HIV, o impacto de intervenções educativas na redução da vulnerabilidade à infecção, o nível de conhecimento, o real interesse em participar de possíveis ensaios de vacinas anti-HIV e caracterizar virológica e imunológica eventuais soroconvertores.

Metodologia: O estudo é dividido em duas fases: processo de seleção (recrutamento e admissão) e acompanhamento. Critérios de elegibilidade: ser homossexual ou bissexual masculino, soronegativo para o HIV e com mais de 18 anos. Após consentimento livre e esclarecido eles são avaliados semestralmente, através de: entrevistas individuais, aconselhamentos pré e pós-teste, exames laboratoriais, consultas clínicas. Os exames complementares (hemograma, sorologia para HIV, sífilis, hepatites) são realizados pelo Laboratório Central do Hospital das Clínicas/UFMG e no Laboratório DIP/UFMG. Instrumentos para a coleta dos dados: questionário-entrevista semi-estruturado com 95 questões sobre orientação sexual, práticas sexuais, uso de drogas e conhecimentos sobre vacinas; questionário para avaliação clínica; filmes seguidos de discussão, oficinas de sexo mais seguro e seminários, realizados mensalmente; e técnicas qualitativas, como grupos focais para aprofundamento das análises quantitativas. Os participantes recebem assistência médica necessária, preservativos, gel lubrificante, auxílio-transporte e alimentação. Aqueles que se infectam pelo HIV durante a permanência na coorte, são acompanhados pela mesma equipe do projeto no Centro de Treinamento e Referência em Doenças Infecciosas e Parasitárias (UFMG/PBH). O recrutamento ocorre principalmente por indicação de amigos (snow ball), panfletagem em locais GLBT e mídia em geral.

Concorrência: Estratégico

População Alvo: Homossexuais

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: APOIO À ESTRUTURAÇÃO DE COORTES

Produção Científica


Projeto: PERFIL DE RISCO CARDIOVASCULAR DE CRIANÇAS E ADOLESCENTES COM HIV/SIDA - ESTUDO PERI
Coordenador: BRUNO CARAMELLI
Resumo: Trata-se de um estudo do tipo caso-controle, no qual se compara a prevalência de fatores de risco para aterosclerose - dieta, atividade física, hipertensão arterial, perfil lipídico, metabolismo dos glicídios, estado de coagulação, obesidade abdominal, obesidade, proteína C-reativa - entre crianças e adolescentes portadoras e não-portadoras do HIV. Sangue congelado está sendo armazenado, a fim de determinar analitos solúveis para avaliação de função endotelial. Determinar-se-á a associação entre determinados aspectos de estados de saúde das crianças com aids e complicações cardiovasculares: funções ventriculares, massa e diâmetros ventriculares. Aplicar-se-á um programa interdisciplinar de controle dos fatores de risco em um grupo selecionado de crianças com aids e o impacto deste programa será comparado com um grupo-controle de crianças com HIV/aids.

Objetivo: Determinar a prevalência dos fatores de risco cardiovascular em crianças e adolescentes com HIV/SIDA e sua associação de características clínicas, hábitos e regimes e tratamento a fim de instituir mudanças possíveis nos mesmos para diminuir o impacto da doença sobre o sistema cardiovascular e a aceleração da progressão da aterosclerose nestes pacientes.

Metodologia: Em uma amostra aleatória de crianças - casos do ambulatório de infectologia do Hospital Infantil Joana de Gusmão (Florianópolis-SC) e controles, do ambulatório de puericultura do mesmo hospital - está sendo aplicado questionário, exame físico e antropométrico, coleta de sangue para determinação de analitos, realização de radiografia de tórax, eletrocardiograma e ecocardiograma. Comparar-se-á a prevalência de fatores de risco para aterosclerose em crianças e adolescentes HIV positivas e negativas. Determinar-se-ão as associações entre alterações cardíacas funcionais com os fatores de risco para aterosclerose e determinadas características clínicas decorrentes da infecção. Aplicar-se-á um programa de reabilitação cardiovascular interdisciplinar em crianças portadoras de HIV moradoras no Lar Recanto do Carinho, situado em Florianópolis-SC. Após um período de intervenção de 12 meses, aplicar-se-á o mesmo protocolo de pesquisa nessas crianças e em crianças previamente avaliadas, mas não-submetidas ao programa. Determinar-se-á o impacto desse programa no controle dos fatores de risco para aterosclerose nessa população.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Crianças e Adolescentes vivendo/portadoras do HIV

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICA

Produção Científica


Projeto: PERFIL LIPIDÊMICO DE PESSOAS COM HIV/AIDS EM SEGUIMENTO NA REDE MUNICIPAL ESPECIALIZADA EM DST/AIDS DA SECRETARIA MUNICIPAL DE SAÚDE DE SÃO PAULO E DO CENTRO DE CONTROLE DE DEFICIÊNCIAS IMUNOLÓGICAS DA UNIVERSIDADE FEDERAL DE SÃO PAULO.
Coordenador: DAVID SALOMAO LEWI
Resumo: Desenvolver as ações do Projeto Perfil Lipidêmico de Pessoas com HIV/AIDS em Seguimento na Rede Municipal Especializada em DST/Aids da Secretaria Municipal de Saúde de São Paulo e do Centro de Controle de Deficiências Imunológicas da Universidade Federal de São Paulo que visa a analisar os fatores de risco para o desenvolvimento de doença cardíaca nos pacientes infectados pelo HIV que utilizarm ou não anti-retrovirais.

Objetivo: Estudo clínico- epidemiológico retrospectivo sobre o risco cardiovascular da terapia antiretroviral em adultos, adolescentes e crianças.

Metodologia: A rede mundial especializada em DST/Aids, vinculada a SMS/SP é formada atualmente por 23 serviçoes que variam segundo sua complexidade e recebem denominação especifica para dintinguí-los: Centro de Testagem e Aconselhamento (CTA), Centro de Prevenção de Assistência (CPA), Ambulatório de Especialidades (AE), Serviços de Assistência Especializada (SAE) e Centro de Referencia (CR). As pessoas diagnosticadas com DST/HIV/Aids podem receber atendimento em 15 desses serviçoes, os quais seriam alvos potenciais desta pesquisa. Encontram-se distribuidos em diversas regioes da cidade, de forma a aproxima-los da demanda cada vez mais crescente em regiões periféricas. Atualmente, encontram-se em seguimento cerca de 15.500 pacientes com HIV/AIds, sendo que destes, aproximadamente 8.000 em uso de TARV e no CCDI cerca de 1120 pacientes, 850 em uso de TARV, totalizando o universo de cerca de 16.120 pacientes em seguimento e 8850 em uso de TARV. Este amplo universo possibilitará a inclusão de cerca de 351pacientes nesta pesquisa. Neste estudo iremos descrever os fatores de risco relacionados ao desenvolvimento de doenças cardiovascular (idade, tabagismo, hipertensão arterial sistêmica, diabetes melitus, história familiar precoce de ateroesclerose) através da utilização da Escala de Framingham. Tendo com obase às informações disponíveis, no presente estudo, um painel lipídico em jejum (de 12 a 14 horas) deverá ser obtido em todos os pacientes com HIV/Aids, em uso ou não de TARV, consistindo de Colesterol Total e frações (LDL e HDL) e triglicérides. Serão avaliados através de questionário, outros fatores de risco relacionados com o desenvolvimento de eventos coronarianos através dos critérios de Framingham.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: RISCO CARDIOVASCULAR TERAPIA ANTI- RETROVIRAL EM ADULTOS, ADOLESCENTES E CRIANÇAS EM PERNAMBUCO
Coordenador: HELOISA RAMOS LACERDA DE MELO
Resumo: A presente proposta compõe um projeto interinstitucional que congrega docentes, pesquisadores e médicos das Universidades Federal e Estadual de Pernambuco e da Sociedade Estadual de Saúde, visando estudar vários aspectos da infecção pelo HIV. Os projetos abordam co-infecções, complicações da terapia anti-retroviral e genotipagem e transmissão vertical e serão desenvolvidos de forma integrada com a finalidade de responder a deferentes objetivos propostos. Para esse projeto serão avaliados todos os pacientes (crianças, adolescentes e adultos) com infecção pelo HIV-AIDS que iniciaram acompanhamento ou tratamento após o ano 2000 nos três principais serviços de referencia para HIV/AIDS na cidade do Recife: Hospital Universitário Oswaldo Cruz da Universidade de Pernambuco, Hospital das Clinicas da Universidade Federal de Pernambuco e Hospital Correia Picanço da Secretaria Estadual de Saúde que juntos serão responsáveis por 90% do atendimento à pacientes com HIV/AIDS no Estado de Pernambuco, totalizando cerca de 5000 pacientes. O numero de casos novos é de cerca de 800-1000 casos por ano e tem se mantido estável nos últimos anos. Observa-se, como no restante do Brasil, uma evidente feminilização, interiorização e pauperização da epidemia.

Objetivo: Avaliar o risco de doença cardiovascular associado ao uso de drogas anti-retrovirais em adultos, crianças e adolescentes em tratamento retroviral no estado de Pernambuco, incluindo a identificação de esquemas antivirais com maior capacidade de potencializar os fatores de risco para doenças cardiovasculares.

Metodologia: A descrição da metodologia compreenderá uma parte comum a todos os projetos em HIV/AIDS, resultado da intersecção dos mesmos, e uma parte específica, atendendo à diversidade dos problemas abordados. Os fatores de risco serão avaliados através de questionários a ser respondido pelo paciente sobre hábitos alimentares (classificada como dieta aterogênica e não aterogênica), tabagismo (presente ou ausente), uso de drogas, sedentarismo e histórico familiar de doença cardiovascular (em parentes de primeiro grau). Para a identificação dos anti-retrovirais serão utilizados registros médicos em prontuário e farmácia dispensadora dos antivirais. Os antivirais serão classificados em quatro grupos que são os inibidores da transcriptase reserva núcleosideqs os inibidores de transcritase reserva não nucleosídeos, os inibidores de protease e os inibidores de fusão. As drogas de cada grupo serão registradas individualmente, para averiguação de diferenças entre medicamentos dentro de um mesmo grupo.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: "Co-infecção HIV e hepatite B (HBV): Estudo dos aspectos clínicos e terapêuticos de uma série de casos de pacientes HIV positivos acompanhados em três serviços de referência, em Salvador/BA".
Coordenador: JOAO EDUARDO PEREIRA
Resumo: A Hepatite B e o HIV são dois importantes agravos para a saúde pública. Além do grande impacto epidemiológico (prevalências estimadas no Brasil: 0,6% para o HIV e 1,04% para HBV), estes vírus tem importantes conseqüências prognosticas e clínicas para o individuo. Os tratamentos são custosos para o SUS e complexos o que dificulta o manejo dos pacientes infectados. O vírus da hepatite B e o HIV compartilham diversas vias de transmissão em comum (sexual, parenteral e vertical), de modo que a co-existência destes vírus é bastante freqüente. A co-infecção HIV/ HBV trans conseqüências prognosticas e terapêuticas: Aumento da morbi-mortalidade por cirrose e suas complicações em pacientes HIV positivos, maior taxa de hepatotoxicidade com o uso da TARV, dificuldade para o manejo do HBV, etc. Contudo, muito do que se aplica aos indivíduos co-infectados provém dos estudos em pacientes mono-infectados pelo HBV e existe diversas lacunas de conhecimento sobre a interação destes vírus, seja no campo da imunológica, historia natural da doença, diagnóstico e tratamento. Em Salvador, a situação epidemiológica do HBV e do HIV suge-re que tenhamos uma alta freqüência de co-infecção. Sobretudo, quando consideramos que, con-forme demonstrado por Pereira et al (no prelo), existe um considerável e preocupante déficit de conhecimento sobre as formas de transmissão das hepatites virais entre a população leiga em Sal-vador (ao responder um questionário com perguntas básicas sobre modos de transmissão e medidas de prevenção das hepatites virais, mais de 50% da população entrevistada deu respostas incorretas ou marcou a alternativa NÃO SEI). Deste modo, torna-se imprescindível o melhor conhecimento desta co-infecção, tento pela freqüência esperada de sua ocorrência, quanto por suas conseqüências danosas aos pacientes e pelo impacto causado à saúde pública. O melhor conhecimento desta inte-ração pode ajudar na definição de orientações de manejo mais próximas da nossa realidade, difusão de conhecimento entre profissionais da saúde que atuam na área e formação de políticas de saúde adequadas para a co-infecção. A Hepatite B e o HIV são dois importantes agravos para a saúde pública. Além do grande impacto epidemiológico (prevalências estimadas no Brasil: 0,6% para o HIV e 1,04% para HBV), estes vírus tem importantes conseqüências prognosticas e clínicas para o individuo. Os tratamentos são custosos para o SUS e complexos o que dificulta o manejo dos pacientes infectados. O vírus da hepatite B e o HIV compartilham diversas vias de transmissão em comum (sexual, parenteral e vertical), de modo que a co-existência destes vírus é bastante freqüente. A co-infecção HIV/ HBV trans conseqüências prognosticas e terapêuticas: Aumento da morbi-mortalidade por cirrose e suas complicações em pacientes HIV positivos, maior taxa de hepatotoxicidade com o uso da TARV, dificuldade para o manejo do HBV, etc. Contudo, muito do que se aplica aos indivíduos co-infectados provém dos estudos em pacientes mono-infectados pelo HBV e existe diversas lacunas de conhecimento sobre a interação destes vírus, seja no campo da imunológica, historia natural da doença, diagnóstico e tratamento. Em Salvador, a situação epidemiológica do HBV e do HIV suge-re que tenhamos uma alta freqüência de co-infecção. Sobretudo, quando consideramos que, con-forme demonstrado por Pereira et al (no prelo), existe um considerável e preocupante déficit de conhecimento sobre as formas de transmissão das hepatites virais entre a população leiga em Sal-vador (ao responder um questionário com perguntas básicas sobre modos de transmissão e medidas de prevenção das hepatites virais, mais de 50% da população entrevistada deu respostas incorretas ou marcou a alternativa NÃO SEI). Deste modo, torna-se imprescindível o melhor conhecimento desta co-infecção, tento pela freqüência esperada de sua ocorrência, quanto por suas conseqüências danosas aos pacientes e pelo impacto causado à saúde pública. O melhor conhecimento desta inte-ração pode ajudar na definição de orientações de manejo mais próximas da nossa realidade, difusão de conhecimento entre profissionais da saúde que atuam na área e formação de políticas de saúde adequadas para a co-infecção.

Objetivo: OBJETIVO GERAL: Avaliar aspectos clínico-terapêuticos da co-infecção HIV/HBV em uma série de casos de pacientes HIV positivo residentes em uma região metropolitana do nordeste do Brasil. OBJETIVOS ESPECÍFICOS: A) Estimar a freqüência da co-infecção HIV/ HBV, bem como a presença de hepatite B oculta (uma forma de Hepatite B de difícil diagnóstico, mas com conseqüências clínicas) em paci-entes HIV positivos; B) Avaliar a dinâmica da resposta vacinal para HBV em pacientes HIV positivos e quais as va-riáveis implicadas na taxa de resposta vacinal; C) Estudar a freqüência e fatores associados com a emergência de cepas mutantes do HBV em pacientes HIV positivos; D) Avaliar o impacto e interações clínicas, imunológicas e virológicas dos tratamentos antivi-rais para o HIV e o HBV; E) Avaliar sob forma de estudo piloto uma estratégia terapêutica de resgate dos pacientes HBV/ HIV positivos que apresentam resistência do HBV à lamivudina.

Metodologia: O estudo será conduzido em 2 centros de referência para manejo do HIV e 1 centro de referência para manejo de Hepatites Virais em Salvador/ Ba. Projeto de caráter ambipesctivo, conta com os seguintes braços: A) Aspectos descritivos (análise de variáveis epidemiológicas, antropométricas e clínicas-laboratoriais) - Desenho do estudo: Análise de serie de casos, com aplicação de estatística descriti-va e elementos de estatística analítica (comparação entre médicas e proporções referentes aos sub-grupos). Dados coletados por meio de fichas clínicas (vide item 10.4.1) preenchidas durante as consultas médicas ou extraídos dos prontuários. B) Estudo sobre aspectos da resposta vacinal para Hepatite B em pacientes HIV positivos - Dese-nho do estudo: Estudo aberto, com controle histórico, com estatística analítica uni e multivariada sobre os fatores que interferem na taxa de resposta vacinal. As indicações, esquemas vacinais e aplicações das vacinas obedecerão às normas e protocolos já existentes do Programa Nacional de Imunizações em conjunto com o Programa nacional de hepatites Virais/ Ministério da Saúde. Deste modo, os pacientes serão testados para imunidade contra o HBV e para parâmetros de integridade do sistema imune, aqueles susceptíveis serão encaminhados para vacinação conforme determina já citadas, após o termino do esquema vacinal o paciente será re-testado par averiguar a viragem soro-lógica (vide item 10.4.1). C) Estudo de epidemiologia molecular da co-infecção HIV/ HBV - Desenho do estudo: Serie de casos com determinação de freqüências (embora o tamanho da serie sugira que os resultados de-vem aproximar-se das verdadeiras prevalências na região). Para pesquisa do RNA (HIV) e DNA (HBV) será utilizada a técnica de PCR (Polimerase Chain Reaction) por Kits comerciais (Roche, Bayer, Biomerieux), com determinações qualitativas e quantitativas (carga viral), além de genoti-pagem e pesquisa de mutações (HBV). Os mapas de distribuição dos genótipos e de mutações dos dois vírus serão sobrepostos e correlacionados com variáveis clínico-epidemiológicas (vide item 10.4.1). D) Estudo do impacto das terapias antivirais - Estudo descritivo sobre principais esquemas tera-pêuticos utilizados e suas conseqüências e correlações com as cinéticas virais e variáveis clínicas (vide item 10.4.1). Os principais parâmetros avaliados serão a carga viral, a emergência de cepas mutantes, a resistência terapêutica, a evolução clínica e as interações medicamentosas. E) Estudo do uso de entecavir para tratamento do HBV em pacientes -co-infectados - Desenho do estudo: Estudo piloto, aberto, não controlado com a utilização do entecavir para tratar pacientes com cepas mutantes do HBV resistentes a lamivudina. As principais varáveis analisadas serão ge-nótipos virais, cargas virais, tempo de uso de lamivudina, esquema de TARV utilizado, contagem de CD4, dose da lamivudina. Os pacientes que apresentarem indicação, segundo os consensos internacionais vigentes, terão ana-lise histológica hepática. Os fragmentos serão colhidos serão preservados em solução de Bouin ou formol a 10%, sendo posteriormente fixados em parafina, cortados em micrótomo e corados para as seguintes colorações: Hematoxilina-Eosina (HE), Picro-sirius ou tricrômio de Mansson (avalia-ção da fibrose hepática) e Perl´s (avaliação da sobrecarga de ferro). Todos fragmentos serão avali-ados pelo mesmo patologista. Para coleta de dados será construída uma ficha de dados, conforme a disposição a seguir: A) Dados de identificação (nome completo, data de nascimento, endereço residencial, telefone, responsável, registro hospitalar ou cartão SUS, instituição de origem); B) Dados antropométricos (peso, altura, sexo, IMC, circunferência abdominal, cor, dados de avaliação nutricional); C) Dados epidemiológicos (comportamento sexual, uso de sangue e/ ou hemoderivados/ he-mocomponentes, uso de drogas IV, uso de drogas inalatorias, tatuagens, piercing, outras DST, procedimentos médicos e odontológicos, transplante de órgãos, atividades profissio-nais, etc). D) Dados Bioquímicos e hematológicos (função renal, eletrólitos, hemograma completo, teste de agressão hepática e bilar, teste de função hepática; etc) E) Testes sorológicos (anti-HIV 1 e 2; HBsAg, anti-HBc total, HBeAg, anti-HBe, anti-HCV - outros testes sorológicos quando necessários, ex: anti-HBs, anti-HDV, anti-HBs IgM, anti-HAV IgM, anti-HAV IgG, anti-HTLV 1 e 2); F) Testes imunológicos (contagem de CD4, Relação CD4/ CD8, Teste de imunidade contra o HBV, teste de imunidade contra o HAV, pesquisa de auto-anticorpos, pesquisa de crioglo-bulinas); G) Testes virológicos (testes qualitativos, testes quantitativos - carga viral, genotipagem, testes de resistência terapêutica - quando necessários); H) Dados clínicos (Classificações - HIV/ Aids, Child, MELD; Complicações da infecção pelo HIV; Complicações da doença hepática - SHP, Ascite, Carcinoma Hepatocelullar, Varises de esôfago, Encefalopatia hepática, Infecções; Alterações endocrinológicas - dislipidemia, alterações da tireóide, obesidade, diabetes; Infecções oportunistas); I) Dados histológicos (classificação METAVIR, Algoritmo da Sociedade Brasileira de Pato-logia, Avaliação de Esteatose Hepática); J) Dados terapêuticos: HIV: Uso de esquema TARV, tipo de TARV, Tempo de uso, efeitos adversos, aderência. HBV: Indicação de uso, esquema utilizado, efeitos adversos, critérios de resposta virológi-ca, critérios de resposta bioquímica, escape terapêutico. Para analise dos dados será construído um danço de dados no programa SPSS®, versão 13.0. Os dados serão manipulados para analise apenas pelo profissional habilitado em estatística. As princi-pais variáveis estudadas serão classificadas quanto à origem em antropométricas, bioquímicas, he-matológicas, imunológicas, epidemiológicas, virológicas, clínicas e terapêuticas. Sempre que pos-sível serão utilizados o sistema métrico internacional, o Sistema de Unidades Internacionais (UI), o número de copias/ ml e os padrões de risco e resposta terapêutica definidos pelos consensos inter-nacionais. As variáveis serão coletadas preferencialmente como variáveis continuas (exceto para as variáveis naturalmente categóricas), sendo categorizadas posteriormente, se necessário. Os dados serão analisados quanto aos seguintes elementos da estatística: A) Estatística descritiva: Medidas de Variação (Ranger, Variância, Desvio padrão); Medidas de Localização (Moda, Média, Mediana, Mínimo, Máximo, Amplitude, Histograma) B) Estatística Analítica (comparação entre meias e proporções): Poder do estudo (erro ?), Teste de Levine, Teste t de student, X2 (testes monocaudal e bi-caudal), Intervalo de confiança Erro ? (p) - Considerando significativos valores de p ? 0,05., Analise univariada de variá-veis, Analise multivariada de variáveis que apresentarem significância na analise univaria-da, Técnicas de regressão logística (se necessário). Os dados será analisados ao 6º, 12º, 18º e 24º mês do projeto. Sendo as tendências encontradas nas analises parciais descritas nos relatórios preliminares do projeto.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: EPIDEMIOLÓGICA

Produção Científica


Projeto: CARACTERIZAÇÃO EPIDEMIOLÓGICA-CLÍNICA DO DIAGNÓSTICO LABORATORIAL E DA RESPOSTA A ANTIFÚNGICOS DA PARACOCCIDIOIDOMICOSE EM PACIENTES CO-INFECTADOS PELO HIV-1.
Coordenador: ROBERTO MARTINEZ
Resumo: Ribeirão Preto e alguns outros municípios de sua micro e macrorregião do Estado de São Paulo têm hoje prevalência da síndrome de imunodeficiência adquirida, conforme mostram há longo tempo as tabelas divulgadas da Coordenação Nacional de DST/AIDS do Ministério da Saúde. Tais coeficientes sinalizam o grande avanço da epidemia de aids na região Nordeste do Estado de São Paulo. Inicialmente mais racionada com uso endovenoso de drogas ilícitas e atualmente difundindo-se secundariamente por via sexual. É uma área geográfica de grandes contrastes sociais, pois ao lado da riqueza representada pelo agronegócio e pela prestação de serviços educacionais e de saúde, convive a pobreza dos bóias-frias que moram na periferia das cidades, mas trabalham no campo dos migrantes de outros Estados e os moradores das muitas favelas de Ribeirão Preto e dos municípios mais populosos. A mesma região geográfica e uma área hiperendêmica de paracoccidioidomicose possivelmente pela intensa atividade agrícola expondo trabalhadores ao ambiente rural onde ocorre a infecção por P. brasiliensis que adoecem apresentam lesão de curso crônico no pulmão tegumento e em outras vísceras com freqüência deixando seguidas incapacitantes causando a morte. Pode ser classificada como doença ocupacional para a maioria dos acometidos. Após a primeira descrição da co-infecção pelo P. brasiliensis em paciente da região em 1989, dezenas de outros casos foram diagnosticados e medicados no Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto, levando a uma estimativa de que o fungo causaria doença oportunista em cerca de 1,3% da população de pacientes com aids. Trata-se da maior casuística de co-infecção paracoccidioidomicose/HIV-I dentre todos os países onde a micose é endêmica apenas parcialmente divulgada. Contrasta com o total de casos publicados da co-infecção no Brasil e na America Latina que atinge hoje número pouco superior a 100. Geralmente como relatos isolados há um questionamento sobre o relativamente pequeno número de casos divulgados face as dimensões da epidemia de aids e a endemicidade da micose no Brasil. Existem poucos dados conhecidos sobre a co-infecção epidemiológicos clínicos, métodos de diagnóstico laboratorial e forma de tratamento. Preencher estas lacunas do conhecimento médico-científico e contribuir para o diagnóstico clínico-laboratorial precoce e tratamento adequado particularmente em serviços médicos não especializados e em pequenas comunidades rurais. Justificam o presente projeto.

Objetivo: Geral; Caracterizar a co-infecção paracoccidioidomicose-aids com relação it epidemiologia, quadro clínico radiológico, método de diagnóstico laboratorial e evolução de acordo com o tratamento antifúngico utilizado. Específicos: Analisar casos de co-infecção paracoccidioidomicose-aids, prospectiva e retrospectiva de modo a obter dados sistematizados sobre epidemiologia e prevalência, quadro clínico-radiológico. forma de diagnóstico laboratorial, tratamento e evolução. Isolar P. brasiliensis de amostras de secreções e lesões de pacientes com aracoccidioidomicose infectados ou não pelo HIV e testar sua sensibilidade in vitro a antifúngico. Cultivar amostras de P. brasiliensis selecionando amostras produtoras de antígenos que possam ser empregados em reações sorológicas. Verificar a reatividade de soros de pacientes co-infectados frente a antígenos de P. brasiliensis e de outros fungos de importância médica definindo o papel de testes sorológicos no diagnostico da infecção urológica oportunista.

Metodologia: Coleta de dados clínicos e epidemiológicos - Será feita revisão da casuística publicada em periódicos, buscando evidências que contribuam para a caracterização que se pretende realizar da confecção. A casuística principal a ser analisada compôe-se de pacientes com paracoccidioidomicose e infecção por HIV-1, os quais tiveram o diagnóstico e tratamento realizado no Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto - Universidade de São Paulo, entre 1986 e 2005. Os prontuários médicos serão analisados, coletando-se os dados com auxílio de ficha padronizada. Dada a exigüidade de tempo para o desenvolvimento do projeto (12 meses), a maioria dos dados clínicos será obtida retrospectivamente. A medida em que forem diagnosticados novos casos, estes serão incluídos no estudo, obtendo-se os dados prospectivamente, porém sem interferência com decisões médicas, sobre procedimentos diagnósticos e terapêuticos. A UETDI unidade que presta assistência a pacientes com AIDS no Hospital das Clínicas da FMRP-USP tem atualmente cerca de 1.300 adultos em seguimento, que serão tomados como amostra da população de aids para inquérito sorológico e determinação da reatividade específica e inespecífica para P. brasiliensis. Os dados epidemiológico-clínico-evolutivos dos cerca de 80 casos conhecidos de co-infecção paracoccidioidomicose-aids serão cotejados com aqueles de pacientes com paracoccidioidomicose sem infecção pelo HIV-I, na proporção de 1 caso do primeiro grupo para 2 casos do segundo grupo, buscando-se pareá-los segundo o ano de ocorrência da infecção por P. brasiliensis. A coleta de dados quer pela revisão de prontuários, quer pelo exame de documentos de pacientes em seguimento incluirá: dados demográficos, procedência e naturalidade, contato com área rural, via de transmissão do HIV-I, doenças oportunistas previas e concomitantes, carga viral do HIV-I e contagem de linfócitos CD4+ em data próxima do diagnóstico da paracoccidioidomicose, exame hematológico, bioquímica sanguínea, exames para diagnóstico da micose, sintomas e sinais clínicos, antifúngicos empregados e evolução sob tratamento, este detalhado quanta a doses e duração. Os exames radiológicos, especialmente de tórax serão reavaliados de modo padronizado. A evolução do paciente será classificada em cura clínica, melhora, persistência de doença ativa e óbito. Procedimentos micológicos - Amostras de secreções e de lesões de pacientes com hipótese clínica de paracoccidioidomicose serão examinadas em microscópio após tratamento com KOH10% e coloração com azul-algodão, buscando as leveduras típicas de P. brasiliensis. Tais amostras serão também cultivadas a temperatura ambiente, durante 4 semanas, em meio Sabouraud com cloranfenicol e em Sabouraud com cicloheximida. Materiais livres de contaminação serão também cultivados a 35° C, em meio Fava Neto. Os isolados de fungos filamentos serão identificados pela micromorfologia em microcultivo, pelo eventual dimorfismo temperatura - dependente e por outros testes convencionais. Amostras fúngicas caracterizadas como P. brasiliensis serão mantidas viáveis no Laboratório de Investigação em Micologia Medica da FMRP-USP por meio de subcultivos em meio Sabouraud e preservação a-70° C. Amostras conhecidas do fungo, como B339, serão mantidas da mesma maneira, com finalidade de controle de produção de frações antigênicas pelo fungo. Teste de sensibilidade a antifúngicos - P. brasiliensis isolado de co-infectados ou não pelo HIV-I terá a susceptibilidade determinada in vitro às drogas anfotericina B, cetoconazol, itraconazol, fluconazol e sulfametoxazol-trimetoprim. A avaliação será efetuada com a fase leveduriforme, obtida em cultura a 35° C. A concentração inibitória mínima será mensurada por meio dos testes de diluição das drogas em ágar e diluição em meio líquido, confirmando-se por meio de fitas de e teste em placas com o meio Sabouraud (Hahn et. al, 2002). A escala de concentrações de cada droga nos testes abrangera as concentrações esperadas no sangue e tecidos dos pacientes (Espinel-Ingroff et al). Produção e avaliação de antígenos de P. brasiliensis - Fungos isolados de pacientes com a coinfecção, assim como outras amostras serão cultivados para obtenção de exoantígeno - cultura estacionária em meio com composição definida (Restrepo e Jimenez, 1980) ou por cultura em meio líquido com agitação (Camargo et. al, 1991) e antígeno celular obtido pela ruptura de leveduras por meio de ultrassom. Os extratos de diferentes cepas de fungo serão avaliados quanta a presença de frações mais antigênicas por meio de eletroforese em gel de poliacrilamida (SDS-PAGE), selecionando-se cepas mais produtoras de glicoproteínas de 43KDa e de 70KDa, reconhecidas pelos anticorpos da maioria dos pacientes com paracoccidioidomicose (Camargo et. al, 2003). Os extratos mais reativos serão testados contra soros de pacientes, isoladamente ou em "pool", com o objetivo de alcançar valores máximos de sensibilidade e de especificidade nas reações de imunodifusão dupla em gel de ágar e na contraimunoeletroforese (Mendes Giannini et. al, 1994). Transferência de antígenos para papel de nitrocelulose também será feita com o objetivo de avaliar reação sorológica em meio solido. A padronização dos testes sorológicos será seguida da execução das reações com os soros de pacientes com paracoccidioidomicose-aids e de casos sem a infecção fúngica.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: IMPACTO DA ADESÃO AO TRATAMENTO ANTI-RETROVIRAL EM CRIANÇAS E ADOLESCENTES NA PERSPECTIVA DA FAMÍLIA, DA CRIANÇA E DO ADOLESCENTE NOS MUNICÍPIOS DE PORTO ALEGRE E SANTA MARIA/RS.
Coordenador: MARIA DA GRAÇA CORSO DA MOTTA
Resumo: Desenvolver ações do Projeto Impacto da Adesão ao Tratamento Anti-Retroviral em Crianças e Adolescentes na Perspectiva da Família, da Criança e do Adolescentes nos Municípios de Porto Alegre e Santa Maria/RS que visa a avaliar o presente nível de adesão ao tratamento anti-retroviral em crianças e adolescentes com AIDS nos municípios de Porto Algre e Santa Maria/RS.

Objetivo: Avaliar o nível de adesão ao tratamento anti-retroviral em crianças e adolescentes com aids nos municípios de Porto Alegre e Santa Maria (RS); e desvelar a percepção e a vivência, em relação ao tratamento anti-retroviral e à adesão, na perspectiva da família, da criança e do adolescente que vivem com aids nos municípios de Porto Alegre e Santa Maria (RS).

Metodologia: A presente pesquisa pretende avaliar a realidade em suas múltiplas dimensões e complexidades com o propósito de encontrar respostas para as questões aqui levantadas, bem como compreender suas diferentes interfaces; sendo assim, se elegeu a abordagem quantitativa para desenvolver a primeira etapa desta pesquisa e, para a segunda etapa, a abordagem qualitativa. Faz-se importante destacar que após a coleta dos dados quantitativos e dos dados qualitativos ocorrerá a análise por parte da equipe pesquisadora em relação aos mesmos e, como retorno aos serviços no qual o estudo se desenvolveu, ocorrerá a elaboração de boletins informativos os quais serão distribuídos entre os usuários das instituições, bem como entre os profissionais envolvidos com o diagnóstico, a prevenção e a assistência às crianças e ais adolescentes que vivem com AIDS. Salienta-se, ainda, que serão realizadas reuniões semestrais entre os membros da equipe pesquisadora no sentido de avaliar e analisar o andamento do estudo, bem como a fim de reordenar o percurso metodológico quando da necessidade.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Crianças e Adolescentes vivendo/portadoras do HIV

Natureza: ESTUDOS E PESQUISAS

Subnatureza: COMPORTAMENTAL

Produção Científica


Projeto: Comunicação de diagnóstico de soropositividade HIV e Aids para pré-adolescentes, adolescentes e adultos: impacto emocional, aspectos psicossociais e adesão ao tratamento.
Coordenador: MARIA APARECIDA CREPALDI
Resumo: Objeto de estudo desta pesquisa é a comunicação de diagnósticos de soropositividade para o HIV e Aids e as mudanças psicológicas vivenciadas pelos pacientes, relacionadas ao impacto emocional, à adesão ao tratamento e às estratégias de enfrentamento da doença. Busca investigar as implicações da revelação de diagnósticos de soropositividade para o HIV e Aids na perspectiva de pacientes adultos. Além disso, pretende-se levantar quais formas de comunicar essas notícias estão sendo utilizadas, pelos profissionais de saúde na sua prática cotidiana, as dificuldades enfrentadas e os recursos disponíveis para tanto. Trata-se de uma parte de um projeto maior que investigará as implicações da revelação de diagnósticos de soropositividade para o HIV e Aids na perspectiva de pacientes em diferentes faixas etárias (pré-adolescentes, adolescente, adultos) e seus familiares.

Objetivo: Avaliar as vivências e manifestações psicológicas de pré-adolescentes, adolescentes e adultos em relação á revelação do diagnóstico de soropositividade para o HIV e Aids.

Metodologia: De acordo com a classificação proposta por Hübner (1998), esta pesquisa é classificada como descri-tivo-correlacional, pois se pretende, além de descrever, estabelecer relações entre os fenômenos investiga-dos. A pesquisa descritivo-correlacional se aplica à investigação de fenômenos para os quais não há possibi-lidade de manipular as condições de ocorrência, sendo portanto, adequada para o estudo das vivências de-correntes da revelação do diagnóstico de soropositividade para o HIV e Aids. O delineamento da pesquisa é transversal. Esta pesquisa caracteriza-se por uma base epistemológica qualitativa, a qual é pertinente à investiga-ção de fenômenos complexos como a subjetividade, e objetiva conhecer vivências, crenças, valores e signi-ficados (Minayo e Sanches, 1993). Além disso, para abordar fenômenos que ainda não se encontram am-plamente investigados, como o fenômeno em questão, é necessário realizar estudos que os analisem em profundidade. A avaliação de alguns construtos, como qualidade de vida, stress, estratégias de enfrentamen-to, locus de controle, desesperança e depressão, será realizada por meio de metodologia quantitativa, neces-sária como complemento da análise qualitativa. A pesquisa será realizada no município de Florianópolis, Estado de Santa Catarina, em quatro institu-ições: Hospital Infantil Joana de Gusmão, Hospital Nereu Ramos, Hospital Universitário Polydoro Ernani de São Thiago, da Universidade Federal de Santa Catarina (HU/UFSC) e Serviço de Atendimento Psicoló-gico (Sapsi/UFSC). Ressalta-se que os três hospitais possuem Serviço de Atendimento Psicológico aos paci-entes e familiares, o que confere um suporte técnico necessário para a realização desta pesquisa. O Hospital Infantil Joana de Gusmão presta assistência a crianças e adolescentes até 15 anos de idade, atendendo à clientela do Sistema Único de Saúde (SUS), de convênios e particular. Dispõe o serviço de Hospital-Dia para atendimento de crianças e adolescentes soropositivos. Trata-se de um hospital de referên-cia estadual no atendimento à crianças e adolescentes. O Hospital Nereu Ramos é um hospital de porte médio, com 147 leitos ativados, sendo que no Servi-ço de doenças infecto-parasitárias/AIDS há 36 leitos destinados para Internação, 20 leitos para o Hospital Dia e 15 leitos para Assistência Domiciliar Terapêutica. O Serviço de Ambulatório Pneumologi-a/Infectologia realiza uma média de 800 atendimentos por mês. Em 01 de dezembro de 1997 o Hospital Nereu Ramos foi reconhecido como Centro de Referência Estadual no tratamento de Portadores HIV/AIDS e em janeiro de 1998 foi designado Centro de Referência em Doenças Pulmonares/Tisiologia, configurando-se em relevante contexto para realização desta pesquisa. Já o Hospital Universitário Polydoro Ernani de São Thiago, da Universidade Federal de Santa Catari-na (HU/UFSC) é de âmbito federal, apresentando uma clientela heterogênea do ponto de vista social, eco-nômico e profissional, proporcionando a este atendimento ambulatorial, de internação e cirúrgico totalmente gratuitos. O SAPSI é o Serviço de Atendimento Psicológico da Universidade Federal de Santa Catarina, e tem como objetivo prestar atendimento psicológico gratuito à comunidade universitária e a comunidade da cida-de de Florianópolis e regiões circunvizinhas. As atividades desenvolvidas incluem intervenções clínicas, promoção da qualidade de vida e pesquisas. É o local que propicia aos alunos da graduação em Psicologia e cursos de pós-graduação na área a prática necessária à sua formação profissional de maneira que, através do atendimento à comunidade, possam adquirir e aperfeiçoar formas de atuação profissional nos campos da Psicologia. O estudo-piloto será efetuado por meio da aplicação do protocolo de pesquisa com três pacientes (dois pré-adolescentes, dois adolescentes e dois adultos), três familiares de pessoas soropositivas. O estudo-piloto servirá para aperfeiçoar os instrumentos de coleta de dados (roteiros de entrevistas), além de indicar alterações necessárias no protocolo de pesquisa (ordem de aplicação dos instrumentos) e na forma de abor-dagem dos participantes pelas pesquisadoras. Serão realizadas análises quali-quantitativas dos dados. Os dados obtidos por meio das entrevistas semi-estruturadas serão analisados a partir da metodologia da análise temática categorial de conteúdo (Bar-din, 1977), que permite identificar generalidades e peculiaridades. Para os demais instrumentos será realiza-da análise estatística descritiva, baseada em dados de freqüência, porcentagem e incidência por meio da utilização do programa SPSS® 13.0 for Windows®.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: COMPORTAMENTAL

Produção Científica


Projeto: Estudo Clínico-epidemiológico na co-infecção HIV/HTLV: fatores clínicos e laboratoriais associados ás manifestações neurológicas de ambos os retrovírus.
Coordenador: ABELARDO DE QUEIROZ CAMPOS ARAUJO
Resumo: Pretende-se estabelecer quais os fatores clínicos e laboratoriais estão associados ao risco de desenvolver alguma doença neurológica na co-infecção HIV / HTLV. Com isto, medidas de intervenção clínica para prevenir tais ou amenizar manifestações neurológicas poderão ser introduzidas precocemente.

Objetivo: Verificar se a co-infecção HIV/HTLV oferece risco maior para o desenvolvimento de algumas das doenças neurológicas associadas a ambos os retrovírus quando comparada á infecção isolada pelo HIV e pelo HTLV e determinar que fatores clínicos-laboratoriais estão associados a este risco aumentado.

Metodologia: Os pacientes estudados serão oriundos do Instituto de Pesquisa Clínica Evandro Chagas (IPEC) / FIO-CRUZ, no Rio de Janeiro. A coorte de indivíduos infectados pelo HTLV tem 612 pacientes (a maior coorte das Américas) e a de soropositivos para o HIV tem 2474 pacientes. Todos os pacientes infectados pelo HTLV já são submetidos, rotineiramente, à sorologia contra o HIV. A-queles que apresentarem co-infecção com o HIV serão avaliados do ponto de vista clínico-neurológico e laboratorial, através de determinação da carga viral para o HIV, carga proviral por PCR em tempo real para o HTLV, dosagem sérica de neopterina no líquor (quando for indicada a punção lombar), contagem da sub-população linfocitária, dosagem sérica da vitamina B12, análise da bioquímica sanguínea e do hemograma, avaliação cognitiva (Grooved pegboard, finger tap test, teste de trilhas, teste de fluência verbal, Escala de demência para a infecção pelo HIV, mini exame do estado mental) e avaliação eletrofisiológica através de eletroneuromiografia e / ou potencial evocado somato-sensitivo e / ou testes para disautonomia (quando houver queixa clínica e / ou alterações ao exame neurológico que os justifiquem). Todos os exames labora-toriais já são rotineiramente realizados no IPEC. Serão escolhidos, aleatoriamente, 650 pacientes infectados pelo HIV para serem submetidos à sorologia contra o HTLV, haja vista que tal sorologia não é rotineiramente realizada nesta coorte. Chegou-se a este número de 650 indivíduos tendo em vista que, em um projeto piloto realizado no IPEC / FIOCRUZ, a pre-valência média de indivíduos com a co-infecção de em torno de 3 a 5%. Aqueles que apresentarem co-infecção com o HIV serão avaliados do ponto de vista clínico-neurológico e laboratorial, através de deter-minação da carga viral para o HIV, carga proviral por PCR em tempo real para o HTLV, dosagem sérica de neopterina no líquor (quando for indicada a punção lombar), contagem da subpopulação linfocitária, análise da bioquímica sanguínea e do hemograma, avaliação cognitiva (Grooved pegboard, finger tap test, teste de trilhas, teste de fluência verbal, Escala de demência para a infecção pelo HIV, mini exame do estado mental) e avaliação eletrofisiológica através de eletroneuromiografia e / ou potencial evocado somato-sensitivo e / ou testes para disautonomia (quando houver queixa clínica e / ou alterações ao exame neurológico que os justifiquem). A coorte de co-infectados será acompanhada por um período médio de 18 meses, com avaliações clínico-neurológicas a cada 2 meses e avaliações laboratoriais a intervalos semestrais. Os dados clínicos e laborato-riais dos co-infectados serão comparados aos dados dos pacientes infectados pelo HIV e HTLV, isolada-mente. Todos os exames listados já são rotineiramente utilizados pelo Centro de Referência em Neuroinfecção e HTLV na própria instituição (IPEC / FIOCRUZ). Os dados serão computados em banco de dados gerados no programa SPSS 11.0 for Windows.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: Estudo comparativo, randomizado, da administração do Atazanavir versus Nelfinavir na profilaxia antiretroviral em vítimas de violência sexual.
Coordenador: DIANA BRASIL PEDRAL SAMPAIO
Resumo: A violência sexual e um fenômeno freqüente no Brasil e no mundo inteiro, sendo devastador nas suas conseqüências psicossociais e pode resultar em danos físicos graves, tal como gravidez indesejada, ferimentos corporais, incluindo genitália, e infecção por HIV e outras DST. O atendimento correto e precoce desse agravo pode prevenir a grande maioria dessas patologias. Freqüentemente, a preocupação maior da vítima exposta à violência sexual e uma infecção possível pelo HIV. Infelizmente, as taxas de abandono da profilaxia antiretroviral são preocupantes e aumentam assim o risco da vítima de adquirir uma infecção pelo HIV. O objetivo deste estudo e aumentar a adesão à profilaxia antiretroviral, reduzindo os efeitos colaterais da medicação utilizada e conseguindo assim taxas de término de tratamento mais favoráveis e diminuir os agravos sofridos pela vitima. No mundo inteiro, a violência sexual tem confrontado a sociedade como um problema complexo, de aspectos médicos, psicológicos e sociais. A violência sexual, categorizada no Brasil pelo artigo 213 do código penal (definição do estupro como coito vaginal mediante violência ou grave ameaça) e o artigo 214 (atentado violento ao pudor, caracterizado pelo ato libidinoso diverso do coito vaginal), e um fenômeno cujo tamanho pode ser apenas estimado, devido à tremenda subnotificação. O agressor muitas vezes e um conhecido (vizinhos ou familiares) e por razões de vergonha, receio ou ressentimento da vítima, a agressão não e notificada no serviço de saúde ou na Secretaria de Segurança Pública. E sabido, porém que a violência sexual não e um fenômeno raro. Nos EUA, estima-se que a cada ano ocorrem perto de 680.000 estupros, o que equivale a um estupro a cada seis minutos. O registro desses crimes corresponde a, no máximo, 16% dos casos (13). A agressão sexual impõe na vítima uma serie de riscos para a sua saúde física e mental. As conseqüências psicossociais são tremendas, variando com a personalidade e a idade da vítima, e freqüentemente resultando numa síndrome de desordem estressante pós-traumática. Os traumatismos físicos variam de grau e forma, sendo presente em aproximadamente 10% dos estupros e agravando o risco de infecção com uma DST (3). A possibilidade de uma gravidez indesejada como resultado do estupro geralmente é entendida como uma segunda violência e inaceitável para a vítima (6).

Objetivo: Geral: Determinar se na profilaxia antiretroviral a taxa de adesão ao esquema ARV (ATV + Biovir) é maior que no esquema de tratamento padrão do MS (NFV + Biovir) e comparar as taxas de soroconversão em cada grupo. Específico: Comparar o número de efeitos colaterais das pacientes usando Nelfinavir com os que estão usando Atazanavir como drogas profiláticas para HIV nas vítimas de violência sexual; Identificar fatores de risco de adesão nas vítimas de violência sexual; Avaliar se existe associação entre a modalidade de violência sexual sofrida e a taxa de soroconversão.

Metodologia: Número de pacientes: Na media 20 pacientes por mês durante 15 meses = 300 pacientes no total, todos adultos maior que 18 anos Duração da profilaxia: 28 dias consecutivos por paciente Desenho do Estudo e Metodologia: Este e um estudo de um só centro (projeto VIVER), 2-braços, randomizado, comparativo, de Fase III, que irá comparar o esquema de profilaxia antiretroviral, inc1uindo Atazanavir, com um esquema padrão (inc1uindo Nelfinavir) e avaliar a taxa de soroconversão em cada grupo. A indicação alvo e quimioprofilaxia contra o HIV após violência sexual sofrida. Quando a paciente vítima de violência sexual procurar o serviço se referência VIVER, ela vai ser recebida segundo as normas desta instituição e, adicionalmente, ser oferecida participar neste estudo, se no caso específico for indicada profilaxia antiretroviral (vide em baixo). Assinado o termo de consentimento livre, a paciente por sorteio (envelope com o esquema padrão ou esquema alternativo) e colocada em um dos dois braços. Semanalmente, a paciente volta ao sítio do estudo para receber a medicação da semana seguinte, ser avaliada pela médica e colher sangue periférico para avaliação laboratorial. A coleta de sangue dos exames gerais (hemograma etc.) e do ELISA para HIV-1/2 ocorrerá dentro do projeto VIVER. O grupo de controle consistira nas pacientes que teoricamente teriam indicação de iniciar a profilaxia antiretroviral, mas chegam apos 72 horas no serviço, caso em que não e mais recomendado iniciar esta profilaxia. Este grupo recebera meramente vale de transporte para realizar os ELISAs subseqüentes para averiguar uma eventual soroconversão. Como um fator importante da não-adesão a qualquer medicação fornecida neste sítio pode ser a falta de meios de transporte, o estudo iniciar-se-á sem fornecer vales de transporte nem para a paciente, nem para acompanhantes (100 pacientes). Na segunda metade do estudo (200 pacientes) serão fornecidos vales de transporte a todas as pacientes e um acompanhante dos dois braços para avaliar o efeito que esta medida terá na taxa de adesão. Será feito ELISA para HIV -1/2 em todas as pacientes inc1usas no estudo (no tempo zero, apos 45 e 90 dias) para avaliar uma eventual soroconversão para HIV. Será garantido vale de transporte de ida e volta para cada dia da testagem sorológica. Os custos associados com o fornecimento do Atazanavir de um lado justificam-se com a economia resultando da não-prescrição do Nelfinavir para um dos dois braços deste estudo. A coordenadora e o assistente de coordenação serão responsáveis pela administração do protocolo, pela organização da coleta de dados e sangue periférico, organização dos testes ELISA e laboratoriais gerais. Contatos semanais serão feitos com as médicas do VIVER para retirada de dúvidas e uniformização dos procedimentos: será feita revisão das fichas das pacientes da semana anterior e feita a orientação de cada caso do ponto de vista do infectologista, considerando que essa especialidade não existe no VIVER. A coordenadora e o assistente serão consultores diários em todas as dúvidas, inclusive durante período noturno e final de semana. Também e responsabilidade da coordenadora e do assistente, reuniões com a Secretária de Saúde e de Justiça nas solicitações destas, além de reuniões com o corpo clínico do VIVER. Antes do início do protocolo um treinamento da equipe será realizado.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Vitimas de violência e crimes sexuais e/ou homofóbicos

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: INVESTIGAÇÃO CLÍNICA, LABORATORIAL E IMUNOLÓGICA DE PACIENTES COM ESPOROTRICOSE E INFECÇÃO PELO HIV ATENDIDOS NO INSTITUTO DE PESQUISA CLÍNICA EVANDRO CHAGAS/ RIO DE JANEIRO.
Coordenador: MARIA CLARA GUTIERREZ GALHARDO
Resumo: O projeto visa descrever o perfil da co-infecção HIV/Sporothrix schenckii, através do estudo das diversas apresentações clínicas, avaliação diagnóstica e resposta terapêutica, bem como o estudo da interação celular entre os dois patógenos e o hospedeiro. Pretende-se descrever o padrão fenotípico e genotípico para uma melhor compreensão da esporotricose como doença oportunista e a proposição de rotina diagnóstica e esquema de tratamento adequado, dentro dos diversos quadros apresentados e de acordo com a situação imunológica da população estudada.

Objetivo: AVALIAR DO PONTO DE VISTA CLÍNICO, IMUNOLÓGICO, LABORATORIAL TERAPÊUTICO OS PACIENTES COM ESPOROTRICOSE E CO-INFECTADOS PELO HIV.

Metodologia: Os pacientes assinarão Termo de Consentimento Livre e Esclarecido para realização da ro-tina clínica e entrada no Programa de Esporotricose do IPEC (Modelo em anexo). Será um estudo prospectivo de indivíduos com infecção pelo HIV associada a esporotricose. Os pacientes serão acompanhados no IPEC. Geralmente os pacientes com suspeita de esporotricose e HIV são enca-minhados da própria coorte de pacientes HIV do IPEC ou referendados por outras unidades. Serão incluídos os pacientes co-infectados HIV-Sporothrix schenckii e excluídos àqueles com Doença psiquiátrica ou neurológica ativa que impeça a compreensão do estudo e assinatura do termo de consentimento.O critérios do diagnóstico da infecção pelo HIV será o algoritmo elaborado pelo Programa Nacional de DST e Aids do Ministério da Saúde. O diagnóstico de esporotricose será estabelecido pelo isolamento do S. schenckii de espécimes clínicos, os quais serão determinados dependendo da manifestação clínica apresentada pelo paciente. O exame micológico seguirá a se-guinte rotina: microscopia direta com hidróxido de sódio 4% e semeadura em meio Sabouraud-dextrose-ágar, ágar-Mycobiotic (Difco) a 25 0C. Para hemoculturas 5 ml de sangue deverão ser coletados em Myco-F Lytic (Becton Dickson) e incubados a 37 C. Os isolados serão estudados quanto à sua morfologia macroscópica e microscópica em meio de batata-dextrose-agar (Difco) à 25 0C e a conversão à forma leveduriforme do S. schenckii será realizada no meio ágar-infusão-cérebro-coração (Difco) a 37 0C (RIPPON, 1988; WERNER & WERNER, 1994). A avaliação da disseminação da esporotricose será nos seguintes sítios: SNC, sistema respiratório, sistema digestivo. Incluiremos na rotina a punção lombar, Rx de seios de face, endoscopia nasal e laringoscopia, exame de fundo de olho e ultrassonografia abdominal. O restante de exames como RX de tórax, exames de escarro e hemoculturas já são realizados de rotina. Quando houver manifestação clínica (ou sintomatologia) serão realizados exames diagnósticos relativos a estes sítios como sistema os-teoarticular (punção articular, tomografia), sistema hematopoético. Para a avaliação imunológica e virológica em relação à infecção pelo HIV serão colhidos 10 ml de sangue venoso em tubos de Vacutainer contendo EDTA e heparina para a determinação da carga viral HIV-1 e as subpopula-ções de linfócitos T. A carga viral HIV-1 será determinada pelo método quantitativo Nucleic Acid Sequence Based Amplification (NASBA, Organon, Technika) A subpopulação linfócitária (CD3, CD4 e CD8 ) será determinada método colorimétrico pela citometria de fluxo. Para a avaliação imunológica em relação a S.schenckii serão colhidos 20 ml de sangue venoso em tubos de Vacu-tainer contendo heparina. Será realizada a avaliação da resposta proliferativa primária de células mononucleares e polimorfonucleares isoladas de sangue periférico por gradiente de ficoll- hypaque (sigma) e estimuladas in vitro com antígeno total de S. schenckii e à estímulos inespecícficos como concavalina A, PHA: Fitohemaglutinina PMA: acetato de phorbol mistrato. Será avaliada a capaci-dade de células mononucleares isoladas de sangue periférico a responderem in vitro à estímulos específicos através de produção de citocinas de tipo I ou tipo II medidas pelo método de ELISA utilizando kits comerciais padrão para dosagem de IFN-g, IL-10 dentre outras. As células em proli-feração serão avaliada por citometria de fluxo para identificação das subpopulações respondedoras. Nos casos em que houver cura ou remissão da esporotricose os exames serão repetidos para a rea-valiação da resposta imune. Como existem poucos casos desta associação nos ateremos ao tempo do que tamanho de amostra nesse momento. Pretendemos encerrar este estudo em 12 meses.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: IDENTIFICAÇÃO DE MARCADORES GENÉTICOS ASSOCIADOS A EFEITOS ADVERSOS EM PACIENTES COM SÍNDROME DA IMUNODEFICIÊNCIA ADQUIRIDA SOB TERAPIA ANTI-RETROVIRAL.
Coordenador: EDUARDO SPRINZ
Resumo: A proposta desta pesquisa tem como objetivo final a identificação de polimorfismos associados à ocorrência de lipodistrofia, dislipidemias e outros e-feitos adversos, que irão determinar a eficácia e a segurança da medicação com anti-retrovirais é a princi-pal meta desse trabalho. A identificação de associação de variantes dos genes em estudo com a resposta aos fármacos poderá ser também utilizada para definir "a priori" o melhor tratamento farmacológico para cada paciente de forma individualizada, evitando-se assim o uso desnecessário de fármacos com potencial para causar lipodistrofia nos pacientes, com a conseqüente redução da morbidade e aumento da aderência ao tratamento, aprimorando o manejo clínico-terapêutico e psico-social destes pacientes.

Objetivo: VERIFICAR A ASSOCIAÇÃO DA VARIABILIDADE EM GENES ENVOLVIDOS NOS ASPECTOS FARMACOCINÉTICOS E FARMCODINÂMICOS DA TERAPIA ANTIRETROVIRAL COMBINADA E A OCORRÊNCIA DE LIPODISTROFIA, DISLIPIDEMIAS E OUTROS EFEITOS ADVERSOS EM PACIENTES SOB ESTA TERAPIA.

Metodologia: As amostras de sangue coletadas serão centrifugadas e armazenadas no Laboratório de Pesquisa Cardio-vascular no Centro de Pesquisa do Hospital de Clínicas de Porto Alegre (HCPA) sob refrigeração por, no máximo, 72 horas. As amostras serão encaminhadas para o laboratório de DNA do Departamento de Gené-tica da UFRGS, onde serão realizadas as análises genéticas e as amostras de sangue dos pacientes que auto-rizarem posteriores análises mediante assinatura do consentimento livre e esclarecido serão armazenadas por um período de 5 anos. Demais exames (perfil lipídico, carga viral, CD4) fazem parte da rotina assistencial do paciente. Todos os dados serão armazenados em um banco de dados no programa Microsoft Excel para posterior análise. "Metodologia laboratorial Será realizado um levantamento em diferentes bases de dados, como OMIM, LocusLink e dbSNP (dis-poníveis em http://www.ncbi.nlm.nih.gov), bem como uma revisão da literatura em busca de variantes fre-qüentes descritas para cada um dos genes analisados, dando-se preferência àquelas levando a substituições de aminoácidos na proteína codificada e/ou às localizadas na região promotora dos genes a serem investiga-dos. Serão desenhados "primers" flanqueando as regiões de interesse, que serão amplificadas pela técnica da reação em cadeia da polimerase (PCR). Os polimorfismos serão detectados por clivagem com endonuclea-ses de restrição ou seqüenciamento, quando necessário. As amostras dos pacientes serão simultaneamente genotipadas para um conjunto de marcadores de DNA que será utilizado como um controle genômico com a finalidade de eliminar o problema de estratifica-ção populacional. Os pacientes serão selecionados no ambulatório de HIV/AIDS do Hospital de Clínicas de Porto Alegre (HCPA). "Tamanho da amostra A amostra a ser analisada será constituída de 400 pacientes HIV positivos em tratamento no Ambulatório HIV/AIDS do Hospital de Clínicas de Porto Alegre, que constitui 1/3 dos pacientes em uso de anti-retrovirais do ambulatório. "Critérios de inclusão -Idade igual ou superior a 18 anos -Estar utilizando, regularmente, terapia anti-retroviral há pelo menos um ano. "Critério de exclusão -Doença neurológica que impeça o paciente de entender o estudo. Os pacientes serão selecionados durante os turnos de atendimento ambulatorial. Após identificação dos pacientes, serão explicados os objetivos do estudo. Mediante a concordância em participar do mesmo e assinatura do termo de consentimento livre e esclarecido, para aqueles incluídos no estudo, será preenchido um formulário inicial com dados demográficos, uso de medicações, avaliação antropométrica e comorbida-des. Será colhida uma amostra de sangue total com anticoagulante (EDTA) e uma amostra em tubo seco (10 ml). Os dados obtidos dos pacientes, bem como seus genótipos, serão armazenados em um banco de dados no programa Microsoft Excel para posterior análise. -Análise estatística A análise estatística será realizada no programa SPSS 11.0. As freqüências alélicas e genotípicas serão comparadas entre os grupos de pacientes com ou sem reações adversas através de teste qui-quadrado. As médias de parâmetros bioquímicos serão comparadas entre os diferentes genótipos através de análises de variância. As variáveis que contribuem para os fenótipos analisados serão determinadas através de regressão logística.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: BÁSICA OU FUNDAMENTAL

Produção Científica


Projeto: USO DE DROGAS E ÁLCOOL E ADESÃO AO TRATAMENTO ANTI-RETROVIRAL NA INFECÇÃO PELO HIV.
Coordenador: ANDRE MALBERGIER
Resumo: O Projeto Uso de Drogas e Álcool e Adesão ao Tratamento Anti-Retroviral na Infecção pelo HIV visa comparar a adesão ao tratamento anti-retroviral em pacientes infectados pelo HIV usuários de álcool e drogas e não usuários bem como avaliar o impacto na adesão ao tratamento anti-retroviral e no consumo de álcool e drogas após intervenção específica para usuários de álcool e drogas infectados pelo HIV no Bairro Bela Vista no Município de São Paulo. Este estudo baseia-se na premissa de que encontrar estratégias que promovam o aumento da adesão dos pacientes aos esquemas terapêuticos é contribuir, no âmbito da saúde, para a efetivação do processo de construção e exercício da cidadania. O objetivo final deste trabalho é, através de intervenções psicoeducativas, aumentar a adesão dos pacientes usuários de álcool e outras drogas ao tratamento anti-retroviral em um serviço especializado no tratamento da infecção pelo HIV do município de São Paulo. Para se atingir tal objetivo, inicialmente iremos avaliar a adesão em pacientes usuários de álcool e drogas e compará-los aos não usuários. Conhecendo a adesão, iniciaremos uma intervenção breve que será avaliada no seu término e após seis meses. A adesão pode proporcionar maior vínculo do paciente com a equipe de tratamento e assim, aumentar a probabilidade deste paciente controlar sua doença. É esperado que o paciente, aderido ao tratamento, tenha orientações constantes sobre sua doença, sobre as medicações necessárias, efeitos colaterais e conseqüências do abandono do tratamento ou de sua manutenção. Assim, espera-se que o paciente adquira melhor qualidade de vida.

Objetivo: COMPARAR A ADESÃO AO TRATAMENTO ANTI-RETROVIRAL EM PACIENTES INFECTADOS PELO HIV, USUÁRIOS DE ÁLCOOL E DROGAS E NÃO USUÁRIOS.

Metodologia: Este estudo será desenvolvido pelo GREA - Grupo Interdisciplinar de Estudos de Álcool e Drogas do Instituto de Psiquiatria do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo (IPq-HC-FMUSP) e pelo Serviço de Extensão ao Atendimento de Pacientes HIV/AIDS da Divisão de Clínicas de Moléstias Infecto-Contagiosas e Parasitárias do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo ("Casa da AIDS"). Os pacientes que participarão desta pesquisa são atendidos na Casa da AIDS. De acordo com a literatura pesquisada, os índices de adesão à terapia anti-retroviral variam entre 40% e 80% (Knobel et al., 2002). Supondo a prevalência de 20% de não-adesão, =5%, precisão de ± 5% e um intervalo de confiança de 95%, chegou-se a um total de 455 pacientes entre uma população de 3.000 pacientes em tratamento para serem avaliados quanto à presença de transtornos relacionados ao uso de substância, depressão, ansiedade e adesão ao tratamento. Para fim deste estudo, serão escolhidos sistematicamente os primeiros cinco pacientes que chegarem ao ambulatório da "Casa da Aids" para atendimento nos períodos matinal, vespertino e noturno e que aceitem participar do mesmo. Se houver recusa por parte de algum paciente, serão chamados novos pacientes até se completar o número necessário para aquele período (cinco). Os pacientes, selecionados através dos critérios de inclusão e exclusão (listados a seguir) serão convidados a participar do estudo e, após a leitura e assinatura do termo de consentimento (ANEXO), responderão a questionários e entrevistas visando avaliá-los quanto à presença de transtornos relacionados ao uso de substâncias psicoativas, depressão, ansiedade e adesão ao tratamento da infecção pelo HIV. Os critérios de inclusão são: 1. Idade entre 18 e 60 anos; 2. Estar em tratamento com terapia anti-retroviral; 3. Residência na Grande São Paulo; 4. Ter telefone para contato. Critérios de exclusão: 1. Pacientes que não possuem telefone ou endereço fixo para contato; 2. Pacientes com quadro de demência que apresentarem escores abaixo de 24 no MEEM, considerado indicativo de alterações cognitivas difusas. Questionários a serem aplicados em todos os pacientes no início do estudo: 1. Questionário sócio-demográfico 2. Mini Exame do Estado Mental - MEEM (Folstein et al., 1975) - entrevista para detecção de prejuízos cognitivos/demência. 3. SCID 2.0: entrevista diagnóstica de transtornos mentais segundo o DSM-IV (Associação Psiquiátrica Americana). Traduzida para o português por Tavares (1996), a SCID 2.0 se inicia por uma seção de revisão geral, como um roteiro de entrevista clínica não-estruturada, e, em seguida, é dividida em módulos que correspondem às categorias diagnósticas maiores. Os critérios diagnósticos estão presentes no próprio corpo do instrumento, facilitando a elaboração do diagnóstico conforme a entrevista progride. Uma característica essencial da SCID 2.0 é que, embora as perguntas sejam estruturadas, a pontuação se refere ao julgamento clínico do entrevistador, com relação à presença ou não de determinado critério, e não à resposta dada pelo paciente. Esta característica do instrumento torna necessário o treinamento do entrevistador assim como bons índices de concordância com a utilização de versões traduzidas. Serão utilizadas as seções da SCID 2.0 para abuso e dependência de substâncias, depressão e ansiedade. 4. Escalas de Hamilton para ansiedade e depressão. A Escala de Avaliação de Depressão de Hamiltom (HAM-D) foi desenvolvida por Hamiltom há mais de 40 anos (Hamiltom, 1960). Será utilizada a versão de 17 itens, que é uma das mais aplicadas em estudos para avaliação da presença e gravidade de sintomas depressivos. A Escala de Avaliação de ansiedade de Hamiltom (HAM-A) (Hamilton, 1959) é composta de 14 itens. 5. Questionário SDS. Questionário para avaliação de gravidade de uso de drogas traduzido e validado por Ferri (2000). 1. Você chegou a pensar que o seu uso de (nome da droga) estava fora de controle? 2. A idéia de não conseguir tomar uma dose da droga deixa você preocupado / ansioso? 3. Você se preocupa com o seu uso de (nome da droga)? 4. Você gostaria de ser capaz de parar de usar (nome da droga)? 5. Quão difícil você acha que seria parar ou ficar sem (nome da droga)? 6. AUDIT. Questionário de risco para uso de álcool. O Alcohol Use Disorders Identification Test (AUDIT) é um questionário auto-administrado e desenhado especialmente para uso não especializado, cuja duração não leva mais que 2 a 3 minutos. Foi criado e promovido pela OMS (1992) como instrumento de detecção de consumo de álcool em níveis de risco e prejudicial em pacientes de serviços de atenção primária. É composto por 10 itens que cobrem informações referentes à conduta de consumo e de problemas relacionados. Seus critérios de validação (sensibilidade e especificidade) mostraram-se superiores a 90% para detectar consumidores de risco e consumo prejudicial. Sua abrangência temporal está relacionada ao consumo recente embora reconheça complicações no último ano. O AUDIT é validado em vários países, inclusive no Brasil, apresentando níveis de sensibilidade de 87,8% para o uso nocivo de álcool e o seu desempenho foi avaliado positivamente para sua utilização em serviços de atenção primária à saúde. Além disso, na validação brasileira, o AUDIT apresentou uma confiabilidade satisfatória e capacidade de responder às mudanças do consumo (Méndez, 1999). 7. Levantamento sobre Consumo de drogas. 8. QSAM (questionário de adesão ao tratamento para o HIV) e questionário de adesão elaborado pela equipe. 1) Você esqueceu alguma vez de tomar seus remédios? Sim ( ) Não ( ) 2) Você fica às vezes preocupado sobre tomar seus remédios? Sim ( ) Não ( ) 3) Às vezes, quando você se sente mal, você para de tomar seus remédios? Sim ( ) Não ( ) 4) Sobre a ultima semana: Quantas vezes você não tomou seus remédios? Nunca ( ) 1 a 2 vezes ( ) 3 a 5 vezes ( ) 6 a 10 vezes ( ) mais de 10 vezes ( ) 5) No ultimo fim-de-semana você não tomou seus remédios? Sim ( ) Não ( ) 6) Nos últimos 3 meses, em quantos dias você não tomou nenhum dos seus remédios? Até 2 dias ( ) Mais de 2 dias ( ) O Questionário Simplificado de Adesão à Medicação (QSAM), que é constituído por 6 questões, foi criado e validado por Knobel et al. (2002) e será aplicado para avaliação da adesão. Um resultado positivo para o QSAM indica que o paciente não aderiu ao tratamento. São considerados resultados positivos para o QSAM uma resposta positiva para qualquer uma das questões qualitativas, mais de duas doses perdidas na semana passada, ou mais de 2 dias sem nenhuma medicação nos últimos 3 meses. Além desse questionário, outras perguntas abordando presença às consultas, dificuldades para tomar as medicações e outras variáveis relacionadas à adesão serão realizadas para complementação das informações. Após a primeira entrevista, os pesquisadores também registrarão os valores da contagem de células CD4+ e da carga viral mais recentes no prontuário do paciente avaliado. Um dos pontos mais discutidos na área de dependência de drogas é a confiabilidade do relato de uso por parte dos usuários. Para se obter mais credibilidade e confiabilidade de nossos resultados, os pacientes (que aceitarem) terão sua urina testada para a presença de anfetaminas, cocaína e maconha. Os pacientes que referirem algum consumo de drogas ou 4 episódios de consumo de álcool no último mês (estima-se que serão de 10 a 15% da amostra - 60 pacientes) serão considerados "usuários" e serão comparados aos "não usuários" em relação aos resultados obtidos na aplicação dos questionários e entrevistas que foram descritos acima. Ou seja, no primeiro momento, todos os instrumentos serão aplicados em todos os pacientes selecionados (455). Após esta avaliação, o grupo de "usuários" será encaminhado para orientação e intervenção visando mudanças no consumo de álcool e drogas e melhora da adesão. Após as três sessões de intervenção e após 6 meses do término da intervenção, os usuários serão reavaliados pelos questionários AUDIT, SDS, QSAM e questionário de adesão visando medir a eficácia da intervenção quanto à adesão ao tratamento e os escores obtidos nas escalas de uso de drogas e álcool. As reavaliações serão comparadas com as avaliações dos usuários no momento do início da pesquisa (antes da intervenção). Serão registrados novamente os resultados da Carga Viral e do CD4+ mais próximos da última avaliação (6 meses após o término da intervenção). A avaliação após 6 meses do término da intervenção visa verificar se eventuais mudanças de comportamento adquiridas durante a intervenção se mantém após 6 meses. A inclusão dos pacientes nos grupos de intervenção será baseada somente no relato dos pacientes. A testagem de urina visa somente avaliar a confiabilidade do relato do paciente nesse contexto. No seguimento dos usuários, somente serão utilizados os relatos do consumo e não haverá mais testagem. Os pacientes que recusarem dispor de sua urina para análise mas relatarem que consumiram drogas conforme os critérios descritos acima, também serão encaminhados para os grupos de intervenção. Os não usuários farão somente a primeira avaliação, quando serão comparados aos usuários através dos instrumentos acima citados. Visando não gerar custos aos pacientes que participarem da pesquisa, serão oferecidos vales-transporte e vales-refeição para a locomoção e alimentação respectivamente. Variáveis a serem estudadas no projeto: - Uso de álcool e drogas; - Transtornos de ansiedade e sua gravidade; - Transtornos depressivos e sua gravidade; - Adesão; - Variáveis sócio-demográficas: idade, sexo, renda familiar, estado civil e escolaridade; variáveis clínicas: doenças clínicas associadas e doenças oportunistas; variáveis imunológicas: dosagem de CD4 e CV; - Variáveis relacionadas ao tratamento: esquema anti-retroviral, uso de antidepressivo, tratamento de doenças oportunistas e de doenças associadas; - Confiabilidade do relato do uso de drogas. A intervenção consistirá de 3 encontros de 90 minutos com 10 usuários de álcool ou drogas. Nestes encontros serão discutidos: 1. Benefícios (coisas agradáveis) e custos (desvantagens) associados ao uso da substância. Após o levantamento do histórico do uso da droga e a listagem dos prós e contra em relação a esse uso, procura-se que o paciente consiga perceber e avaliar as desvantagens do uso de substância para seu comportamento. 2. Estratégias para melhora da adesão. Tal intervenção é baseada em modelos de intervenção breve para mudanças de comportamento em usuários de drogas já existentes na literatura. Os pacientes que faltarem a algum encontro serão convocados por telefone para comparecerem ao próximo e tal falta será registrada. No momento da análise, os sujeitos serão alocados em subgrupos diferentes dependendo do número de encontros que compareceram. Os pesquisadores usarão o notebook para aplicar as entrevistas que serão respondidas pelos pacientes e as respostas digitadas pelo entrevistador no momento da entrevista. O computador (desktop) será utilizado para armazenamento do banco de dados e análise estatística, além da redação dos relatórios. A impressora imprimirá os trabalhos realizados nos computadores. Durante a intervenção, serão utilizados mecanismos audio-visuais para torná-la mais dinâmica, didática e interativa. Para isso serão adquiridos data-show, TV e DVD. Os armários serão utilizados para armazenamento dos materiais da pesquisa em local seguro. Para as intervenções serão confeccionados materiais pedagógicos como folders e folhetos. O médico infectologista foi considerado contrapartida do serviço já que é o profissional que acompanha clinicamente os pacientes da pesquisa e pede os exames de contagem de CD4 e carga viral em sua rotina do serviço. A assistente social, pertencente ao corpo de funcionários da Casa da AIDS, auxiliará na abordagem, convocação e orientação dos pacientes da pesquisa e também não será paga pelo projeto, sendo que sua remuneração será considerada como contrapartida do serviço.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: COMPORTAMENTAL

Produção Científica


Projeto: PREVALÊNCIA DA CO-INFECÇÃO HIV/TUBERCULOSE EM POPULAÇÃO DE UM COMPLEXO PENITENCIÁRIO NA BAHIA.
Coordenador: ANTONIO CARLOS MOREIRA LEMOS
Resumo: O Projeto Prevalência da Co-Infecção HIV/Tuberculose em População de um Complexo Penitenciário na Bahia visa avaliar os indicadores epidemiológicos da co-infecção TB-HIV e da TB na população de um Complexo Penitenciário na Bahia. Ampliar o entendimento da situação epidemiólogica co-infecção HIV-tuberculose (HIV-TB) em população carcerária do estado da Bahia - enfatizando a transmissibilidade da TB nesta população.

Objetivo: AVALIAR OS INDICADORES EPIDEMIOLÓGICOS DA CO-INFECÇÃO TB-HIV DA TB NA POPULAÇÃO DE UM COMPLEXO PENITENCIÁRIO NA BAHIA.

Metodologia: O delineamento do estudo será de uma coorte prospectiva. Inicialmente será realizada uma avaliação transversal dos internos participantes do estudo, constando de exame clínico e complementares (sorologia anti-HIV 1 e 2, teste tuberculínico, Radiografias de tórax e exames bacteriológicos - baciloscopia e cultura para micobactérias do escarro espontâneo, lavado bronco-alveolar e ou biópsia transbrônquica) para avaliar a prevalência da co-infecção HIV-TB e da TB-doença e TB-infecção no tempo inicial do estudo. Os internos participantes do estudo serão acompanhados por período de hum ano com vigilância ativa de presença de sintomas gerais e específicos compatíveis com TB-doença. A cada três meses novas avaliações clínica, radiológica e bacteriológica (baciloscopia e cultura para micobactéria do escarro e lavado bronco-alveolar e ou biópsia transbrônquica) serão repetidas para detecção precoce de casos. Os casos novos de TB-doença dignosticados serão avaliados para HIV, caso o primeiro teste seja negativo. Critérios de inclusão e exclusão Serão elegíveis para participar do atual estudo todos os internos do CPLM albergados durante o período do estudo - de julho de 2006 a julho de 2007 - com pena a cumprir no início do estudo superior a hum ano. Os critérios de exclusão do atual estudo serão: (1) recusa em participar do estudo; (2) transferência para outras unidades prisionais na Bahia ou em outras unidades federadas. Variáveis Variáveis respostas (de maior interesse): TB-doença, TB-infecção, Co-infecção TB-HIV. Outras variáveis serão consideradas no atual estudo: 1) Variáveis demográficas: idade, sexo, cor de pele; 2) Variáveis clínicas: tosse, expectoração, febre, hemoptise, dor torácica, dor torácica, perda ponderal, índice de massa corpórea, presença de co-morbidades; 3) Variáveis epidemiológicas e de estilo de vida: história anterior de tratamento para TB, abandono de tratamento para TB, história de contato com portador de TB nos últimos cinco anos, presença de cicatriz vacinal, alcoolismo, tabagismo, uso de drogas ilícitas, tempo de encarceramento, estado marital, origem (capital, interior, outro estado), situação de emprego, lotação no CPLB; 4) Variáveis radiográficas: presença de infiltrado, cavitações (uni ou bilaterais) e localização da lesões. 5) Variáveis laboratoriais: (a) bacteriológicas: baciloscopia e cultura para micobactériaa do escarro (b) teste de sensibilidade; (c) teste tuberculínico ; (d) sorologia para HIV; (e) biologia molecular: presença de padrão cluster - identificação do fingerprinting do DNA das cepas M. tuberculosis isoladas nas culturas. Operacionalização das variáveis Todos os internos do CPLB com tempo de pena a cumprir igual ou superior a 1 ano serão elegíveis e convidados a participar do estudo, através da leitura, entendimento e assinatura do termo de consentimento livre e esclarecido. Os internos que concordarem em participar do estudo serão entrevistados por uma equipe de médicos do serviço médico do CPLB. Um questionário padronizado será preenchido nesta ocasião, contendo as variáveis clínicas, epidemiológicas e de estilo de vida acima especificadas. Todos os internos serão submetidos inicialmente a radiografia de tórax em PA e perfil e teste tuberculínico (utilizando o PPD RT23, através da técnica de Mantoux - conforme padronização do Ministério da Saúde) no próprio serviço médico do CPLB. Três auxiliares de enfermagem do CPLB serão capacitados pela equipe do Laboratório do Hospital Especializado Octávio Mangabeira para uniformização dos procedimentos de aplicação e leitura do teste tuberculínico, garantindo menor probabilidade de erro de técnica e de diferenças inter-observador na leitura. Serão considerados reatores ao PPD: (1) induração ? 10 mm no grupo HIV-negativos e (2) induração ? 5 mm no grupo HIV- positivo. Nos internos com sintomas respiratórios ou anormalidade nas radiografias de tórax, as amostras de escarro serão coletadas no próprio CPLM e encaminhadas para o laboratório do Hospital Especializado Octávio Mangabeira e Laboratório Central Gonçalo Muniz (LACEN-Bahia) para processamento de exames de baciloscopia (pelo método de Ziehl-Neelsen) e cultura para micobactérias (em meio sólido de Löwenstein-Jesen). Nos internos sem presença de escarro espontâneo será procedida a coleta de espécimes respiratórias por outro método, como escarro induzido ou lavado bronco-alveolar no Hospital Especializado Octávio Mangabeira. Todas as culturas com crescimento de colônias de micobatérias serão enviadas ao LACEN-Bahia para exames de (1) identificação de espécie, através de métodos bioquímicos e (2) teste de sensibilidade às drogas anti-TB, através método das proporções. A sorologia para HIV será oferecida para todos os presidiários, independente da presença de fatores preditores de infecção. Será procedida uma abordagem de aconselhamento pré-teste e posteriormente pós-teste pela equipe de saúde do CPLB para todos os internos. O material coletado na própria penitenciária por equipe treinada de auxiliares de enfermagem e técnicos de laboratório e encaminhada para o LACEN-Bahia. Será utilizado teste de ELISA para triagem e Western-Blott, como teste confirmatório, nas amostras ELISA-positivo. Todas as cepas de M. tuberculosis isoladas dos presidiários serão analisadas pelo Laboratório de Biologia Molecular da FIOCRUZ-Bahia para identificação do fingerprinting do DNA do M. tuberculosis, através da técnica de RFLP (restriction fragment-lenght polymorphism). Este método, resumidamente, é baseado na identificação da variação no número e na posição da seqüência IS6110 no genoma do M. tuberculosis. A cada 3 meses todos os prisioneiros serão submetido à nova reavaliação, constando de exame clínico, radiografias de tórax e bacteriológicos (baciloscopia e cultura para micobactérias). Nos não infectados inicialmente será repetido teste tuberculínico no momento das reavaliações. Análise estatística Para análise dos dados será utilizado o programa estatístico SPSS, versão 9.0. As variáveis categóricas serão descritas através de proporções e as quantitativas através de suas médias e desvios padrão. Análise univariada exploratória será realizada para identificar os possíveis fatores de riscos para desenvolvimento de Tuberculose. Para avaliar possíveis efeitos de modificação de efeito e/ou confundimento nas associações brutas observadas na análise exploratória será utilizada a técnica regressão logística

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Populações confinadas adultas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: EPIDEMIOLÓGICA

Produção Científica


Projeto: ASSOCIAÇÃO ENTRE CARGA VIRALVAGINAL DE HIV E DE HPV EM MULHERES INFECTADAS PELO HIV.
Coordenador: ELIANA MARTORANO AMARAL
Resumo: O Projeto Associação entre Carga Viral Vaginal de HIV e de HPV em Mulheres Infectadas pelo HIV visa avaliar a existência de associação entre a carga viral de HIV e de HPV no ambiente vaginal em mulheres infectadas pelo HIV e os potenciais fatores confundidores desta associação referentes ao ambiente vaginal, plasmático e terapia HAART atendidas no Centro de Inegração de Atenção Integral à Saude da Mulher (CASIM) da Unicamp, em Campinas, São Paulo.

Objetivo: AVALIAR SE EXISTE ASSOCIAÇÃO ENTRE CARGA VIRAL DE HIV E DE HPV NO AMBIENTE VAGINAL EM MULHERES INFECTADAS PELO HIV E OS POTENCIAIS FATORES CONFUNDIDORES DESTA ASSOCIAÇÃO REFERENTES AO AMBIENTE VAGINAL, PLASMÁTICO E TERAPIA HAART.

Metodologia: Serão selecionadas as mulheres com sorologia positiva para o HIV que são atendidas no Ambulatório de Infecções Genitais II do CAISM - UNICAMP, no momento em que vêm para consulta ginecológica de rotina. As pacientes serão convidadas a participar do estudo e deverão passar pelo processo de consentimento livre e esclarecido, assinado o formulário próprio. Responderão as perguntas do questionário, sendo, a seguir, submetidas a exame ginecológico e coleta de amostras. Inicialmente será colhido conteúdo de terço posterior da parede lateral da vagina para bacterioscopia a fresco e corada pelo Gram pára pesquisa de infecções e escore de Nugent. Posteriormente, será feita a coleta do lavado cervico-vaginal com 10 mL de solução salina para dosagem de vírus livre. Finalmente, serão colhidos as amostras endocervicais Clamydia trachomatis, Neisseria gonorrhoea (captura híbrida II) e HPV através de swab, usando captura híbrida II.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICA

Produção Científica


Projeto: PERFIL DE RESISTÊNCIA GENOTÍPICA DO HIV-1 AOS ANTI-RETROVIRAIS EM UMA POPULAÇÃO DE CRIANÇAS INFECTADAS PELO HIV POR TRANSMISSÃO VERTICAL, NASCIDAS DE MÂES POSITIVAS PARA O HIV EXPOSTAS A TERAPIA ANTI-RETROVIRAL OU SUBMETIDAS A QUIMIOPROFILAXIA COM ANTI-RETROVIRAIS PARA PREVENÇÃO DA TRANSMISSÃO VERTICAL DO HIV DURANTE A GESTAÇÃO.
Coordenador: MARIZA GONÇALVES MORGADO
Resumo: O uso de quimioprofilaxia com anti-retrovirais para mulheres grávidas infectadas pelo HIV-1 representou um impor-tante avanço na prevenção da transmissão vertical (CDC, 1998; CONNOR, 1994; DABIS, 1999; SHAFFER, 1999; WIKTOR, 1999). Entretanto, o amplo uso de agentes anti-retrovirais e o aumento da prevalência de cepas do HIV resistentes às drogas anti-retrovirais trazem questionamentos sobre as possíveis implicações da resistência aos anti-retrovirais no âmbito da transmissão perinatal do HIV-1 (COLGROVE, 1999; MASQUELIER, 1999). O Brasil se destaca entre os países em desenvolvimento por oferecer acesso universal ao tratamento anti-retroviral. Além disso, são disponibilizados também, gratuitamente, exames de contagem de linfócitos TCD4+/TCD8+, quantificação de RNA-HIV-1. Ao final de 2003, cerca de 140.000 indivíduos infectados pelo HIV se encontravam em tratamento anti-retroviral. As atuais recomendações do Ministério da Saúde de quimioprofilaxia com anti-retrovirais para gestantes portadoras de infecção pelo HIV-1, embora permitam o uso de terapia anti-retroviral potente para mulheres com carga viral para o HIV-1 >1000 cópias/mL, continuam admitindo o uso isolado de Zidovudina para aquelas que apresentam Carga Viral do HIV-1 até 10.000 cópias/mL. Além disso, é recomendada, como em outros países, a suspensão da qui-mioprofilaxia anti-retroviral após o parto. Devido à dificuldade em realizar exames de Carga Viral na rede pública, na maior parte das vezes, a suspensão dos anti-retrovirais ocorre sem que a quantificação de RNA viral seja de fato avaliada. Existem poucos dados na literatura sobre o desenvolvimento de resistência viral aos anti-retrovirais nas mulheres nestas situações e sobre a transmissão de vírus resistentes para os recém-nascidos infectados. O desenvolvimento de resistência é motivo especial de preocupação no caso de esquemas de quimioprofilaxia com barreira genética limitada, tais como os que contêm Nevirapina. Tal situação poderia acarretar o desenvolvimento de resistência a Nevirapina, e conseqüentemente a outros anti-retrovirais da mesma classe. O desenvolvimento de resistência pode, potencialmente, comprometer futuras opções terapêuticas tanto para as crianças infectadas quanto para as mulheres expostas a quimio-profilaxia com anti-retrovirais, bem como comprometer o uso posterior de quimioprofilaxia em gestações subseqüentes. Da mesma forma, gestantes já submetidas a tratamento anti-retroviral anteriormente a gestação, algumas vezes já tendo experimentado diferentes esquemas terapêuticos, podem acumular variantes virais apresentando mutações de resistência que, mesmo na presença de esquemas terapêuticos durante a gestação podem ser transmitidas ao bebê. Com a realização deste estudo esperamos avaliar a seleção de vírus com mutações que conferem resistência às drogas em mulheres que fizeram profilaxia ou tratamento com anti-retrovirais quando grávidas, e em crianças que adquirirem a infecção dessas gestantes. Além disso, esperamos estimar a taxa de transmissão vertical do HIV nestas populações de gestantes.

Objetivo: Geral: Avaliar a ocorrência e o perfil de resistência genotípica do HIV-1 aos anti-retrovirais em crianças infectadas por transmissão vertical nascidas de mães submetidas a tratamento anti-retroviral ou quimioprofilaxia anti-retroviral durante a gestação. Específicos: Avaliar a ocorrência de mutações de resistência aos antiretrovirais em crianças infectadas pelo HIV por transmissão vertical, nascidas de mães que receberam quimioprofilaxia com anti- retrovirais durante a gestação e o parto. Avaliar a ocorrência de mutações de resistência aos antiretrovirais em crianças infectadas pelo HIV por transmissão vertical, nascidas de mães que recebem tratamento com anti-retrovirais. Avaliar o perfil de resistência primária aos anti-retrovirais em gestantes portadoras de Infecção pelo HIV-1, virgens de tratamento anti-retroviral, diagnosticadas no Pré-Natal. Avaliar o perfil de resistência aos antiretrovirais em gestantes portadoras de infecção pelo HIV-1,virgens de tratamen-to, que fizeram quimioprofilaxia anti-retroviral, e tiveram o esquema interrompido no parto ou pós-parto imediato, e que transmitiram o HIV por via vertical a seus bebês. Avaliar o perfil de resistência aos antiretrovirais em gestantes portadoras de infecção pelo HIV-1, experientes de trata-mento anti-retroviral, que transmitiram o HIV por via vertical a seus bebês. Caracterizar os subtipos virais predominantes nessas populações de gestantes e de crianças. Avaliar a taxa de transmissão vertical do HIV-1 nessas populações. Identificar os fatores demográficos, epidemiológicos, clínicos, imunológicos e virológicos associados à transmissão vertical do HIV e à transmissão de vírus mutantes resistentes aos anti-retrovirais.

Metodologia: Desenho do Estudo: Trata-se de um estudo observacional exploratório, para o qual serão convidadas a participar todas as gestantes portadoras de Infecção pelo HIV-1 que estejam em acompanhamento no ambulatório de Pré-Natal do Hospital Geral de Nova Iguaçu/MS e no ambulatório de Pré-Natal do Instituto Fernandes Figueira/FIOCRUZ, no período de 18 meses a contar de 01 Outubro de 2005, que (1) tenham recebido quimioprofilaxia com antiretrovirais para prevenção da transmissão perinatal do HIV-1 e, (2) que tenham recebido tratamento com drogas anti-retrovirais antes e/ou durante a gestação. Estas dois grupos de pacientes serão acompanhadas com exame de CD4 e carga viral, além de ser preenchido um questionário com os dados clínicos e laboratoriais durante a gestação. Para as gestantes com experiência terapêutica antes da gestação será colhida a informação sobre as terapias utilizadas. Estima-se que nas duas unidades faremos acompanhamento de 250 gestantes portadoras de infecçãopelo HIV no período de 18 meses, com uma taxa de transmissão vertical estimada do HIV de 5%. Os esquemas anti-retrovirais combinados utilizados na gestação deverão conter, sempre que possível, zidovudina e lamivudina, associados a nelfinavir ou nevirapina (MS, 2003). Os bebês serão acompanhados desde o nascimento, através da quantificação de RNA para HIV-1 no sangue periférico nas primeiras 48 horas de vida, com um mês de vida e, posteriormente, aos quatro e seis meses de vida. Se em algum momento a quantificação de RNA para HIV-1 for positiva deverá ser colhida nova amostra imediatamente para con-firmação, realização de CD4+/CD8+ e genotipagem. Como ainda não se conhece bem o efeito do tratamento quimioprofilático em gestantes quanto à seleção de variantes virais resistentes, esse grupo de gestantes virgens de tratamento antes da gravidez, submetidas a quimioprofilaxia anti-retroviral durante o período gestacional serão acompanhadas com exames de CD4, carga viral e genotipagem antes da introdução da quimioprofilaxia, no momento do parto ou no pós-parto imediato, com duas semanas após o parto, com 01 mês e seis meses após a interrupção dos antiretrovirais, no intuito de detectar a presença de mutações de resistência viral ao esquema utilizado durante o pré-natal que é interrompido na hora do parto. Caso a genotipagem do HIV-1 não indique a presença de variantes virais resistentes aos anti-retrovirais no momento do parto e com duas semanas após a interrupção das drogas antiretrovirais, não haverá necessi-dade de realização da mesma com seis meses após o parto. As gestantes com tratamento antiretroviral prévio a gestação deverão colher sangue para estudos imunológicos e virológicos no momento da assinatura do termo de consentimento livre e esclarecido e no parto ou pós-parto imediato.Estas gestantes deverão apresentar evidência de infecção pelo HIV documentada por testes de anticorpos ELISA, confirmada por imunofluorescência e/ou Western Blot; gravidez com idade gestacional estimada de pelo menos 14 semanas, com base na história menstrual e/ou ultra-sonografia; não ter feito uso prévio de drogas anti-retrovirais; não ter indicação de tratamento anti-retroviral. Seleção dos Participantes: Todas as gestantes portadoras de infecção pelo HIV, virgens de tratamento ou não, em acompanhamento Pré-Natal no Hospital Geral de Nova Iguaçu e no ambulatório de Pré Natal do Instituto Fernandes Figueira/FIOCRUZ, serão convidadas a participar desse estudo. Critérios de Inclusão: Gestantes que tenham iniciado quimioprofilaxia anti-retroviral para prevenção da transmissão vertical durante a gestação ou gestantes em tratamento terapêutico antes e/ou durante a gestação. Ter pelo menos 16 anos de idade; dispor formulário de consentimento esclarecido assinado da paciente e/ou seu responsável legal. Critérios de Exclusão: Mulheres que não concordem em fazer tratamento regular durante o estudo. Técnicas: Os procedimentos deste estudo envolvem a aplicação de um formulário pré-estruturado onde serão captura-dos dados demográficos, estagiamento clínico, história de outras Infecções Sexualmente Transmissíveis, fatores de risco, e exames laboratoriais de rotina. Nenhum procedimento do estudo será realizado antes da leitura, explicação, entendimento e assinatura do Termo de Consentimento Livre e Esclarecido. O questionário é composto de perguntas de múltipla escolha sobre informações sócio-demográficas e comportamentais (uso de drogas e bebidas alcoólicas e relações sexuais), infecções sexualmente transmissíveis, e fatores de risco. No Termo de Consentimento Livre e Esclarecido fornecido para a gestante, será solicitado que a mesma decida se consente a realização de quantificação de RNA para HIV-1 no sangue do bebê nas primeiras 48 horas de vida, com um mês de vida e posteriormente aos quatro e seis meses de vida. Se em algum momento a quantificação de RNA para HIV-1 for positiva deverá ser colhida nova amostra imediatamente para confirmação, realização de CD4+/CD8+ e genotipagem.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: CARACTERIZAÇÃO FENOTÍPICA E GENOTÍPICA DE LEVEDURAS DO GÊNERO CANDIDA ASSOCIADAS A FUNGEMIAS E CANDIDIASE MUCOCUTANEA EM PACIENTES COM HIV EM UNIDADES HOSPITALARES DA CIDADE DO RIO DE JANEIRO.
Coordenador: ROSELY MARIA ZANCOPÉ OLIVEIRA
Resumo: O Projeto Caracterização Fenotípica e Genotípica de Leveduras do Gênero Candida Associadas a Fungemias e Candidíase Mucocutânea em Pacientes com HIV em Unidades Hospitalares da Cidade do Rio de Janeiro visa a identificação e caracterização em nível morfológico, bioquímico, fisiológico e de susceptibilidade a antifúngicos das leveduras associadas a episódios de fungemia e de candidíase mucocutânea em unidades hospitalares do Rio de Janeiro, bem como a caracterização genotípica da amostragem a ser analisada visando o aprimoramento do conhecimento científico em candidíases em portadores do vírus HIV, visando a melhoria da qualidade das ações e intervenções neste campo. Nos últimos anos, vem sendo observada uma disseminação global de certas variantes epidêmicas de microrganismos. Essa disseminação é freqüentemente associada a uma maior virulência (vantagem adaptativa) ou a emergência de novas características de resistência a drogas, envolvendo invariavelmente um aumento da morbidade e mortalidade pelas doenças associadas a quadros imunossupressivos, tal como a AIDS. O conhecimento de características fenotípicas e genotípicas de microrganismos que devido a uma depressão do sistema imune passam a interagir como patógenos, entre eles, Candida spp., é de fundamental importância para basear estratégias de tratamento, prevenção e controle de infecções oportunistas em pacientes portadores de HIV, bem como em outros pacientes imunodeprimidos, possibilitando também a previsão de surtos graves antes mesmo que estes se estabeleçam.

Objetivo: IDENTIFICAÇÃO E CARACTERIZAÇÃO EM NÍVEL MORFOLÓGICO, BIOQUIMICO, FSIOLÓGICO E DE SUSCEPTIBILIDADE A ANTIFÚNGICOS DAS LEVEDURAS ASSOCIADAS A EPISÓDIOS DE FUNGEMIA E DE CANDIDÍASE MUCOCUTANEA EM UNIDADES HOSPITALARES DO RIO DE JANEIRO, BEM COMO A CARACTERIZAÇÃO GENOTÍPICA DA AMOSTRAGEM A SER ANALISADAVISANDO O APRIMORAMENTO DO CONHECIMENTO CIENTÍFICO EM CANDIDÍASES EM PORTADORES DO VIRUS HIV, VISANDO A MELHORIA DA QUALIDADE DAS AÇÕES E INTERVENÇÕES NESTE CAMPO.

Metodologia: Amostragem: Serão incluídos neste estudo isolados de Candida oriundos de pacientes portadoras do HIV atendidos nas três unidades hospitalares envolvidas no projeto [Instituto de Pesquisa Clínica Evandro Chagas (IPEC-FIOCRUZ), Instituto Fernandes Figueira (IFF - FIOCRUZ) e Hospital dos Servidores do Estado do Rio de Janeiro (HSE). Até o presente, 150 leveduras já foram isoladas de amostras biológicas de pacientes portadores do HIV com quadro clínico de fungemia, de candidíase oral e candidíase vulvovaginal , e estão sendo mantidas no Setor de Imunodiagnóstico/Diagnóstico Micológico do Serviço de Micologia do IPEC para inclusão neste estudo. Todas estas amostras foram obtidas rotineiramente através de suspeita clínica de candídiase, e confirmação laboratorial. Prospectivamente, todos as leveduras isoladas de hemoculturas e/ou de secreções orais e vaginais de pacientes com AIDS nas três unidades hospitalares envolvidas no projeto serão encaminhadas para o Serviço de Micologia do IPEC para caracterização fenotípica e genotípica. Cálculo amostral. Com base na teoria de amostragem, estabeleceremos a análise das relações existentes entre a população e as amostras extraídas. Atualmente dispomos 150 isolados de Candida no Serviço de Micologia do IPEC relacionados a casos de candidíase com diferentes formas clínicas provenientes de pacientes com HIV. Para o cálculo do tamanho de cada amostra será utilizado critério de conveniência. Caracterização fenotípica dos isolados: Para identificação de espécie e caracterização fenotípica, os isolados à partir do subcultivo inicial serão inoculados novamente em placas de Petri contendo ágar Sabouraud para observação da morfologia da colônia, e em placas de CHROMagar Candida. Nesse meio, o isolamento e a identificação presuntiva serão obtidos com base na pigmentação devido à produção de enzimas que reagem com o substrato cromógeno contido no meio. Todos os isolados com morfologia compatível com Candida serão reavaliados por provas convencionais (morfologia) e API 20 C (Bio Meuriex) a partir do perfil bioquímico e da fermentação e assimilação de açúcares. Teste de suscetibilidade a antifúngicos: Todos isolados incluídos neste estudo serão submetidos inicialmente ao Teste E (AB BioDisk, Solna, Sweden) obedecendo às especificações do fabricante. No Teste E como em outros métodos baseados na difusão, os MICs para as espécies de Candida podem ser reportados a 48 horas de incubação para 93% dos isolados testados. Após a incubação, a leitura da concentração inibitória mínima (CIM) será feita considerando a intersecção da borda da zona de inibição elíptica com a escala existente na tira. Nos isolados onde o fenômeno do "trailing" possa ocorrer será realizado também o teste de sensibilidade aos antifúngicos utilizando-se o método padronizado de macrodiluição em meio líquido (M27-P) recomendado pelo Comitê Nacional de Padronização Laboratorial Clínica (Villanova, Pa). Os MICs serão determinados após 48 horas de incubação a 35ºC pela comparação visual da turbidez de cada MIC em tubo com um percentual padronizado de 80% de inibição. O MIC- 80% será considerado como a menor concentração da droga com uma turbidez menor ou igual que aquela do tubo padrão. Em ambos os testes serão utilizados os antifúngicos itraconazol, anfotericina B, fluconazol e ketoconazol em diferentes concentrações, as quais serão padronizadas segundo recomendações da literatura. Extração do DNA: Técnicas convencionais utilizadas para a extração e purificação do DNA genômico dos fungos serão aplicadas em todos os isolados estudados. Utilizaremos o kit PUREGENE (Gentra Systems) para extração do DNA das células leveduriformes. As células fúngicas serão lisadas, as proteínas serão precipitadas e o sobrenadante contendo o DNA purificado será precipitado. Após precipitação, o DNA será hidratado com tampão Tris-EDTA e tratado com RNAse. O material extraído será estocado a 2 - 8 ºC "overnight", e então serão armazenados a - 20°C até o momento de uso. Reação de polimerase em cadeia associada a ensaio imunoenzimático (PCR-EIA). Este método consiste na amplificação da região ITS2 do rDNA fúngico com seqüências iniciadoras nucleotídicas universais. O produto de amplificação será então hibridizado com sondas específicas de C. albicans, C. krusei, C. parapsilosis, C. tropicalis e C. glabrata marcadas com digoxigenina (DIG) e sondas genéricas marcadas com biotina previamente sintetizadas no Centers for Disease Control and Prevention (CDC). Este complexo de DNA será transferido para placas de microtitulação cobertas com estreptoavidina, e uma reação imunoenzimática utilizando conjugado anti-DIG marcado com peroxidase será conduzida para detecção do DNA capturado pela placa. Reação de polimerase em cadeia com seqüências iniciadoras arbritárias (RAPD): Para tal, será utilizado o kit Ready-to-Go RAPD Analysis Beads (Amersham Pharmacia Biotech INC), onde seis seqüências iniciadoras nucleotídicas com 10-mer ("primers") serão previamente selecionadas em estudo-piloto para avaliação da capacidade discriminatória de cada seqüência do teste. Após a escolha de no mínimo três seqüências iniciadoras, a reação será desenvolvida de acordo com as recomendações inseridas no kit, pelo fabricante. Após eletroforese e coloração com brometo de etídio (concentração final 10 µg/ml), o gel será fotografado para análise posterior, através da observação visual e computacional. Tipagem pelo M-13: Serão utilizados oligonucleotídeos específicos da seqüência minisatélite M-13 (5´-GAGGGTGGCGGTTCT-3´). Para realização do PCR a reação de amplificação será feita num volume final de 50 L contendo 25ng do DNA genômico, 10mM Tris-HCL, pH 8.3, 50mM Cloreto de potássio, 1.5 mM de Cloreto de Magnésio, 0.2mM de cada dNTP (dATP, dCTP, dGTP e dTTP) , 3mM de Acetato de Magnésio, 30ng do primer M13 e 2.5 unidades de Taq DNA polimerase. As condições de amplificação do PCR serão: 35 ciclos de 20´ de desnaturação a 94ºC, 1´ de pareamento a 50ºC, e 20´´ de extensão a 72ºC, seguido de uma extensão final de 6´ a 72ºC. A eletroforese será realizada em gel de agarose a 1.4% em TBE (0.1 M Tris, 0.09 M ácido bórico, 0.001 M EDTA [pH 8.4]) aproximadamente por 6 horas a 60 V. O gel será corado por brometo de etídio (0.5 g/mL em água destilada) por 30` e lavado por 30` com água destilada. O produto do PCR será visualizado em um transiluminador de UV e depois fotografado. Técnicas de Hibridização: Southern blot com sonda genética Ca3 e Cp3-13. Será desenvolvido para esta etapa o protocolo descrito por Enger e colaboradores (2001). Os DNAs extraídos de todas as amostras de C. parapsilosis serão digeridos com a enzima de restrição EcoRI por 16 h a 37°C. Após digestão, a corrida eletroforética em gel de agarose a 0,75% será realizada a 55 V, e então serão transferidos para uma membrana de nylon de acordo com o método de Southern blot. Seqüenciamento: O sequenciamento da região intergênica do rDNA será uma abordagem molecular a ser seguida em casos onde métodos convencionais falharem na identificação completa do isolado. Para tanto, será utilizada a técnica de PCR com um par primers específicos que hibridizam com a região de interesse. Posteriormente esses fragmentos serão seqüenciados e tais seqüências serão submetidas em bancos de dados públicos, com objetivo de identificar o agente etiológico através da homologia encontrada entre elas. Esta metodologia é simples, rápida para identificação e uma estratégia factível com a inserção de métodos moleculares na identificação de isolados clínicos. Até o presente, 150 leveduras já foram isoladas de amostras biológicas de pacientes portadores do HIV com quadro clínico de fungemia, de candidíase oral e candidíase vulvovaginal provenientes de provenientes das três unidades hospitalares envolvidas neste estudo [Instituto de Pesquisa Clínica Evandro Chagas (IPEC-FIOCRUZ), Instituto Fernandes Figueira (IFF - FIOCRUZ) e Hospital dos Servidores do Estado do Rio de Janeiro (HSE)], e estão sendo mantidas no Setor de Imunodiagnóstico/Diagnóstico Micológico do Serviço de Micologia do IPEC para inclusão neste estudo. Todas estas amostras foram obtidas rotineiramente através de suspeita clínica de candídiase, e confirmação laboratorial. Prospectivamente, todos as leveduras isoladas de hemoculturas e/ou de secreções orais e vaginais de pacientes com AIDS nas três unidades hospitalares envolvidas no projeto serão encaminhadas para o Serviço de Micologia do IPEC para caracterização fenotípica e genotípica. A coleta de dados relativos a estas pacientes como idade, sexo, doença de base, administração de antibióticos, antifúngicos e corticosteróides, associação com infecções bacterianas, e recorrência de CVV será realizada no Banco de Dados das diferentes Unidades hospitalares. Serão excluídos do estudo epidemiológico, pacientes cujos prontuários encontram-se incompletos. Banco de dados: Será utilizado o Programa Statistical Package for the Social Sciences (SPSS) versão 8 para armazenamento de dados e futuras análises. Análise Computacional dos Perfis de DNA. Será realizada através do programa Molecular Analyst Fingerprinting Plus Versão 1. 1 2 (Bio-Rad) onde os coeficientes de similaridade (Dice lndex) serão determinados para cada isolado. O grupamento pela média aritmética para determinar os níveis de diversidade ou similaridade entre os grupos será baseado no método denominado UPGMA (unweighted pair group method with arithmetic means).

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: EPIDEMIOLÓGICA

Produção Científica


Projeto: ESTUDO MULTICÊNTRICO PARA AVALIAÇÃO DA CO-INFECÇÃO HIV - HTLV NO BRASIL.
Coordenador: CARLOS ROBERTO BRITES ALVES
Resumo: O Projeto Estudo Multicêntrico para Avaliação da Co-Infecção HIV/HTLV no Brasil visa definir as características clínicas, epidemiológicas, e evolutivas dos pacientes co-infectados pelo HIV-1 e pelo HTLV-1 e -2, permitindo uma comparação de características e peculiaridades da co-infecção em pacientes de São Paulo e Santos (SP), Salvador (BA) e Belém (PA).

Objetivo: O presente projeto visa determinar as características clínicas, epidemiológicas e evolutivas da co-infecção pelo HIV em nosso meio. Para tanto, pretendemos estabelecer uma coorte multicêntrica, envolvendo servi-ços especializados em HIV/AIDS de Salvador, Santos, São Paulo, e Belém. Estes centros foram seleciona-dos com base na existência prévia de estudos envolvendo a população-alvo (co-infectados). Além disso, a inclusão de crianças no estudo levou em consideração a existência de coortes de fácil aceso, e sob acompa-nhamento estrito, em São Paulo, e na Bahia, em número suficiente para permitir maior poder de detecção de eventuais diferenças clínicas e epidemiológicas entre mono-infectados pelo HIV-1, e co-infectados (HIV-HTLV).

Metodologia: Descrição dos centros: Salvador: a Bahia apresenta a maior taxa de prevalência da infecção pelo HTLV-I , no Brasil, a qual atinge 1,8% da população geral. Como conseqüência, a prevalência da co-infecção em portadores do HIV chega a atingir 20% (Brites). Já existe uma coorte em funcionamento no Serviço de Infectologia do Hospital Universitário Prof. Edgard Santos (HUPES), da UFBA, estabelecida em 2002, a qual conta com mais de 350 indivíduos envolvidos, 15% dos quais co-infectados. Além disso, outros 150 pacientes têm sido diagnosticados previamente, como co-infectados, fornecendo informações importantes sobre este problema (Brites). O Centro de Referência Estadual para AIDS (CREAIDS) também participa da coorte, e tem aproximadamente 180 crianças e adolescentes infectados por via vertical, que serão convidados a participar do estudo. Em São Paulo, o Serviço Extensão ao Atendimento de Pacientes com HIV/AIDS da Divisão de Clínica de Moléstias Infecciosas e Parasitárias do HC-FMUSP também conta com uma coorte em andamento, envolvendo 980 pacientes, e embora apresente menor prevalência de co-infecção, em relação à encontrada na Bahia, pode contribuir com neste estudo um número significativo de pacientes co-infectados sob seguimento. Além disso, em Santos, o Centro de Referência de AIDS da Prefeitura daquele município já avaliou 499 pacientes acompanhados naquele serviço avaliação, tendo identificado 67 (14,3%) pacientes co-infectados. E, finalmente, em Belém teremos a oportunidade de avaliar uma população de co-infectados composta predominantemente pelo HTLV-2, em contraste com outros sítios, onde a infecção por HTLV-1 predomina. Em relação ao sub-estudo pediátrico, serão inicialmente recrutadas crianças através de uma rede de serviços composta por centros de referência para atendimento de AIDS infantil, nos municípios de São Paulo (Instituto da Criança do HC-FMUSP, Centro de Referência e Treinamento em DST/AIDS da Secretaria de Estado da Saúde, Ambulatório da Disciplina de Infectologia Pediátrica da Escola Paulista de Medicina-UNIFESP e Instituto de Infectologia Emílio Ribas) e de Santos (Programa de DST/AIDS do município), compreendendo um total de cerca de 560 pacientes infectadas por HIV, nas quais a prevalência de co-infecção por HTLV é ainda desconhecida. Em conjunto, estes centros reúnem a maior experiência brasileira no estudo da co-infecção, e a junção dessas coortes permitirá alcançar um tamanho de amostra que aumentará significativamente o poder do estudo em detectar diferenças entre as populações de mono e co-infectados. Desenho do estudo: o estudo terá desenho tipo caso-controle, 1:1, e será composto de 2 braços: 1. Braço retrospectivo: para avaliação de toda a população de pacientes co-infectados já identificados nos diferentes centros. Nesta fase, coletaremos dados sobre sexo, idade, data do diagnóstico de ambas as infecções, apresentação clínica no momento do diagnóstico, e evolução da carga viral para o HIV-1, e da contagem de células CD4. Além disso, tempo para introdução de drogas antiretrovirais e resposta à terapia serão também avaliados; os casos serão pareados aos controles por data do diagnóstico da infecção pelo HIV-1. Este estudo incluirá pacientes pediátricos, infectados por via vertical. Nessa população específica, serão avaliados ainda, o tempo de aleitamento materno, a utilização ou não de profilaxia para transmissão vertical do HIV, e a carga proviral do HTLV no momento da avaliação. 2. Braço prospectivo: os pacientes diagnosticados recentemente, ainda sem utilização de drogas ARV, e os pacientes diagnosticados no período do estudo serão seguidos por um período de 18 meses, para determinação da evolução clínica, resposta à TARV, e variação nos parâmetros laboratoriais (Carga viral para HIV-1, contagem de células CD4+, carga proviral para HTLV). Critérios de inclusão: 1. Braço retrospectivo: - Sorologia positiva par HIV-1 (controles) e para o HIV-1 e HTLV-1 ou -2 (casos) - Disponibilidade de registros para coleta de dados demográficos e clínico-laboratoriais 2. Braço prospectivo: - Sorologia positiva para HIV-1 (controles) e para o HIV-1 e HTLV-1 ou -2 (casos) - Ausência de TARV prévia - Disponibilidade para seguimento por 18 meses - Assinatura de termo de consentimento Critérios de exclusão: - Impossibilidade de comparecimento às avaliações - Ausência de dados em prontuário (braço retrospectivo) Seleção dos pacientes: serão revisados os prontuários dos pacientes em seguimento em cada serviço, assim como daqueles que evoluíram para óbito e que tenham sorologia documentada para HTLV. Os pacientes sob TARV, no momento da inclusão, ou já falecidos serão incluídos no braço retrospectivo. Os pacientes virgens de tratamento ARV serão convidados a ingressar no estudo prospectivo. Os indivíduos que ainda não tenham realizado sorologia prévia para HTLV serão testados para anticorpos contra esses agentes. Avaliação clínica: para os dois braços os dados serão coletados através de ficha padronizada (anexo I), contendo questões sobre variáveis laboratoriais e clínicas. Os pacientes no braço prospectivo serão convidados a fornecer amostra de sangue no momento de entrada no estudo, após 6, 12, e 18 meses, para avaliação de testes laboratoriais. Testes laboratoriais: ao ingressarem no estudo prospectivo, os pacientes deverão ser submetidos a bateria de exames de laboratório que incluem: hemograma, TGO, TGP, DHL, Ca++, CD3/CD4/CD8, Carga viral para HIV-1, sorologia para sífilis (VDRL), HCV, e HBV (AgHBs, AntiHBc, e AntiHBs), PPD e parasitológico de fezes com pesquisa de larvas pelo método de Baermann (3 amostras). Amostras de plasma e células mononucleares do sangue periférico serão estocadas a -70oC, para posterior testagem de carga viral e proviral. Aos 6, 12 e 18 meses, o perfil laboratorial será repetido, exceto para os indivíduos com sorologias inicialmente positivas. Tamanho amostral: A expectativa do número de pacientes co-infectados em cada centro, com base nos dados disponíveis é: Estudo retrospectivo: esperamos um total de 70 pacientes na Bahia, 30 pacientes em Porto Alegre, 100 pacientes em São Paulo, e 15 pacientes em Belém, totalizando 215 indivíduos co-infectados. Este número é superior ao descrito na maioria dos estudos disponíveis sobre co-infecção. Estudo prospectivo: estimamos em 50 pacientes sem tratamento / recém - diagnosticados na Bahia, 50 pacientes em Santos e São Paulo, 50 em Porto Alegre, e 10 em Belém, totalizando 160 indivíduos. A população pediátrica infectada pelo HIV, em Salvador, é estimada em 150 pacientes sob acompanhamento, com diagnóstico de 10 novos casos/mês, em média. Considerando-se uma prevalência de 5% nessa população, poderíamos atingir um mínimo de 15% (45 casos) do total de crianças co-infectadas, em Salvador. Em São Paulo, para um total de 560 crianças infectadas pelo HIV, e considerando-se uma prevalência de 5% de co-infecção, teríamos uma amostra mínima de 40 co-infectados (SP e Bahia). Os pacientes acompanhados nas coortes anteriormente descritas serão convidados a participar do braço prospectivo deste estudo, por ocasião das suas consultas regulares. Caso aceitem integrar o estudo, deverão assinar termo de consentimento livre e esclarecido (adultos), ou , no caso das crianças, seus guardiões legais devem autorizar a entrada no protocolo, através da assinatura do mesmo documento. As fichas de coleta dos dados deverão ser aplicadas na entrada, e a intervalos de 6 meses (0, 6 , 12 e 18 meses). As coletas para exames de laboratório serão realizadas nas mesmas ocasiões, evitando-se visitas adicionais ao serviço. Não será feita qualquer intervenção sobre o paciente, que terá seu tratamento definido pelo seu(s) médico(s) as-sistente(s), sem qualquer interferência dos pesquisadores. Os dados dos participantes do estudo retrospectivo serão coletados a partir de revisão dos prontuários médi-cos, para preenchimento das fichas padronizadas. Nesse caso, guardado o anonimato dos sujeitos e o sigilo e confidencialidade do manejo das informações obtidas, prescindir-se-á de termo de consentimento. Os dados coletados serão armazenados em banco eletrônico, construído em programa de computador EPI-Info, versão 6.0 ou SPSS, versão 12.0. Os mesmos programas serão utilizados para análise dos dados.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICA

Produção Científica


Projeto: ESTUDO SOBRE O IMPACTO DO USO DE ÁLCOOL ETÍLICO E DROGAS ILÍCITAS SOBRE A TERAPIA ANTI-RETROVIRAL EM SALVADOR - BAHIA- BRASIL.
Coordenador: CARLOS ROBERTO BRITES ALVES
Resumo:

Objetivo: AVALIAR A PREVALÊNCIA E CARACTETISTICAS DO CONSUMO DE ÁLCOOL ETÍLICO E DROGAS ILÍCITAS EM POPULAÇÃO DE PACIENTES COM HIV/AIDS NA BAHIA, ASSIM COMO SEU IMPACTO SOBRE A ADESÃO Á TERAPIA ANTIRETROVIRAL.

Metodologia:

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: COMPORTAMENTAL

Produção Científica


Projeto: O IMPACTO DO PAPILOMAVIRUS HUMANO ANOGENITAL NA TRANSMISSÃO DO HIV EM ÁREA URBANA DO BRASIL: ESTUDO PILOTO FASE II
Coordenador: MARK DREW CROSLAND GUIMARÃES
Resumo: A partir dos dados apurados nesta pesquisa, será possível melhor avaliar a viabilidade e direcionar o planejamento de um futuro de coorte prospectivo que avaliará o papel do HPV e da neoplasia intra-epitelial anal (NIA) na transmissão do HIV. Além disso, será possível obter informações sobre a proporção de homens positivos que mantém relacionamentos estáveis com mulheres e/ou homens negativos para o HIV, tempo médio deste relacionamento e freqüência do intercurso anal/vaginal desprotegido. Este estudo poderá trazer amplas implicações para o rastreamento na NIA, assim com amplia as dimensões do rastreamento da NIC e tratamento e identificar populações selecionadas para se prevenir o câncer anal e cervical e para se reduzir a incidência do HIV. Desta forma, a demonstração de que a NIA ou a NIC seja um co-fator para aquisição do HIV poderia levar a importantes medidas de intervenção em saúde pública para a prevenção da doença HIV, i.e., rastreamento e tratamento destas lesões antes que a transmissão do HIV ocorra.

Objetivo: OBTER DADOS PRELIMINARES ADICIONAIS PARA EXPLORAR A VIABILIDADE DE SE CONDUZIR UM ESTUDO PROSPECTIVO PARA VERIFICAR SE A INFECÇÃO PELO HPV ANAL E A NIA SÃO CO-FATORES PARA AQUISIÇÃO DO HIV NO BRASIL.

Metodologia: O estudo proposto é uma continuação do estudo de corte transversal multicêntrico sobre o comportamento sexual e atitudes com 545 homens positivos para o HIV (casos índices) em seis centros de referencia para HIV/AIDS em Belo Horizonte e no Rio de Janeiro, Brasil em 2003-2004 (Fase I). Será feito um segundo corte transversal onde os casos índices (CI) participantes da fase anterior serão convidados a retornar. Após entrevista, os CI serão convidados a trazê-los (as) aos serviços. Estes (as) serão também entrevistados (as) e convidados (as) a se submeterem ao exame de swab anal e, para aqueles (as) negativos (as) para o HIV ou que nunca foram testados, será oferecido a oportunidade de realizar o exame anti-HIV.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: USO DE INIBIDORES DE PROTEASE E ALTERAÇÕESMETABÓLICAS, NUTRICIONAIS E NA QUALIDADE DE VIDA DE CRIANÇAS E ADOLESCENTES INFECTADAS PELO VIRUS DA UMUNODEFICIÊNCIA HUMANA.
Coordenador: JACQUELINE PONTES MONTEIRO
Resumo: O Projeto Uso de Inibidores de Protease e Alterações Metabólicas, Nutricionais e na Qualidade de Vida de Crianças e Adolescentes Infectadas pelo Vírus da Imunodeficiência Humana visa descrever as alterações da composição corporal, dos indicadores nutricionais peso/idade, altura, peso/altura, da ingestão de energia, macronutrientes, colesterol e triglicerídeos e do lipidograma completo em três grupos de escolares e adolescentes clinicamente estáveis: HIV-positivos em uso de inibidores de protease (IPs); HIV-positivos que não estejam usando IP´s; HIV-negativos pareadas para idade e sexo; acompanhadas a cada seis meses e durante um ano. Verificar correlações entre o o uso de IPs e o estado nutricional das crianças e adolescentes HIV-positivas. Verificar se as alterações do peso e da composição corporal podem predizer mudanças na qualidade de vida relacionada à saúde dessas crianças e adolescentes.

Objetivo: DESCREVER AS ALTERAÇÕES DA COMPOSIÇÃO CORPORAL DOS INDICADORES NUTRICIONAIS PESO/IDADE, ALTURA/IDADE, PESO/ALTURA, DA INGESTÃO DE ENERGIA, MACRONUTRIENTES, COLESTEROL E TRIGLICERÍDEOS E DO LIPIDO-GRAMA COMPLETO EM TRÊS GRUPOS DE ESCOLARES E ADOLESCENTES CLINICAMENTE ESTÁVEIS: HIV-POSITIVOS EM USO DE INIBIDORES DE PROTEASE ( IPs): HIV - POSITIVOS QUE NÃO ESTEJAM USANDO IPs, HIV- NEGATIVOS PAREADAS PARA IDADE E SEXO: ACOMPANHADAS A CADA SEIS MESES E DURANTE UM ANO.

Metodologia: O trabalho será realizado no Hospital das Clinicas da Faculdade de Ribeirão Preto - USO, SP. O estudo deverá ser aprovado pelo Comitê de Ética em Pesquisa da Instituição e os pacientes e/ou seus responsáveis diretos concordar, por escrito, em participar do mesmo. Serão selecionados, aleatoriamente, trinta a sessenta crianças e adolescentes atendidos no Ambulatório de Doenças Sexualmente Transmissíveis do hospital. Os pacientes positivos serão divididos em três grupos: Grupo 1 (G1): HIV-positivas assintomáticas em uso de inibidor de protoase por não mais que um mês; Grupo 2 (G2): HIV-positivas que não estejam usando inibidor de protease; Grupo 3 (G3): HIV-negativas nascidas de mães soronegativas. Cada grupo será avaliado 3 vezes (primeira consulta de caso novo, segunda consulta após 6 meses e terceira consulta após 12 meses). Os critérios de seleção para participação serão: Ter entre 3 e 17 anos de idade; Ter condições físicas adequadas para realização de antropometria; Não estar recebendo terapia nutricional enteral ou parenteral; Não estar usando medicamentos orexigenos; Não ter história clinica de diabetes mellitus, diarréia crônica, doença hepática, fibrose cística, pancreatite e insuficiência renal; não estar recebendo IPs por mais do que um mês.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Crianças e Adolescentes vivendo/portadoras do HIV

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICA

Produção Científica


Projeto: ADESÃO Á TERAPIA ANTI-RETROVIRALNA INFÂNCIA E ADOLESCÊNCIA
Coordenador: ROSANGELA RODRIGUES
Resumo: O Projeto Adesão à Terapia Anti-retroviral na Infância e Adolescência visa estudar características e fatores associados à adesão aos medicamentos anti-retrovirais entre crianças e adolescentes, e a relação entre diferentes níveis da adesão e resultados terapêuticos, definidos conforme parâmetros clínicos e laboratoriais. A aplicação, por meio de entrevista, do instrumento para avaliar a adesão aos medicamentos utili-zados na terapia antiretroviral (TARV) nas condições rotineiras de atendimento às crianças e adolescentes, permitirá conhecer o melhor os esquemas de medicamentos ARV aplicados para pacientes neste pertencen-tes a esse grupo etário, fornecendo subsídios para a avaliação da sua efetividade. Será possível também conhecer a relação entre a adesão ao TARV e os resultados terapêuticos avaliados por meio de parâmetros laboratoriais (carga viral, níveis de células CD4, e clínicos), tal conheci-mento oferecerá subsídio à introdução de medidas mais adequadas para o manejo do tratamento, sejam elas relativas à melhoria da utilização dos esquemas prescritos ou à outros fatores inerentes ao viver HIV/AIDS para as crianças e adolescentes. Conheceremos melhor quais características sócio-demográficas, da estrutura familiar, do cuidador ou da instituição que o acolhe, da presença de comorbidade, do tratamento medicamentoso assim como dos efeitos adversos, estão associadas à adesão. Tais resultados oferecerão subsídios ao aperfeiçoamento do Programa Nacional de DST/AIDS em suas atividades voltadas a assistência de crianças e adolescentes que convivem com a infecção HIV/AIDS. A avaliação das concentrações plasmáticas dos medicamentos ARV e de sua consistência com a adesão auto referida, permitirá a validação do instrumento para sua avaliação. A genotipagem possibilitará a identificação da sua relação com a resistência aos medicamentos ARV e sua influência na resposta ao TARV, considerando-se a adesão ao regime proposto.

Objetivo: ESTUDAR CARACTERÍSTICAS E FATORES ASSOCIADOS Á ADESÃO AOS MEDICAMENTOS ANTIRETROVIRAIS ENTRE CRIANÇAS E ADOLESCENTES, E A RELAÇÃO ENTRE DIFERENTES NÍVEIS DA ADESÃO E RESULTADOS TERAPÊUTICOS, DEFINIDOS CONFORME PARÂMETROS CLÍNICOS E LABORATORIAIS.

Metodologia: Delineamento do Estudo: Será desenvolvido um estudo observacional, de corte transversal. Definição de Caso: Os casos serão crianças e adolescentes de ambos os sexos, portadoras do HIV/AIDS, inde-pendentemente da via de transmissão, com idade entre dois e 20 anos, em tratamento antiretroviral com diagnóstico conforme os critérios do Programa Nacional em Doenças sexualmente Transmissíveis/Aids (DST/Aids) do Ministério da Saúde do Brasil para definição de caso de AIDS (CDC modificado-Anexo1, MS 2004). As condições associadas a Aids serão classificadas conforme os critérios de definição de caso (Anexo 1). Os parâmetros laboratoriais (Carga viral e Contagem de LT-CD4) serão classificados de acor-do com o "Guia de tratamento clínico da infecção pelo HIV em crianças", bem como as reações adversas (RAM), que serão definidas conforme parâmetros para intolerância e toxicidade previstos (MS 2004b). Seleção dos Casos Critérios de inclusão: Serão incluídos no estudo crianças e adolescentes de ambos os sexos de dois a 20 anos de idade portadoras do HIV/AIDS, atendidas no IIER e que estejam sob tratamento ARV há pelo menos dois anos independentemente do local de residência. Critérios de exclusão: Crianças e adolescentes, cujos responsáveis não concordarem em participar do es-tudo, assinando o termo de consentimento livre e esclarecido, ou cujo estado de saúde inviabilizar as res-postas aos questionários ou participação na pesquisa. Definição da amostra Serão incluídos no estudo, todos os pacientes atendidos no hospital-dia e que preencherem os critérios de inclusão. Será também selecionado um sub-grupo objetivando a validação do método para afe-rição da adesão, no qual, além dos procedimentos descritos neste estudo, serão efetuadas as dosagens das concentrações plasmáticas dos medicamentos ARV, assim como a tentativa de isolamento do HIV e sub-seqüente caracterização genotípica com a finalidade de identificar mutações que poderiam influenciar os resultados. O tamanho desta sub-amostra foi estimado em 220 pacientes, conforme proposto por Browner e cols 2003 para estudos de corte transversal, incluindo 10% de perdas possíveis. Fontes de dados: Esta pesquisa utilizará fundamentalmente dados primários, ou seja, obtidos durante a investigação, mas incluirá também dados de prontuários dos pacientes incluídos no estudo, assim como informações disponíveis nos registros do serviço de laboratório clínico do IIER. Critérios de perdas: Será considerado como perda, o paciente ou o responsável, que por motivos de saúde esteja im-possibilitado de ser entrevistado ou quando estes faltarem em duas consultas agendadas sucessivamente. Validação do instrumento: A confiabilidade do instrumento utilizado para aferição da adesão ao tratamento (questioná-rio) será mensurada pelo nível de concordância com indicadores aceitos de adesão, ou seja, níveis de con-centrações plasmáticas dos medicamentos antiretrovirais, carga viral, a contagem de Linfócitos T CD4 e o controle do retorno das unidades posológicas dispensadas. Para análise da concordância será utilizado o índice Kappa de Cohen. A acurácia será avaliada por meio da estimativa da sensibilidade e da especifici-dade. Dosagens plasmáticas dos medicamentos ARV: Os fármacos antiretrovirais presentes nas amostras de plasma serão quantificados por meio de cromatografia liquida de alta eficiência (CLAE), com detector UV-vísivel, fluorescência ou massa. Os pa-drões da curva de calibração e as amostras para controle de qualidade a serem utilizados na validação do método serão obtidos adicionando-se o padrão de referência dos fármacos antiretrovirais ao plasma "bran-co". O método será desenvolvido conforme recomendado pela Resolução ANVISA RE 899/03. As amos-tras serão analisadas paralelamente à curva de calibração, com no mínimo cinco pontos, e às amostras de controle de qualidade (em três concentrações e em triplicata). Considerando que a variabilidade individual nas concentrações plasmáticas pode levar à interpretação inexata de uma única mensuração, será feita a análise de três amostras em meses consecutivos para minimizar estas variações (Heeswijk 2002). Os ARV serão selecionados para a dosagem dos níveis plasmáticos de acordo com critério de maior freqüência de prescrição, factibilidade do método de dosagem, e presença documentada de correla-ção entre níveis plasmáticos e os resultados terapêuticos. Os fármacos que normalmente atendem este úl-timo critério são os IP e ITRNN, já que os ITRN passam por uma fosforilação intracelular para produzir o metabólito ativo que requer sofisticadas técnicas de quantificação, enquanto que a concentração do pró-fármaco, apesar de ser facilmente obtida, relaciona-se pobremente com a resposta terapêutica (Alexander 2003, Soldin 2004, Heeswijk 2002; Fraaij 2004). Para seleção da sub-amostra para validação, será tomado como critério de inclusão estar em uso dos medicamentos ARV definidos para a análise. Contagem de Linfócitos T CD4: Serão utilizados os valores obtidos nos e exames de rotina, registrado previamente em prontuários do pa-ciente, conforme as técnicas padronizadas no laboratório do IIER. HIV-1 RNA (Viremia Plasmática): Serão utilizados os valores obtidos nos e exames de rotina,registrado previamente em prontuários do pa-ciente, conforme as técnicas padronizadas no laboratório do IIER. Controle do retorno dos medicamentos dispensados: Para obtenção de informações referentes à adesão, será solicitado aos responsáveis que tragam, durante três meses consecutivos, os frascos de medicamentos dispensados no período anterior, ou seja, entre a última consulta e a atual com a finalidade de realizar contagens das unidades farmacêuticas (com-primidos e/ou cápsulas) restantes nas embalagens dos medicamentos dispensados. Para formulações liqui-das será feita a mensuração do volume restante nos frascos. Genotipagem O plasma será separado em alíquotas de 500 uL e 500 uL do anel de leucócitos serão coleta-dos em tubo cônico que contenha 500 uL de soro fetal bovino e DMSO (Dimetil Sulfóxido) a 20%. O ma-terial biológico será armazenado a -70 C até a realização dos procedimentos laboratoriais. Será feita a ex-tração do RNA, a partir de plasma, utilizando metodologia "in-house" (solução de trizol). Alternativamen-te, "kits" comerciais de extração de DNA ou RNA (Qiagen, Amersham-Pharmacia) poderão ser utilizados na recuperação de amostras (com amplificação negativa). O produto da extração, (DNA ou cDNA retro-transcrito), será submetido à amplificação molecular por metodologia de Reação em Cadeia da Polimerase (Polimerase Chain Reaction - PCR). Os primers que serão utilizados estão descritos na literatura e listados na tabela 1, assim como a ciclagem das amostras está descrita na tabela 2. A PCR será realizada para am-plificação do gene pol. A primeira etapa do PCR permitirá a obtenção de um produto de amplicon de 1,2 Kb do gene polimerase. Serão utilizados os iniciadores forward K1 e reverse K2. As amostras serão cicla-das de acordo com o programa Pol Plasma. A segunda amplificação (Nested PCR) permitirá a obtenção dos genes codificadores da protease (PR) e transcriptase reversa (RT). Serão utilizados os iniciadores forward DP10 e reverse DP11 para a região da protease e os iniciadores forward F1 e reverse F2 para a região da transcriptase reversa. Para a região da protease as amostras serão cicladas utilizando o programa PT. Para a região codificadora da RT a ciclagem será reali-zada segundo o programa RT. Através da utilização de colunas de purificação (Rapid Concert, Gibco) o material genético será purificado e quantificado por corrida de eletroforese (agarose 2%), com padrão de peso molecular (Mass ladder). Reação de seqüenciamento para incorporação de rodaminas marcadas (Big Dye, Applied Biosystems) seguida de uma etapa de purificação com isopropanol e etanol serão realizadas. A incorporação de rodaminas será realizada com os mesmos "primers" utilizado na segunda reação de PCR. Alternativamente, na reação de seqüenciamento da região da protease, se utilizará os iniciadores DP16 e DP 17 (tabela 1); A reação de seqüenciamento ocorrerá segundo as condições descritas no pro-grama Big Dye (HM). As amostras serão ressuspensas em formamida Hi-Di e seqüenciadas em equipa-mento automático (ABI 3100). O seqüenciamento genético da PR e RT permitirá a obtenção de arquivos (cromatogramas) para análise genotípica. Para as dosagens plasmáticas dos medicamentos e genotipagem, serão coletadas amostras de san-gue total com EDTA (ácido etilenediaminetetracético), por punção de veia periférica. Os tubos serão centri-fugados a 2000rpm por 20 minutos, para que ocorra a separação do plasma. Esta coleta será realizada no dia agendado para cada paciente para o atendimento no hospital-dia, evitando-se introduzir modificações no procedimento habitual, após a assinatura no Termo de Consentimento Livre e Esclarecido, dos respon-sáveis pelos pacientes que concordaram em participar do estudo. A seguir, será feita a entrevista com o responsável pelas crianças com idade menor ou igual a 12 anos e quando se tratar de maiores de 12 anos, com próprio adolescente, caso ele prescinda de apoio do responsável para se medicar. Para facilitar o reconhecimento dos medicamentos, serão utilizadas amostras das embalagens e respectivas formas farmacêuticas fornecidas na farmácia do IIER. Além disso, serão ob-tidas informações sobre diagnóstico, tratamento ARV e parâmetros clínicos e laboratoriais, cuja fonte de dados serão os prontuários médicos e laudos de exames laboratoriais solicitados por critérios estabelecidos pelo serviço, referentes ao início do tratamento (instrumento A) e referentes aos atendimentos anteriores (instrumento B) (Anexo 2). O instrumento C (Anexo 3) consistirá em um questionário estruturado objeti-vando a realização de entrevista, incluindo o instrumento C1, utilizado para as informações referentes às condições sócio-econômicas e estrutura familiar, o instrumento C2 para informações sobre a adesão ao tratamento e razões para não adesão e o instrumento C3 para dados referentes á farmacocinética. Primeiramente será realizada a análise descritiva das variáveis de interesse, através das freqüências relativas e absolutas, médias e medianas utilizando os testes estatísticos adequados para cada tipo de variá-vel. Será também identificada a adesão acumulada referente a três dias, permitindo a averiguação da adesão ao regime terapêutico prescrito: P: número de doses prescritas (número de vezes que cada medicamento foi prescrito/dia dia). M: número de doses omitidas (nº de doses omitidas de cada medicamento nos 3 últimos dias). d: número de medicamentos no regime. A variável dependente será a adesão ao tratamento, analisada como variável dicotômica. Para análise da adesão serão considerados aderentes aqueles que: 1)-Referiram não ter perdido nenhuma dose nos três dias anteriores ou que tomarem 90% ou mais do medicamento prescrito para o período conforme a contagem de unidades farmacêuticas; 2)-Tomaram todas as doses den-tro do intervalo de tempo correto, ou seja, com variações de no máximo 25% do intervalo prescri-to (Arnsten e cols 2001); 3) - Ausência de resposta positiva às questões do teste para adesão de Knobel adaptado, 2002. As variáveis independentes serão as seguintes: " Variáveis sócio-demográficas e estrutura familiar e outras formas de apoio: Relativas à criança: idade, sexo, escolaridade, com quem reside, situação de moradia, uso de drogas ilíci-tas e etilismo, conhecimento do diagnóstico, idade da revelação da soropositividade, responsabilidade pela administração dos medicamentos, pré-natal da mãe, profilaxia para transmissão vertical da mãe, mãe sabia, quando a mãe ficou sabendo. Relativas ao cuidador: grau de parentesco, escolaridade, responsabilidade por outras crianças ou adoles-centes, responsabilidade por outra pessoa soropositiva, soropositividade, uso de ARV, comorbidade, uso de drogas ilícitas e etilismo. " Variáveis relativas às características clínicas e laboratoriais e da criança ou adolescente: data do diagnóstico, data do início do tratamento, via de transmissão, peso, altura, categoria clínica [critério CDC], modificações na categoria clínica, carga viral (CV), queda da CV em 1 a 2 log, contagem de LTCD4, eleva-ção de pontos percentuais na contagem de CD4, hospitalizações, comorbidade, episódios de condições associadas à Aids, perfil de genotípico, concentrações plasmáticas dos medicamentos ARV. " Variáveis relativas ao tratamento: TARV, tipo de TARV, estar em primeira experiência com os Inibidores de Protease (IP), modificações no TARV, Reações adversas (RAMs) aos ARV, Tipo de RAMs, identificação dos medicamentos, perda de dose, total de doses perdidas, identificação do regime posológi-co, identificação das recomendações alimentares, uso de outros medicamentos que não antiretrovirais pres-critos e não prescritos, razões para não adesão. Como medida de associação utilizaremos a odds ratio (OR), sendo que serão estimados os OR não ajustados e ajustados com os respectivos intervalos de 95% de confiança (CI95%) pela análise bivariada e multivariada, respectivamente. A análise multivariada será efetuada por meio de regressão logística, a in-clusão das variáveis na análise multivariada levará em conta sua significância estatística (p< 0,05) e sua relevância biológica. A significância das variáveis no modelo será feita pela razão de verossimilhança. O modelo multivariado final será determinado pelo uso do método stepwise forward. Análise Biomolecular A genotipagem será realizado utilizando aplicativos disponíveis, como Sequence Navigator, por meio da edição e análise dos cromatogramas gerados pelo seqüenciamento genético, onde seqüências "foward" e "reverse" formaram um arquivo consenso e um produto final, em formato fasta. Após esta etapa as seqüên-cias genéticas serão alinhadas para análise de similaridade entre a edição gerada e a seqüência HXB2 do HIV (GenBank access number K03455), avaliando o perfil de mutações da seqüências analisadas. Estas informações moleculares serão submetidas à programas disponíveis na internet. Na análise da resistência aos ARV, o perfil genotípico será avaliado pela submissão ao "site" Stanford HIV Drug Resistance Databa-se (hivdb.stanford.edu), que gera notas informativas sobre cada mutação e sua relação com a suscetibilida-de aos medicamento antiretrovirais.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Crianças e Adolescentes vivendo/portadoras do HIV

Natureza: ESTUDOS E PESQUISAS

Subnatureza: COMPORTAMENTAL

Produção Científica


Projeto: ESTUDO DA RESPOSTA IMUNE DA CÉRVIX UTERINA EM MULHERES CO- INFECTADAS PELO HIV/HPV
Coordenador: ALCINA FREDERICA NICOL DE OLIVEIRA
Resumo: O Projeto Estudo da Resposta Imune da Cérvix Uterina em Mulheres Co-Infectadas pelo HIV/HPV visa estudar a resposta imune na mucosa do cérvix uterino de mulheres co-infectadas pelo HIV/HPV, analisando o papel das moléculas imuno-reguladoras. Realizar um estudo longitudinal avaliando a evolução clínica e imunológica, a nível sistêmico e no cérvix uterino, de mulheres co-infectadas pelo HIV/HPV-1, associando-o com a carga viral, ocorrência de infecções oportunísticas, manifestações ginecológicas, doenças sexualmente transmissíveis, neoplasias e outras manifestações associadas à infecção pelo HIV. Pretendemos com o desenvolvimento desta proposta avançar no conhecimento da resposta imu-ne e a investigação de possíveis marcadores imunológicos nas diferentes formas clínicas da in-fecção pelo HPV e co-infecção pelo HIV/HPV. O impacto científico esperado pelos resultados do projeto é grande, pois o desafio de responder sobre a questão da resposta imune e a imunopatogenia causada pelo HPV é um dos grandes desafios da biomedicina, visto que cerca de 25% da população geral, foram infectados pelo HPV. Todos os resultados gerados pela presente proposta de pesquisa serão encaminhados para pu-blicação em revistas de divulgação internacional e resumos em congressos científicos.

Objetivo: OBJETIVO GERAL: Estudar a resposta imune na mucosa do cérvix uterino de mulehres co-infectados pelo HIV/HPV, analisando o papel das moléculas imuno-reguladoras. Realizar um estudo longitudinal avaliando a evolução clínica e imunológica, a nível sistêmico e no cérvix uterino, de mulehres co-infectadas pelo HPV/HIV-1, associando-o com a carga viral, ocorrência de infecções oportunístas, manifestaões ginecológicas, doenças sexualmente trasmissíveis, neoplasias e outras manifestações associadas a infecção pelo HIV. OBJETIVOS ESPECÍFICOS: 1) Estudar a co-infecção causada pelo HIV-1/HPV, atrabés da análise de moléculas sinalizadores supressoaras de citocinas (SSI/SOCS), responsáveis pelo "feedback" negativo da expressão de citocinas. a- Correlacionar a expressão de SSI/SOCS na cérvix uterina em mulheres infectadas pelo HPV para verificar se estas proteínas poderiam influenciar a replicação viral do HIV-1 ou não; b- Analisar e comparar a expressão de moléculas inibidoras SSI/SOCS com a presença de citocinas tipo 1 e 2 e pró-inflamatória na cervix uterina. 2) Analisar quais quiocinas estariam envolvidas na infecção; 3) Avaliar a expressão de moléculas de adesão nas lesões e associá-las a migração celular; 4) Comparar o processo inflamatório na cérvix uterina em portadoras da infecção pelo HPV e coinfectadas pelo HIV-1; 5) Correlacionar a resposta imune da mucosa uterina com o estágio clínca de infecção.

Metodologia: Casuística Neste trabalho procuraremos avaliar as alterações imunológicas e a carga viral em uma cohorte de mulheres infectadas pelo HIV-1 acompanhada pelo corpo clínico do IPEC, como parte de um estudo visando a evolução da infecção pelo HIV em mulhe-res, bem como aquelas provenientes do Serviço de patológica cervical do Instituto Fernandes Figueiras. Um total de 100 mulheres, já diagnosticadas como positivas para o HIV-1 atra-vés dos procedimentos sorológicos clássicos (ELISA e western blot) e incluídas no grupo de estudo acima, serão acompanhadas por um período de 12 meses, com visi-tas a cada 6 meses, onde, serão realizados os exames clínicos e laboratoriais de roti-na (hemograma, VHS, contagem de plaquetas, dosagem de transaminases, uréia, creatinina, triglicerídeos, sorologia para toxoplasmose, citomegalovirus, sífilis, hepati-te B e C, testes cutâneos para avaliar a imunidade celular, tipagem de linfócitos T CD4+, CD8+ e linfócitos T totais (CD3+). Estas pacientes já recebem atendimento médico e medicamentos para tratamento anti-retroviral e para profilaxia de infecções oportunísticas, bem como métodos diagnósticos disponíveis no IPEC. As pacientes receberão informações gerais sobre os objetivos do estudo e procedi-mentos envolvidos (exame clínico, coleta de espécimes, entrevistas). As pacientes que concordarem em participar serão solicitadas a assinarem um termo de consenti-mento em três vias (prontuário, paciente, arquivo do projeto). Será preenchido um questionário inicial para cada paciente onde estarão es-pecificados os dados referentes aos exames laboratoriais de rotina , os dados demo-gráficos estagiamento clínico, DSTs e outras infecções ginecológicas prévias, além dos dados referentes ao parceiro como status sorológico, fatores de risco, estagia-mento clínico, DSTs, contagem de linfócitos CD4+, CD8+ e linfócitos T totais CD3+, entre outros. A história de um ou mais episódios de gravidez após a soroconversão será também computada no questionário, a fim de ser avaliada quanto a possível in-fluência no comprometimento das funções imunológicas e, consequentemente no favorecimento da evolução para a AIDS, através da comparação com aquelas sem episódios de gravidez, pareadas por idade e por tempo provável de soroconversão. Desenho do estudo Estudo seccional/transversal, no âmbito de um estudo de coorte em acompa-nhamento de pacientes com infecção pelo HIV/HPV que serão comparas às pacientes somente infectadas pelo HPV . Avaliação do perfil imunológico As alterações imunológicas serão medidas através da avaliação das subpopu-lações de linfócitos T CD4+ e CD8+, linfócitos T totais CD3+, assim como a presença de linfócitos T ativados expressando diferentes marcadores de superfície (HLA-DR, CD38, CD25), visto que ao longo da infecção pelo HIV-1 ocorre um estado de ativa-ção celular, detectado pelo aumento da expressão destes marcadores de superfície, o qual se correlaciona com o aumento da carga viral (Fauci, 1993; Stanley e cols, 1996). Esta metodologia já se encontra implantada no laboratório de Imunologia do IOC. Estas medidas serão realizadas por citometria de fluxo (Citômetro XL, Coulter Co) Avaliação da carga viral A avaliação da carga viral tem se mostrado como um parâmetro importante no acompanhamento de indivíduos infectados pelo HIV-1, apresentando boa correlação com o estágio clínico, patogenicidade, evolução para a AIDS e transmissão materno-infantil ( Ho e cols, 1995; Dickover e cols., 1996) . Esta será feita por PCR quantitativo a partir de RNA viral obtido de plasma das pacientes nos diferentes pontos de coleta. O RNA será extraído a partir de alíquotas estocadas a - 70 C de plasma, tratado com DNAse, submetido a reação com a transcriptase reversa para cópia do cDNA, o qual será ampliado por PCR. Para sua quantificação será utilizado kit comercial do tipo Amplicor HIV monitor (Roche, NJ) ou similar. Material coletado das pacientes Esfregaços da ecto-cérvice serão obtidos pelo ginecologista, durante a consulta gi-necológica. 6 lâminas préviamente filmadas com silano (Sigma, Ca) serão fixadas em acetona fria (6 lâminas) em frasco de citologia e transportado para o laboratório para posterior estudo imunohistoquímico. Serão utilizadas neste estudo biópsias cervicais que foram realizadas, a crité-rio médico e diagnóstico histopatológico sugestivo de infecção pelo HPV, que encon-tram-se arquivadas no Departamento de Anatomia Patológica do IFF. Estas amostras foram préviamente fixadas em formol a 10%, processadas e embebidas em parafina. Cortes histológicos de 5 serão obtidos através do micrótomo e colocados em lâmi-nas filmadas (silano). O estudo será realizado através da técnica de imunoperoxidase e por RT-PCR in situ . Serão ainda transcritos dos prontuários das pacientes os dados clínicos, laboratoriais, comportamentais e demográficos. Critérios de inclusão: Serão incluídas no estudo pacientes maiores de 18 anos, apresentando lesões cervicais com suspeita clínica de infecção pelo HPV, onde por critério clínico seja ne-cessário a realização de biópsia do colo uterino, sendo estas pacientes infectadas ou não pelo HIV-1. Todas as pacientes assinarão termo de consentimento livre e escla-recido (em anexo), após serem informadas dos objetivos do estudo pelos médicos responsáveis. Critérios de exclusão: Serão excluídas do estudo aquelas pacientes que não apresentaram ao diag-nóstico histopatológico, indicações de infecção pelo HPV e outras DSTs ao exame clínico . O estudo da expressão de SSI/SOCS na cérvix uterina, a detecção de quimiocinas, moléculas dee adesão e citocinas tipo 1 , 2 e pró-inflamatórias serão analisadas pelo método da imunohistoquímica, com um painel de anticorpos de acordo com protocolo já estabelecido (Nicol et al 2005b) e RT-PCR in situ. Recente colaboração com o Dr. Gerard Jerry Nuovo (Dep.of Pathology -OSU- Ohio State University, Columbus - USA) nos proporcionou padronização deste método. A detecção do mRNA do PCR-amplificado do HIV-1 será detectado como previamente descrito por Nuovo (Nuovo 1995, Nicol & Nuovo 2005) . Primers SK38 e SK39 (Perkin-Elmer Corporation; Nor-walk, CT), no qual correspondem a região gag bem como primers específicos para ca-da citocina a ser analisada. Para esta etapa serão utilizados cortes parafinizados (fixados em formol a 10%) e lâ-minas de esfregaço do cérvix uterino (ectocérvice) fixados em acetona. Técnica de imunoperoxidase: Fragmentos fixados em formol a 10%, emblocados em parafinas, serão corta-dos em micrótomo com 5 m , a seguir realizaremos as marcações pela imunohisto-química . As lâminas serão hidratadas utilizando o tampão de lavagem Tris base salina (TBS pH 7,4,) (Sigma Chemical Co, St. Louis, EUA) por 10 minutos. Logo após, será feita a inibição endógena dos cortes em peróxido de hidrogênio 30% em TBS (diluição 1:1) por 15 minutos. As lâminas serão incubadas em soro normal de cavalo (1:75, Vectastain ABC Kit, Vector Laboratories, Burlingame, EUA) diluído em TBS. Os anti-corpos primários utilizados estão especificados na Tabela 1. Após a incubação por 1 hora em temperatura ambiente, os cortes serão lavados em TBS (dois banhos de 5 minutos), e incubados com o anticorpo secundário biotinilado anti-camundongo (1:200, Vectastain ABC Kit, Vector Laboratories, Burlingame, EUA) diluído em TBS por 30 minutos. As lâminas serão novamente lavadas em TBS (dois banhos de 5 mi-nutos) e incubadas com o complexo avidina-biotina conjugado com peroxidase (1:100, Vectastain ABC Kit, Vector Laboratories, Burlingame, EUA) por 30 minutos e reveladas com 3'3 diaminobenzidina (DAB) (Sigma Chemical Company, St. Louis, EUA), e contracoradas com hematoxilina de Mayer. Uma vez determinado a freqüência de células positivas para cada uma das populações a serem estudadas e sua distribuição no tecido (epitélio, camada basal do epitélio e córion), as lâminas serão coradas com auxílio do kit Double staining (Dako) para dupla marcação. Assim teremos a possibilidade de identificar quais populações celulares es-tão ativadas in vivo e como estão distribuídas na lesão. Quantificação das células positivas As células positivas serão quantificadas de duas formas diferentes: 1) Com o auxílio de um microscópio (Leitz) acoplado a um Software - Image Pro-Plus, e 2) Utilizando uma gratícula, inserida na ocular do microscópio, com objetiva de 400x. Armazenamento de dados e análise estatística Todos os dados, referentes a cada paciente e os resultados gerados serão incluídos em banco de dados no Programa SPSS. A análise estatística será processada utilizando-se os recursos disponíveis no próprio programa SPSS através de análise comparativa entre as pacientes HIV positivas e negativas. Um estatístico profissional será responsável, junto com os pesquisadores, pela realização destas análises. A análise inicial compreenderá a busca de fatores prognósticos e imunológicos entre os diversos grupos analisados, utilizando-se os testes estatísticos apropriados. Curvas de sobrevida de Ka-plan-Meier serão utilizadas para calcular riscos cumulativos para os diversos parâmetros marca-dores da evolução da infecção pelo HIV. A identificação das variáveis preditoras da evolução para SIDA, e NIC ou outra condição que se deseje avaliar, serão analisadas através do "proportional harzards model" utilizando-se as variá-veis inicialmente detectadas no momento da análise univariada.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICA

Produção Científica


Projeto: DESENVOLVIMENTO DE INSTRUMENTOS CLÍNICOS E LABORATORIAIS APLICÁVEIS AOS ESTUDOS CLÍNICO-EPIDEMIOLÓGICOS, AO DIAGNÓSTICO E AO MONITORAMENTO TERAPÉUTICO DA CO-INFECÇÃO HIV/LEISHMANIA.
Coordenador: ALDA MARIA DA CRUZ
Resumo: 1. PROTOCOLOS DE INVESTIGAÇÃO E ACOMPANHAMENTO CLÍNICO, INCLUINDO CRITÉRIOS DE DIAGNÓSTICO E CONDUTA TERAPÊUTICA. 1.1. Casuística: O estudo terá caráter tanto prospectivo, por busca ativa de casos, como retrospectivo, por busca em registros hospitalares, de co-infecção HJ\I/Leishmania, nas várias instituições participantes. Na zona altamente endêmica de HJ\I, a procura de leishmanioses se fará baseada em critérios epidemiológicos de contato com área endêmica para leishmaniose e/ou parâmetros clínico-Iaboratoriais Na zona endêmica de leishmanioses, a procura de infecção por HIV se fará pela infonnação de exposição aos fatores de risco e/ou parâmetros clinico-Iaboratoriais. O universo de pacientes co-infectados identificado nos centros participantes deste estudo, que estão atualmente em acompanhamento, é de aproxin1adamente 50 casos. Como controle serão eShldados pacientes portadores de leishmaIÚoses tegumentar (30 casos) e visceral (30 casos) sem história de infecção pelo HJ\I; cerca de 50 individuos com infecção por HIV, sem leishmanioses (dependendo do parâmetro a ser estudado); e 20 individuos sadios. 1.2. Estudo retrospectivo: será realizada a busca de registros hospitalares nas várias instituições participantes, utilizando-se uma Ficha Clinica (anexo) para recuperação e análise de aspectos clínicos, diagnósticos e evolutivos de portadores de co-infecção Leishmania/HJ\l. 1.3 Estudo prospectivo: Critérios de inclusão: serão incluídos os pacientes que preencherem os critérios descritos nos seguintes grupos de estudo: A) Grupo de pacientes em acompanhamento: Serão estudados pacientes HJ\I positivos com história de leislm1aniose (tegumentar ou visceral) ativa ou em remissão. O universo de pacientes coinfectados identificado nos centros participantes deste estudo é de aproximadamente 100 casos, jáem acompanhamento. A mesma Ficha Clinica será utilizada e estes pacientes serão convidados a participar do estudo para avaliação dos parâmetros clinico-Iaboratoriais evolutivos; B) Pacientes a serem identificados por busca ativa: os pacientes atendidos nos centros participantes serão convidados a participar de acordo com os seguintes critérios: Investigação de leishmaniose visceral em pacientes com HIV/ AIDS. Pacientes com diagnóstico de HIV/AIDS em acompanhamento ambulatorial ou internados serão investigados para leishmaniose visceral e divididos em dois grupos: Assintomáticos: pacientes provenientes de área de transmissão de leishmaniose visceral que não apresentarem sintomatologia de leishmaniose visceral; Sintomáticos: Pacientes portadores de HJ\I/AIDS que apresentem dois ou mais dos seguintes sintomas: febre por mais de duas semanas, hepatomegalia, esplenomegalia, adenomegalia, citopenia: anerIÚa e/ou leucopenia e plaquetopeIÚa Investigação de leishmaniose tegumentar em pacientes com HIV/AIDS. Qualquer paciente com diagnóstico de HIV/AIDS que apresentar lesões cutâneas por mais de duas semanas e que estiveram em contato com área de transmissão de leishmaniose pelo menos uma vez na vida. Investigação de HIV em pacientes com leishmanioses. Pacientes com diagnóstico de leishmaniose visceral que apresentarem um ou mais os seguintes critérios: ausência de resposta a terapêutica irúcial (anfotericina B ou antimoIÚal pentavalente), sorologia negativa para Leishmania, comprometimento de órgãos, comumente não afetados na leishmaniose visceral; Pacientes que apresentarem leishmaniose tegumentar com as seguintes caracteristicas: fonna cutânea disseminada com ou sem lesão mucosa; comprometimento mucoso eÀ1:ranasal; presença de parasito em espécime de biópsia de lesão mucosa; intradennorreação de Montenegro negativa; Pacientes com diagnóstico de leishmaniose visceral ou cutânea sem exposição a área de transmissão de leishmaniose há um ano. B) Grupos-controle: serão incluídos pacientes portadores de leislll11aniose teglilllentar (30 casos) e vlsceral (30 casos) sem história de infecção pelo HIV, 50 indivíduos com infecção por HIV, sem leishmanioses (dependendo do parâmetro a ser estudado) e 20 indivíduos sadios. A estes pacientes seráoferecida a sorologia anti-HIV e serão incluídos aqueles que aceitarem participar e realizar a sorologia. Os pacientes que preencherem os critérios de inclusão serão convidados a participar do estudo. O pesquisador lerá o termo de consentimento esclarecido e solicitará ao paciente ou responsável que assine o termo. As amostras clínicas serão colhidas de acordo com as regras das Boas Práticas de Laboratório (Handbook Good Laboratory Practice - GLP - TDRlGLP/01.2, 2001) e do Manual de Vigilância e Controle da Leishmaniose Visceral Editora Ministério da Saúde, 2003) Critérios de exclusão: não há critérios de exclusão previamente defInidos, exceto a recusa de participação. Aspectos Éticos Os pacientes que aceitarem participar da pesquisa e assinarem o termo de Consentimento Livre e Esclarecido serão incluídos no estudo. Para a participação de crianças, os pais ou responsáveis serão esclarecidos e se concordarem, assinarão o Termo. O projeto cumprirá as nODnas que regulanlentam a pesquisa em seres humanos no Brasil -Resolução 196/96 do Conselho Nacional de Saúde - Todos os pacientes receberão o tratamento específIco preconizado pelo Ministério da Saúde para portadores de leishmaniose visceral e illV e terão o seu acompanhamento clínico garantido em cada um dos centros participantes até a cura. 2. OBTENÇÃO DE MATERIAL BIOLÓGICO PARA DIAGNÓSTICO E ENSAIOS LABORATORlAIS. No momento de admissão no protocolo de estudo será coletado um volume máximo de 40 mL de sangue periférico de cada indivíduo. Este volume será dividido em: 2 tubos de 10 mL com heparina, 1 tubo de 10mL sem heparina, 1 tubo de Sml com EDTA Sinmltaneamente deverá ser coletado um tubo de 5 mL para realização de hemograma do paciente O soro obtido será dividido em: (1) 4 alíquotas de 200J.1L a serem utilizadas para detecção de anticorpos anti-Leishmania; (2) 4 alíquotas de 400 J.1L para detecção de citocinas e fatores solÚveis circulantes. Do plasma obtido do tubo de EDTA serão geradas duas alíquotas para quantificação de carga viral (a estas serão adicionadas tampão para conservação), assim como a imunofenotipagem para os linfócitos T C04+ e C08+. O restante do sangue será utilizado para análises moleculares do vírus e detecção de DNA de Leishmania. Do sangue heparinizado serão obtidas células mononucJeares utilizadas para os ensaios in vitro com estimulação antigênica: (1) caracterização fenotípica dos mononucJeares por citometria de fluxo, (2) proliferação de linfócitos frente a estímulos, (3) caracterização fenotípica ge células reativas a antígenos de Leishmania por citometria de fluxo, (4) detecção de citocinas no sobrenadante das culturas e análise da freqüência de células produtoras por ELISPOT. Parte das células será congelada em nitrogênio líquido para avaliações posteriores. 3. DIAGNÓSTICO VIROLÓGICO E AVALIAÇÃO DA DO GRAU DE COMPROMETIMENTO DO SISTEMA IMUNE. 3.1. Quantificação do RNA do HIV-1: carga viral e genotipagem do HIV A quantificação do RNA viral será realizada a partir do plasma das amostras dos indivíduos, através do sistema NASBA de amplificação (NucJeic Acid Sequence Base Amplification - Organon Teknika, USA). O intervalo de detecção deste sistema é de 80 a 107 cópias de RNNml de plasma, aproximadamente, sendo consideradas significativas alterações 2: 0,5 logo 3.2. Análise molecular do HIV-1 Com a finalidade de identificar amostras com potencial de resistência às drogas antiretrovirais, bem como o desenvolvimento das mesmas, será realizada a análise molecular viral tendo como alvo a região do genoma do vírus correspondente ao gene da enzima polimerase (pai). Para isto, as amostras de DNA proviral presentes nas células mononucJeares serão obtidas utilizando-se kit de e:\.'tração de DNA (QIAamp DNA Blood Mini Kit - Qiagen mc., Valencia, CA, EUA), a partir de alíquotas de sangue total, de acordo com as instruções do fabricante. Estas serão, então, amplificadas pela técnica de Reação em Cadeia da Polimerase (PCR) e submetidas ao seqüenciamento direto de nucJeotídeos a partir dos produtos de PCR. O detalhamento completo desta análise encontrase em Morgado e cols. (1998). As amostras amplificadas serão analisadas por eletroforese em gel de agarose, purificadas (QIAquick PCR Purification Kit - Qiagen) e quantificadas para posterior seqüenciamento de nucJeotídeos. A partir destas, a reação de seqüenciamento será realizada em presença de BigDye@ Terminator - versão 3.1 (Applied Bíosystems, Foster City, CA, EUA) e posteriormente precipitadas para o sequenciamento. Cada amostra será seqüenciada em ambos os sentidos, com primers internos específicos para a região do gene pai, em equipamento ABI PRISM@ 3100 (Applied Biosystems). Por fim, as seqüências serão editadas utilizando-se o programa SeqMan (DNASTAR me., Madison, WI, EUA). 3.3. Quantificação de linfócitos T CD4+ e CD8+ e fenotipagem das subpopulações linfocitárias. A determinação dos linfócitos T CD3+/C04+ e CD3+/CD8+ será realizada a partir de amostras de sangue venoso, através do sistema BD TruCOUNT@ (Becton-Dickinson - BD Franklin La.kes, NJ, EUA), o qual baseia-se na utilização de beads de referência para a quantificação absoluta destas subpopulações. Um painel de anticorpos monoclonais específicos para as moléculas de CD4, CD8 e CD3, triplamente marcados com isotiocianato de fluoresceína (FITC), ficoeritrina (PE) e peridina-clorofila (PercP), respectivamente (BD TRITest@) também será utilizado. A amostras serão avaliadas por citometria de fluxo, utilizando-se o equipamento F ACSCalibur@ (BO) e um software apropriado para esta análise (BD Multiset@). Em complemento à análise das subpopulações linfocitárias, outras moléculas utilizadas no acompanhamento imunológico também serão avaliadas através da citometria de fluxo Moléculas associadas à ativação celular como CD38 e I-ll.,A-DR e moléculas de diferenciação como CD45RA, CD45RO, CD25, CD62L e outras, serão investigadas utilizando-se anticorpos monoclonais específicos devidan1ente marcados. Estas análises serão realizadas pelo software BD Cell Quest ProTJ\.'. 4. IDENTIFICAÇÃO DOS ISOLADOS DE LEISHMANL4. 4.1. Caracterização das espécies de Leishmania por ensaios imunoenzimáticos e moleculares. Os isolados do parasito obtidos a partir de cultura axênica ou inoculação em hamster serão identificados quanto as espécies utilizando eletroforese de isoenzimas e RFLP do espaçador intemo transcrito do DNA ribossômico. Os parasitos ficarão depositados na Coleção de Leishmania do Instituto Oswaldo Cruz, Instituto Oswaldo Cruz - Fundação Oswaldo Cruz - CLIOC WFCC WDCM731. A utilização posterior destas cepas seguirá as normas estabelecidas pelo referido Centro. 4.2. Detecçâo do parasito nos tecidos: imunohistoquímica e DNA parasitário. 4.2.1. Detecção de antígenos de Leishmania em tecido por reação imunohistoquímica. Fragmentos de tecidos fixados em formalina tan1ponada e incluídos em parafina, em cortes de 4J..Ull, serão desparafinados em xilol e rehidratado em concentrações decrescentes de álcool e incubados com H"O" 0,03% em metanol por 30 minutos no escuro para bloquear a atividade da peroxidade endógena. A revelação do antígeno será feita utilizando Tris-HCl (1,2 mg/rnl), pH 1.0, no forno de microondas (Sanyo, Brasil) sob potência máxima em ciclos subseqüentes de 10 e 5 minutos. Após lavagem em salina tamponada com fosfato, 0,01 M, pH 7,2 (phosphate-buffered saline = PBS), os cortes serão tratados com "Block.ing Ki" (Vector Laboratories, Inc., Burlingame, EUA) e "Protein Block" (Dako Corporation). Os cortes serão incubados, a seguir, com anticorpo policlonal de camundongo anti-L. amazonensis diluído 1:1600 (vol:vol) em PBS "overnight" a 4°C na atmosfera úmida (Costa et aI., 2004). A reação prosseguirá utilizando o sistema "catalyzed signal amplification" - peroxidase (Dako Corporation) segundo o protocolo fornecido pelo fabricante, e a reação será revelada utilizando H"02 0,06% e 3,3'diaminobenzidine (Sigma Chemical, USA) 0,3 mg/rnl em PBS. A contracoloração sera feita com hematoxilina de Harry's (Sigma Chemical, EUA). 4.2.2. Análise de DNA parasitário no sangue periférico ou tecidos. Para tal, o DNA total será e:\.1:raído utilizando um kit de isolamento de DNA genômico comercial (Wizard Genomic DNA purification kit, Promega, WI, EUA). A detecção do DNA de Leishmania por PCR será feita utilizando oligonucleotídeos que amplificam a região conservada do minicírculo de Leishmania, conforme descrito previamente (Pirmez et aI, 1999). O produto amplificado será visualizado em gel de agarose e brometo de etídio em transilUI11inador UV e fotografado, para então fazer transferência alcalina para membrana de nylon. Os produtos transferidos serão hibridizados com sonda específica para os subgêneros Leishmania e Viannia. 5. MÉTODOS LABORATORlAIS PARA DETECÇÃO DE ANTlCORPOS ESPECÍFICOS PARA ANTÍGENOS DE LEISHMANIA UTILIZANDO ANTÍGENO RK39DE L. CHAGASI E Hsp 83 DE L. INFANTUM. Serão realizados testes para detecção de anticorpos anti-Leishmania pelo método de ELISA com antígeno total de L. major-like (Guimarães et aI. 1989) e antígeno de choque térmico ("heat shock protein" = Hsp) de 83 kDa de Leishmania infantum e antígeno recombinante r-K39 de L chagas i (Angel et aI., 1996). Para tal, placas de ELISA de poliestireno com 96 poços e fundo chato (NUNC@) serão sensibilizadas com solução dos antígenos citados. Após incubação, as placas serão lavadas e bloqueadas. Os soros dos pacientes e as amostras padrão serão adicionados aos poços em diferentes diluições, conforme o protocolo específico. Após a incubação as placas serão lavadas e seguido da adição do conjugado anti - IgG humano ligado à peroxidase. Finalmente, será adicionada à solução reveladora (substrato + cromógeno). A leitura será realiza utilizando espectrofotômetro (leitor de ELISA) nos respectivos comprimentos de onda. 6. ENSAIOS DE AVALIAÇÃO DE RESPOSTA IM1JNE CELULAR A ANTiGENOS DE HIV E DE LEISHMANIA. 6.1. Obtenção de células mononucleares do sangue periférico (CMSP). O sangue heparinizado será diluído na proporção I: I em meio RPMI 1640 (Sigma, EUA) completo, ou seja, suplementado com 10mM de hepes, 1,5 mM de L-glutamina, 0,04 mM de 2mercaptoethanol e antibióticos (200UI/ml de penicilina e estreptomicma 200 f.lg/ml) As CMSP serão obtidas através de centrifugação em um gradiente de Ficoll-Hypaque (Sigma, EUA). O anel formado, contendo as CMSP, será coletado com o auxílio de uma pipeta Pasteur. As células obtidas serão lavadas três vezes por centrifugação a 4°C e utilizadas para ensaios de resposta proliferativa e para imunofenotipagem. 6.2 Resposta proliferativa das células mononucleares obtidas do sangue periférico. Para avaliação da resposta imune específica, estudaremos a capacidade ftmcional dos linfócitos T em termos de reconhecimento antigênico, ativação e intensidade proliferação dos linfócitos frente a Leishmania e a proteínas do víms HIV. CMSP (3 X 105 células/poço) serão cultivadas na presença de antígenos parasitários, antígeno P24 e de mitógeno (4f.lg de concanavalina A, Con-A). Para produção de antígeno total, promastigotas de cepas de referência de L braziliensis (Ag-Lb) (MHOM/BR/75/M2903) e de L chagas i (Ag-Lc) (IOC-L579) serão rompidas pelo calor e frio, e
Objetivo: IDENTIFICAR AS CARACTERÍSTICAS CLÍNICAS E EPIDEMIOLÓGICAS DOS CASOS DE CO-INFECÇÃO HIV- LEISHMANIA EM ÁREAS DE ALTA OCORRÊNCIA DE AMBAS AS DOENÇAS, BEM COMO IDENTIFICAR AS PRINCIPAIS CARACTERÍSTICAS IMUNOPATOGÊNICAS DA ASSOCIAÇÃO ENTRE ESTES PATÓGENOS.

Metodologia: Protocolos de Investigação e acompanhamento clínico, incluindo critérios de diagnóstico e conduta terapêutica. 1.1. Casuística: O estudo terá caráter tanto prospectivo, por busca ativa de casos, como retrospectivo, por busca em registros hospitalares, de co-infecção HIV/Leishmania, nas várias instituições participantes. Na zona altamente endêmica de HIV, a procura de leishmanioses se fará baseada em critérios epidemiológicos de contrato com área endêmica para leishmaniose e/ou parâmetros clínico-laboratoriais. Na zona endêmica de leishmanioses, a procura de infecção por HIV se fará pela informação de exposição aos fatores de risco e/ou parâmetros clinico - laboratoriais. O universo de pacientes co-infectados identificado nos centros participantes deste estudo, que estão atualmente em acompanhamento, é de aproximadamente 50 casos. Como controle, serão estudados pacientes portadores de leishmanioses tegumentar (30 casos) e visceral (30 casos) sem história de infecção pelo HIV; cerca de 50 indivíduos com infecção por HIV, sem leishmanioses (dependendo do parâmetro a ser estudado); e 20 indivíduos sadios.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: DESENVOLVIMENTO TECNOLÓGICO

Subnatureza: CLÍNICA

Produção Científica


Projeto: Dinâmica da Co- Infecção Trypanosoma Cruzi-HIV na era HAART: Diagnóstico, parasitemia e influência das populações do parasito na evolução clínica e na disfunção autonômica cardíaca.
Coordenador: ELIANE LAGES SILVA
Resumo: O Triângulo Mineiro constitui uma área endêmica para a doença de Chagas, que, apesar da eficácia do controle da transmissão vetorial, ainda permanece com um elevado número de pacientes chagásicos em diferentes faixas etárias e portadores das diversas formas clínicas da doença. Além disso, essa região é um pólo de desenvolvimento agropecuário em franca expansão, cujo crescimento tem colaborado para o aumento do número de co-infectados com o HIV. A FMTM, por sua vez, é tradicionalmente conhecida, no Brasil e exterior, pelos estudos pioneiros nos aspectos patológicos e epidemiológicos da doença de Chagas. Nessa instituição a implantação do curso de Pós-graduação em Medicina Tropical e Infectologia, coordenado pelo Prof. Dr. Aluízio Prata, permitiu a integração multidisciplinar de um grupo de pesquisadores com experiência no estudo da doença de Chagas humana e experimental. Atualmente, a FMTM conta com quatro grupos de pesquisa consolidados pela CAPES, com linhas de pesquisa bem estabelecidas, produção de pesquisa regular com destaque na doença de Chagas. Esse grupo vem atuando há vários na instituição e conta com um serviço de referência regional no atendimento à pacientes chagásicos e DST/AIDS, bem estruturado, com fluxo contínuo de pacientes com cerca de 3 a 4 casos novos de HIV + por semana. Além disso, a FMTM conta com a Fundação de Ensino e Pesquisa de Uberaba (FUNEPU), que auxilia no gerenciamento de verba pública. Outro fator importante é o grande número de pacientes co-infectados em acompanhamento que permitirá a realização deste projeto. Considerando que a maioria dos dados citados na literatura é relato de casos, detectados esporadicamente em diferentes serviços. Não havendo estudos prospectivos em que se avaliem aspectos clínicos relacionados à disfunção autonômica e reativação, parasitológicos, caracterização genética do parasito e susceptibilidade à quimioterápicos, justificando a relevância deste estudo. Além disso, poderão ser criadas protocolos para indicação de tratamento profilático e/ou terapêutico, fato polêmico nessa co-infecção. A história natural da interação T. cruzi-HIV tem sido pouco descrita na literatura e a maioria dos dados se refere a relato de casos. Nessa interação participam fatores associados com o hospedeiro e com o parasito, os quais têm sido negligenciados em decorrência da falta de estudos multidisciplinares envolvendo a pesquisa básica e clínica. Na Faculdade de Medicina do Triângulo Mineiro de Uberaba essa integração vem sendo realizada desde 2000, e isso nos têm permitido avaliar prospectivamente do ponto de vista clínico e parasitológico um grande número de pacientes com a co-infecção T. cruzi-HIV. Considerando a história natural da infecção pelo HIV, está bem definido o caráter oportunista de diversas infecções em conseqüência da depleção do número e função de linfócitos T e depressão da imunidade celular. Assim, no contexto da infecção pelo HIV, a doença de Chagas tem ocorrido como casos de reativação clinicamente manifestos, principalmente como meningoencefalite ou, menos comumente, como miocardite ambos com elevada parasitemia, alta mortalidade, e linfócitos CD4 menor que 200 células/mm3, sobretudo, nos pacientes que não estavam em uso regular da terapia anti-retroviral altamente eficaz (HAART) (Vaidian et al, 2004). A influência do parasito na evolução clínica da infecção chagásica e na reativação ainda é uma questão aberta. Os dados na literatura demonstram que a parasitemia em pacientes portadores do HIV é significativamente maior que nos HIV negativos (Perez-Ramirez et al, 1999). Contudo, esse aumento é silencioso e pouco se sabe sobre o seu reflexo na clínica dos pacientes, pois, em sua maioria, sintomas agudos graves não são detectados. A persistência do parasito e/ou de seus produtos na fase crônica da doença de Chagas têm sido associado com a patogênese da cardiomiopatia chagásica (Higuchi et al 2003), e nos pacientes co-infectados o aumento da parasitemia no decorrer da imunodepressão poderá ser um fator co-adjuvante para a instalação da disfunção autonômica cardíaca. Apesar dos casos de reativação se associar a contagem de linfócitos CD4 abaixo de 200 células/mm3, não tem sido determinada uma definida relação entre os níveis de parasitemia e linfócitos CD4 (Sartori et al 2002), sendo também questionado se, a manutenção dos níveis normais de CD8, não contribuiria para o controle do parasito (Higuchi et al 1997) evitando, em parte, os casos de reativação. As recentes abordagens moleculares no estudo da doença de Chagas induzem novos direcionamentos na co-infecção com HIV. A PCR, devido a sua sensibilidade, especificidade e rapidez, poderá ser eficaz no diagnóstico precoce e no acompanhamento do tratamento pacientes com reativação no SNC, e a sua utilização na detecção do parasito no líquor poderá ser um indicador rápido e seguro de suscetibilidade ou resistência das cepas à ação das drogas e deve ser melhor avaliada (Lages-Silva et al 2002). A caracterização das cepas do T. cruzi quanto ao polimorfismo de tamanho da região 3' do gen 24S rRNA tem evidenciado o T.cruzi I e o T.cruzi II circulando na região do Triângulo Mineiro (Ramirez et al 2002). Apesar das implicações clínicas dessa subdivisão serem pouco abordadas na co-infecção T. cruzi-HIV, nosso grupo tem relatado a presença do T. cruzi II em pacientes reativados (Lages- Silva 2002, Lages-Silva et al 2002). Sabe-se que o T. cruzi I apresenta menor capacidade para invadir células e é mais sensível à ação da resposta imune do hospedeiro e, talvez, seja mais facilmente reativado nos casos de imunossupressão induzindo exarcebação de subpopulações do parasito. A presença do T.cruzi I em pacientes co-infectados explicaria a falta de correlação entre ausência de sintomas clínicos e/ou reativação em pacientes com elevada parasitemia e também entre os níveis de CD4. Alguns autores não encontraram diferença na distribuição de genótipos T.cruzi entre pacientes HIV + e HIV-, demonstrando, no Brasil, maior freqüência dos genótipos 30 e 32, sendo raramente detectados os genótipos 39 e 43 (Perez-Ramirez et al., 1999). Outros autores, analisando as características do kDNa observaram perfis genéticos idênticos do parasito no sangue e líquor (Lages-Silva et al 2002) Desse modo, merece destaque avaliação da influência dos diferentes genótipos do T.cruzi na evolução clínica e na indicação de tratamento específico ou profilático associado ou não a HAART. A monitoração adequada do T. cruzi nos pacientes portadores de cepas com potencial genético para invadir o sistema nervoso central, talvez possa evitar os futuros casos de reativação da doença de Chagas nos pacientes co-infectados com o HIV. A policlonalidade das cepas do T. cruzi pode apresentar implicações importantes nessa co-infecção, sobretudo no que se refere ao tratamento e à sensibilidade das mesmas à ação da resposta imune do hospedeiro. A indicação de tratamento profilático na co-infecção é controversa e pode constituir um problema diante da ocorrência de cepas naturalmente resistentes. Além disso, após imunossupressão tem sido relatado o surgimento de populações do T. cruzi diferentes da cepa parental (Brito et al 2003), sendo importante avaliar a susceptibilidade dessas populações ao tratamento específico. Diante da falta de consenso no que se refere a administração de tratamento profilático nessa co-infecção, a confirmação que o parasito pode influenciar como co-adjuvante na evolução de lesões cardíacas no decorrer da imunossupressão poderá ser um dado importante para se estabelecer protocolos ou recomendações para o acompanhamento desses pacientes. Considerando o acima exposto; a experiência e material acumulado pelo grupo no acompanhamento desta co-infecção; o fluxo contínuo de pacientes com DST/AIDS (22 pacientes co-infectados em seguimento)e as facilidades que o Curso de Pós-graduação em Medicina Tropical e Infectologia da FMTM nos oferece quanto à condução de projetos interdisciplinares, nos propomos realizar esse projeto. Desse modo, a caracterização genética das populações do T. cruzi em pacientes co-infectados com o HIV, sua e correlação com a evolução clínica, o grau de imunodepressão e uso de terapia anti-retroviral altamente eficaz (HAART) e susceptibilidade do parasito à quimioterapia "in vitro", poderá elucidar vários aspectos obscuros dessa interação.

Objetivo: OBJETIVO GERAL: Validar os métodos parasitológicos mais sensíveis na detecção do T.cruzi no sangue e líquor na co-infecção Trypanosoma cruzi -HIV e correlacionar a parasitemia e as características genéticas das populações do T.cruzi isoladas no decorrer da imunodepressão, com a evolução clínica, a susceptibilidade do parasito à quimioterapia específica. e uso de terapia anti-retroviral altamente eficaz (HAART). OBJETIVOS ESPECÍFICOS: - Detectar e quantificar comparativamente a parasitemia dos pacientes chagásicos crônicos co-infectados pelo HIV, por meio do microhematócrito, hemocultura e PCR seriados e avaliar, nos casos suspeitos de invasão do sistema nervoso central, a sensibilidade e eficácia desses métodos na detecção do T. cruzi. - Caracterizar o DNA nuclear e do cinetoplasto (k-DNA) das populações do T. cruzi isoladas de pacientes com a co-infecção T. cruzi-HIV. - Avaliar comparativamente a função autonômica cardíaca de pacientes HIV(+) não chagásicos, pacientes chagásicos HIV(-) e comparando-a com a dos pacientes com a co-infecção T. cruzi/HIV. - Determinar a influência da parasitemia e das características genéticas das populações do T.cruzi na indução de disfunção autonômica cardíaca nos pacientes co-infectados. - Correlacionar as características genéticas do parasito com a cinética da parasitemia e sua associação com os casos de reativação (meningoencefalite e miocardite). - Analisar comparativamente as características genéticas das populações do T.cruzi em diferentes isolamentos de um mesmo paciente no decorrer da imunossupressão - Estabelecer in vitro a susceptibilidade das populações do T.cruzi aos derivados nitroimidazólicos. - Avaliar a influência da HAART, nos perfis genéticos do T. cruzi , na parasitemia e evolução clínica. - Associar os níveis de linfócitos CD4, CD8 e carga viral com a parasitemia, características genéticas do parasito e evolução clínica.

Metodologia: 1. Pacientes e critérios de inclusão e exclusão. Serão incluídos nesse estudo pacientes de ambos os sexos portadores da co-infecção T. cruzi-HIV, Pacientes HIV positivos não chagásicos e pacientes chagásicos HIV negativos num total de 66 pacientes. A infecção pelo T. cruzi será confirmada pela sorologia convencional, por pelo menos dois métodos positivos (HAI, ELISA, IFI), e a infecção pelo HIV por meio de 2 testes de ELISA e um confirmatório. Serão excluídos pacientes HIV positivos, chagásicos e co-infectados que não concordarem em participar do estudo, assim como, aqueles em uso de medicações que possam interferir na função autonômica cardíaca como beta-bloqueadores, anti-arrítmicos, anticoncepcionais e anti-hipertensivos de ação central, pacientes alcoólatras, diabéticos, hipertensos ou com marcapasso. Atualmente, temos em seguimento 22 pacientes portadores da co-infecção T.cruzi-HIV e, como grupo controle, serão pareados igual número de pacientes chagásicos HIV negativos e igual número de indivíduos HIV não chagásicos atendidos no Ambulatório de doença de Chagas e no de DST HIV/AIDS. Todo atendimento e exames serão realizados nas dependências da FMTM e nos Laboratórios de Função Autonômica Cardíaca, de Parasitologia e de Fisiologia. Os pacientes serão acompanhados mensalmente durante o período de 12 meses com atendimento ambulatorial de acordo com a seguinte metodologia: realização de história clínica do paciente e exame físico geral, sendo os dados anotados em ficha específica do ambulatório de Chagas do Hospital Escola da FMTM. Os pacientes realizarão, inicialmente, exames para classificação de formas clínicas (Ecocardiograma, Raios-X de tórax, esofagograma, enema opaco). O eletrocardiograma convencional de 12 derivações com análise espectral e o; teste de função autonômica serão realizados no início e com10 meses de acompanhamento em todos pacientes. A cada três meses os pacientes chagásicos e chagásicos co-infectados serão submetidos ä avaliação parasitológica para detecção da parasitemia e isolamento do T. cruzi. Exames bioquímicos para dosagem de glicemia, colesterol total e frações, triglicérides, uréia, creatinina, sódio, potássio, hemograma são considerados de rotina e serão realizados no acompanhamento ambulatorial. Todos os exames supramencionados já estão incorporados na prática médica diária de avaliação dos pacientes portadores de doença de Chagas e/ou de retrovirose e não são de alto risco. A terapia anti-retroviral altamente eficaz (HAART) e o tratamento terapêutico para doença de Chagas serão instituídos quando houver indicação Nos casos suspeitos de reativação com invasão para o sistema nervoso central e/ou coração serão realizados exames parasitológicos, avaliação eletrocardiográfica e caso confirmada todos demais exames assim como tratamento terapêutico adequado. Todos os indivíduos serão previamente esclarecidos e orientados quanto ao estudo a ser conduzido e seus objetivos e participarão,voluntariamente, após assinatura de consentimento livre e esclarecido o qual será realizado dentro das disposições éticas estabelecidas universalmente para a experimentação humana e com base na resolução 196/96 do Ministério da Saúde. O presente estudo foi submetido à análise pelo Comitê de Ética em Pesquisa da faculdade de Medicina do Triângulo Mineiro. 2. Padronização e análise do teste de função autonômica Após 10 minutos de repouso, deitado, será realizado o eletrocardiograma basal de repouso de 12 derivações, seguido de registro basal de repouso da derivação DII durante dez minutos. Simultaneamente, será aferida, de modo contínuo, a pressão arterial empregando-se sistema com registro de PA por fotoplestismografia digital (PortaPres) e aferida a freqüência respiratória. Em seguida, sobre cada lado da face do paciente serão aplicadas bolsas térmicas, contendo água gelada (4º a 6ºC) e realizados o registro eletrocardiográfico, mesma derivação durante cinco minutos, pressão arterial e a freqüência respiratória no segundo minuto. Após 5 minutos de descanso, será obtido o registro eletrocardiográfico na posição ortostática ("Til Test") por 5 minutos, a pressão arterial no mesmo registro contínuo e freqüência respiratória no segundo minuto. Os registros contínuos serão armazenados em computador e os dados clínicos anotados em ficha padrão. Os registros eletrocardiográficos contínuos serão transmitidos para o computador, através de um conversor analógico-digital (MODELO DI 720-USB+ INDAQ PRO +, DATAQ INSTRUMENTS) adaptado como interface, e armazenados em disquete através de software específico (LINEAR ANALYSIS). Este software analisa matematicamente os intervalos RR do registro, calculando a sua variabilidade no período de tempo: índices temporais paramétricos (média, mediana, coeficiente de variabilidade e desvio-padrão). Por meio de modelos matemáticos auto-regressivos é realizada a análise espectral ou domínio da freqüência dos intervalos RR, avaliando áreas espectrais de muito baixa freqüência (0,04 Hz), baixa freqüência (0,04-0,15) e alta freqüência (0.15-0,50). Este espectro é representado por um gráfico da amplitude dos componentes harmônicos (em s2/Hz) em função de suas respectivas freqüências (em Hz). A caracterização das bandas de freqüência será definida em estudos prévios, na literatura, e padronizada em indivíduos normais (Beraldo, 1987; Junqueira JR, 1990; Chapadeiro et al., 1991; Junqueira JR et al. 1992; Marin-Netto et al, 1996) e relacionada com a atividade do sistema nervoso simpático (áreas de baixa freqüência) e o parassimpático (áreas de alta freqüência), que também sofrem influência das oscilações respiratórias da freqüência cardíaca (Lombardi et al., 1987; Akselrod, 1981; Pomeranz et al., 1985). Serão avaliados os seguintes índices: 1) Índices temporais: média, mediana e desvio-padrão; coeficiente de variabilidade (desvio-padrão/média); valores extremos (mínimo e máximo); diferença entre os valores mínimo e máximo. 2) Índices espectrais: Área espectral total (power total), que expressa a variância de todas as freqüências; área espectral absoluta (power absoluto), que compreende a área de cada faixa de freqüência em separado e expressa a variância de cada área de freqüência; área espectral relativa ou normalizada (power relativo), que compreende a área de cada uma das faixas de freqüência sobre a área de freqüência espectral total e expressa a proporção entre a área absoluta e a área espectral total; Razão entre as áreas absolutas das faixas de baixa e alta freqüência espectrais, que reflete o balanço autonômico símpato-vagal. 3. Exames para classificação de formas clínicas dos pacientes Exames Radiológicos: os exames radiológicos (Rx tórax, enema opaco, esofagograma), serão realizados em todos os indivíduos dos três grupos para a classificação da forma clínica da doença (indeterminada, digestiva, cardíaca ou cárdio-digestiva). Os exames contrastados serão efetuados apenas nos pacientes chagásicos. Ecocardiograma: O grau de acometimento cardíaco será avaliado através de ecocardiograma bidimendional e Doppler. 4.- Exames bioquímicos Através dos exames bioquímicos os pacientes serão caracterizados quanto à presença de outras doenças concomitantes (diabetes, dislipidemias, distúrbios eletrolíticos, insuficiência renal). 5.- Exames parasitológicos: 5.1 - Amostras de sangue e líquido céfalo-raquidiano (LCR) De cada paciente serão obtidos 40ml de sangue, sendo que 30ml serão coletados com tubos vacutainer heparinizados e destinados para a hemocultura e 10ml retirados com tubos vacutainer não heparinizados para análise molecular. Esse será, imediatamente, transferido, para um frasco de polipropileno de 50ml com tampa de rosca (Falcon) contendo igual volume da solução de guanidina-EDTA (Guanidina-HCl 6M e EDTA dissódico 0,2M, pH 8.0), homogeneizado, mantido durante uma semana a temperatura ambiente e posteriormente estocado a 4ºC até a fervura e extração do DNA. Nos casos suspeitos de invasão do sistema nervoso central serão obtidos, por meio de punção lombar, 3ml do líquido cefalorraquidiano, dos quais 1ml será utilizado para hemocultura e 2ml preservados (v/v) em guanidina-EDTA. 5.2. Determinação da parasitemia e Isolamento do parasito A parasitemia dos pacientes será avaliada a cada três meses pela realização do exame a fresco microhematócrito, hemocultura e PCR. 5.2. 1-Hemocultura As hemoculturas serão realizadas segundo a metodologia proposta por CHIARI et al. (1989) e LUZ et al. (1994) utilizando 30ml de sangue venoso heparinizado. Imediatamente após a coleta o sangue será centrifugado a 2616xg durante 10 minutos a 4 C. Em seguida, o plasma será removido e o volume inicial reconstituído com LIT, repetindo-se o processo anterior de centrifugação. Após, o sobrenadante será removido e o sedimento de hemácias homogeneizado com 30ml de LIT e distribuído em 6 tubos plásticos com tampa de rosca (5ml/tubo). O plasma será centrifugado a 2616xg (10min - 4°C) e ao seu sedimento será adicionados 5ml de meio LIT. Estes tubos serão mantidos em estufa a 28ºC e homogeneizados uma vez por semana para aeração. O exame microscópico será realizado aos 30, 60 e 90 dias após o cultivo, observando-se alíquotas de 10µl da suspensão de cada tubo entre lâmina e lamínula, com aumento de 400X. A partir dos tubos positivos serão realizados repiques em meio de LIT para a obtenção de massas de T. cruzi em fase logarítmica de crescimento (1 x 106 epimastigotas). Na tentativa de evitar uma seleção de populações do parasito por prolongada manutenção em meios artificiais, todos os cultivos passaram, no máximo, por seis a sete repiques, equivalentes a aproximadamente 60 dias em meio de cultura, quando, então, serão obtidas as massas e as cepas criopreservadas. Após a amplificação em meio de LIT os parasitos serão lavados (3X) em tampão KRT (Krebs-ringer-tris) pH 7,2 sendo concentrados por centrifugação a 2616xg durante 10 minutos a 4°C. O sedimento de parasitos (massas úmidas) permanecerá a -70°C até o momento da extração do DNA. 5.3. Extração do DNA 5.3.1 - Amostras de sangue e do líquido céfalo-raquidiano (LCR) Antes de iniciar a extração de DNA as amostras de sangue e LCR preservadas em guanidina-EDTA serão fervidas em banho-maria durante 15 minutos, com o objetivo de promover a linearização dos minicírculos concatenados na rede de kDNA (BRITTO et al., 1993) permitindo uma distribuição homogênea das seqüências alvo presentes na amostra. O DNA será extraído de acordo com a técnica proposta por SAMBROOK et al. (1989), com algumas modificações propostas por GOMES et al. (1998). Estes autores utilizaram maior alíquota de sangue lisado, glicogênio como carreador de DNA e diluição do DNA extraído em um volume menor (20 l) tornando o protocolo de extração mais eficiente. Alíquotas de 200µl do sangue lisado e fervido serão desproteinizadas com igual volume de uma mistura de fenol-clorofórmio (v/v), seguida de purificação da fase aquosa com clorofórmio (v/v) e precipitação do DNA presente na fase aquosa com 2 volumes de etanol absoluto, 40 g de glicogênio (Boehringer Mannheim, Alemanha), 100mM de acetato de sódio, em banho de gelo, durante 15 minutos. Após centrifugação a 10.000rpm, durante 15min, o sobrenadante será descartado e o DNA, após volatização do etanol, ressuspendido em 20µl de água milli-Q estéril. O DNA será armazenado a 4ºC até o momento do uso nas reações de PCR específica, rDNA e LSSP-PCR. 5.3.2 - Amostras de cultura em meio LIT O DNA total do T. cruzi será extraído a partir de massas de cultura do parasito obtidas após seu isolamento e amplificação pela hemocultura em meio LIT, contendo aproximadamente 1x109 parasitos em fase logarítmica de crescimento de acordo com MACEDO et al. (1992). O sedimento de parasitos será ressuspendido em 1ml de tampão de lise (80mM NaCl, 45mM EDTA pH 8,0, SDS 1%) contendo 0,1mg/ml de proteinase K (Sigma-Aldrich Company Ltda., MO, USA) e incubado a 37°C durante 12 horas. A extração do DNA será realizada por desproteinização com fenol (v/v), agitação durante 5 minutos, centrifugação a 2616xg por 10 minutos a temperatura ambiente. A fase aquosa será recuperada e submetida a extrações com igual volume (v/v), fenol:clorofórmio:álcool isoamílico (25:24:1) e clorofórmio:álcool isoamílico (24:1) nas mesmas condições anteriores. A precipitação do DNA ocorrerá na presença de 2 volumes de etanol absoluto gelado, 300mM de acetato de sódio a -70°C por 2 horas. Após centrifugação e volatilização do etanol, o precipitado obtido será ressuspendido em 1ml de tampão da ribonuclease (80mM NaCl, 5mM EDTA pH 8,0 e 50µg de ribonuclease A) e incubado a 37°C durante 2 horas. A seguir será realizada nova extração e precipitação do DNA como descrito anteriormente. O DNA obtido será diluído em 300µl de tampão Low TE (10mM Tris-HCl e 0,1mM EDTA pH 8,0) e estocado a -20°C. A concentração aproximada do DNA total será determinada em espectrofotometro e a concentração final do DNA será ajustada nas amostras para 1ng/µl, as quais serão mantidas a 4°C até o momento do uso nas reações de PCRespecífica para T.cruzi de caracterização genética (LSSP-PCR,e rRNA). 5.4 - PCR para detecção e caracterização do T. cruzi 5.4.1 - Amplificação específica do T. cruzi Nas reações da PCR específica as seqüências da região constante dos minicírculos da rede de kDNA do T. cruzi serão o alvo da reação. Um fragmento de 330pb será amplificado com os seguintes iniciadores, descritos por WINCKER et al. (1994): 121 (5'-AAATAATGTACGGGGGAGATGCATGA-3') 122 (5´-GGTTCGATTGGGGTTGGTGTAATATA-3') A metodologia usada para a amplificação específica do T. cruzi será a proposta por GOMES et al. (1998). A PCR será realizada num volume final de 20µl contendo 10mM Tris-HCl (pH 9,0), 0,1% Triton X-100, 3,5mM MgCl2, 75mM KCl, 0,2mM de cada dNTP's (dATP, dCTP, dGTP and dTTP), 1,0 unidade de Taq DNA polimerase (Promega, Madison, WI, USA), 20pmol de cada iniciador (121 e 122), 2µl de DNA e 30µl de óleo mineral. O programa de amplificação terá uma desnaturação inicial a 95ºC (5min) e 35 ciclos com desnaturação a 95 C (1min), anelamento a 65ºC (1min) e extensão a 72ºC (1min), seguida de extensão final de 10 minutos, em um termociclador MJ Research PTC-100. 5.4.2 - LSSP-PCR (Low stringency single specific primer-PCR) A obtenção de assinaturas gênicas do kDNA do T. cruzi será realizada em duas etapas: a primeira consistirá na amplificação específica (PCR) de um fragmento de 330pb representante das quatro porções variáveis do DNA presente nos minicírculos do T. cruzi; e a segunda na re-amplificação desse produto com um iniciador único, na reação de LSSP-PCR. O produto da PCR correspondente a amplificação específica do kDNA do T. cruzi será purificado em gel de agarose 1,5% (1,0% agarose comum e 0,5% agarose low melting) em TBE 1X (89mM Tris-borato, 2mM EDTA pH 8,0) preparado com água bidestilada estéril, em presença de 0,5µg/ml de brometo de etídeo. As bandas de 330pb serão visualizadas em um transiluminador de luz ultravioleta de comprimento de onda longo e coletadas com auxílio de um bisturi ou uma pipeta de transferência. Após aquecimento em banho-maria as amostras serão homogeneizadas e diluídas 1:10 com água milli-Q estéril, sendo, então, utilizadas como DNA molde para as reações de LSSP-PCR (VAGO et al., 1996a e 2000). Na reação de LSSP-PCR as amostras de DNA serão re-amplificadas em condições de baixa estringência (BARRETO et al., 1996) utilizando um único iniciador específico correspondente ao iniciador 121 com 21pb e também denominado S35 - 5' AAATAATGTACGGGGGAGATG 3'. A mistura da reação terá um volume final de 10µl contendo 10mM Tris-HCl (pH 8,5), 0,1% Triton X-100, 1,5mM MgCl2, 0,2mM de cada dNTP's (dATP, dCTP, dGTP and dTTP), 1,0 unidade de Taq DNA polimerase, 45pmol do iniciador e 3µl de DNA (fragmento de 330pb purificado em agarose e diluído 1:10) cobertos com 30µl de óleo mineral. A amplificação passará por 40 ciclos envolvendo desnaturação a 94ºC (1min), anelamento a 30oC (1min) e extensão a 72oC (1min), precedidos de desnaturação inicial a 94oC (5min). Após os 40 ciclos será realizada uma extensão adicional a 72ºC durante 7 minutos. Os produtos de LSSP-PCR serão separados por eletroforese em gel de poliacrilamida a 7,5%, corados pela prata, gerando um perfil composto por múltiplas bandas. A análise destes perfis refletirá a seqüência de nucleotídeos do DNA usado como molde, constituindo sua "assinatura gênica". 5.4.3 - Amplificação da região 3'do gene do RNA ribossômico (rDNA) 24S A amplificação do domínio divergente do gene ribossômico 24S permitirá a caracterização das cepas isoladas de acordo com sua origem, ou seja, associadas aos ciclos de transmissão doméstico ou silvestre e será realizada de acordo com a metodologia previamente descrita (SOUTO & ZINGALES, 1993; SOUTO et al., 1996). A reação será processada em um volume final de 25µl contendo 10mM Tris-HCl (pH 9,0), 50mM KCl, 3,5mM MgCl2; 0.65 unidades de Taq DNA polimerase, 0.1% Triton X-100; 0.2mM de dATP, dCTP, dGTP and dTTP, 10pmol dos iniciadores D71: 3'-AAGGTGCGTCGACAGTGTGG-5' e D72: 3'-TTTTCAGAATGGCCGAACAGT-5', 1ng/µl de DNA do T. cruzi e 30µl de óleo mineral. A PCR será realizada num termociclador MJ Research PTC-100, de acordo com o seguinte programa: desnaturação inicial a 94°C (4 min), 30 ciclos com desnaturação a 94°C (1min), anelamento a 60°C (1min) e extensão a 72°C (1min) seguida de extensão adicional no último ciclo a 72°C. (7min). O produto amplificado será visualizado após eletroforese em gel de poliacrilamida 6%, corado pelo nitrato de prata. A visualização dos fragmentos de 125pb, 110bp ou ambos indicará que o T. cruzi pertence ao T. cruzi II, T. cruzi I ou T. cruzi 1/2, respectivamente. 5.4.4 - Eletroforese em géis de poliacrilamida Os produtos de amplificação obtidos por meio da PCR serão analisados em géis de poliacrilamida, não desnaturante, em diferentes concentrações de acordo com a técnica utilizada. Na PCR específica (iniciadores 121 e 122) e na amplificação do gene rDNA 24S serão utilizados géis a 6% e na LSSP-PCR géis a 7,5%. Uma amostra de 3 a 5µl do produto amplificado, diluído com igual volume do tampão da amostra 2X (0,5% de azul de bromofenol; 0,5% de xileno-cianol; 60% de glicerol) será aplicada em cada canaleta. A corrida eletroforética, em geral, será realizada a 80-100 Volts durante aproximadamente 3h, ou seja, com a migração de 6-7cm do corante xileno-cianol. O tamanho das bandas amplificadas será monitorado com a utilização de marcadores b de peso molecular de 50 ou 100pb para PCR específica, LSSP-PCR e rRNA Após a eletroforese os géis serão transferidos para solução fixadora (etanol absoluto 10%, ácido acético 0,5%) durante 5 minutos e corados com de nitrato de prata (AgNO3) a 0,2% em solução fixadora durante 10 minutos. A revelação das bandas do DNA amplificado será realizada pela redução dos sais de prata com NaOH 3% (p/v) e 0,3% de formaldeído (37%) durante 10 minutos como previamente descrito (SANTOS et al., 1993). Após o aparecimento das bandas a revelação será interrompida com a solução fixadora e os géis fotografados. 5.5 - Análise dos dados e construção dos fenogramas A análise dos perfis de bandas obtidas pela reação de LSSP-PCR será avaliada visualmente. Os padrões observados serão inseridos manualmente no computador e submetidos à análise de proporção de bandas compartilhadas entre as cepas com o programa DNA-POP (PENA & NUNES, 1990) e construção de fenogramas pelo programa Treecon (VAN de PEER, 1997). O programa DNA-POP usa como princípio básico a divisão vertical do gel em níveis de mobilidade, no qual um nível é definido pela presença de, pelo menos, uma banda em qualquer uma das canaletas do gel. De acordo com o número da canaleta e as posições das diferentes bandas a proporção de compartilhamento entre as mesmas é calculada. O programa analisa os dados em comparações de pares em n (n-1)/2 fornecendo o número total de bandas e a proporção de bandas compartilhadas por cada par e, no final, para todos os pares. No programa Treecon será utilizada a medida de distância genética e o método da Média Aritmética não Ponderada - UPGMA (Unweighted Pair-Group Method Analysis ) para construção das árvores genéticas. 6 - Quimioterapia in vitro As cepas isoladas serão submetidas ao teste de sensibilidade aos derivados nitroimidazólicos (benzonidazol, itraconazol, fluconazol). Estes compostos serão administrados a camundongos ou cães normais na concentração de 500mg/Kg, por via oral. Os animais serão sangrados no pico máximo de concentração das drogas (2-3h) e o plasma será obtido. Como controles serão coletados plasmas de animais normais. Esse material será aliquotado e congelado para os testes de drogas. 6.1 - Infecção das monocamadas de células Monocamadas de células MK2 e /ou macrófagos serão infectadas com tripomastigotas obtidos de cultivo em meio de LIT. Após 7-15 dias de multiplicação intracelular tripomastigotas de cultivo celular (TCC) serão obtidos e utilizados para infectar novas monocamadas de células em lâminulas concentração de 5 parasitos/célula. Após três dias essas monocamadas serão tratadas com o plasma contendo as drogas metabolizadas, o qual permanecerá em contato com as células durante 24, 48 e 72horas. Após esse período as drogas serão removidas, as monocamadas lavadas e colocadas em contato com meio RPMI, acrescido de 10% de soro fetal bovino. A cada 24 horas serão obtidas amostras para coloração com Giemsa a fim de se quantificar o número de parasitos intracelulares. 7 - Análise estatística Inicialmente será realizada a análise estatística descritiva para todos os índices mediana, média, percentis 25 e 75, desvio e erro padrão. Em seguida, realizar-se-á o teste de Kolmogorov-Sminov e teste de Barllet, para testar a normalidade da amostra. A análise de variância (ANOVA) de um fator - teste de Tukey ou Kruskall-Wallis e o teste de Dunn quando necessário. A distribuição quanto ao gênero e a terapia empregada serão analisadas pelo teste do Qui-Quadrado. Será considerado como significância estatística, valores de p 0,05.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: Análise genotípica de crianças HIV+ nascidas de mães que usaram anti-retroviral durante a gestação ou parto através da técnica de "real time PCR".
Coordenador: MARCELO ALVES SOARES
Resumo: Apesar do acesso livre e universal aos anti-retrovirais e de taxas de transmissão vertical semelhantes às de países desenvolvidos (4), não há dados publicados no Brasil sobre a prevalência de mutações de resistência em recém-nascidos e nem em gestantes HIV-positivas. Dados da literatura mundial descrevem a presença de mutações de resistência à zidovudina em crianças infectadas que variam de 9 a 17%, porém essas taxas se referem a apenas 18 crianças (5-8). Há apenas 1 relato de 2 crianças com resistência a 3TC e apenas 1 crian-ça com uma cepa multi-resistente aos inibidores de transcriptase reversa e de protease (9-10). As maiores taxas de transmissão vertical de cepas resistentes foram vistas com o uso de dose única de NVP antes do parto e para o recém-nascido em Uganda, onde mutações de resistência foram achadas em até 46% das cri-anças (11). Trabalhos recentes vem demonstrando que as taxas de transmissão vertical de cepas resistentes são subesti-madas devido à menor sensibilidade da genotipagem convencional em comparação com técnicas ultra-sensíveis (12, 13). Por esta razão propomos nesse projeto a utilização da técnica de PCR em tempo real para determinação mais efetiva das cepas mutantes transmitidas verticalmente. Por outro lado, ainda são inconclusivas as evidências de que a presença de mutações de resistência nas mães aumentaria o risco de transmissão vertical (5, 14). A taxa de transmissão vertical (TV) do HIV no Brasil tem variações extremas. Enquanto que em algumas áreas da região Sudeste essa taxa se assemelha ao dos países desenvolvidos, ao redor de 1.2% a 3.5% (4, 15), a região Sul possuí as maiores taxas de transmissão vertical do país (1). Um recente estudo realizado por Martinez et al, mostrou uma taxa de 11.7% na região do Rio Grande, localizada ao Sul do RG, onde mais de 70% da população estudada apresentava-se infectada pelo subtipo C do HIV-1 (3). O Hospital Universitário do Rio Grande , localizado na região sul do Rio Grande do Sul, possui amostras pareadas mãe-filho armazenadas desde 1998. O interesse em estudar essa população se baseia nos seguintes fatos: 1. Encontra-se numa área com alta taxa de transmissão vertical (TV) apesar do uso de ARV em 93% das gestantes (3). 2. Não se sabe ainda o porque das maiores taxas de TV na região Sul do país. Uma das hipótese é que hou-vesse uma deficiência no diagnóstico precoce da infeção pelo HIV em gestantes nessa região, porém um estudo-sentinela em gestantes realizado no Brasil em 2002 (16) mostrou que a região Sul apresenta a maior cobertura de solicitação de sorologia para o HIV em gestantes, assim como a maior taxa de início do acom-panhamento pré-natal durante o primeiro trimestre e de pré-natal com 6 ou mais consultas. 3. É uma área em que há circulação de dois subtipos prevalentes no Brasil: o subtipo C e o subtipo B. É sabido que o subtipo C é transmitido preferencialmente numa fase mais precoce da gravidez (intra-uterina), enquanto o subtipo B é predominantemente transmitido na hora do parto (17). É possível que esta diferença no momento da transmissão vertical tenha impacto na transmissão diferencial de cepas resistentes de vírus. Além disso, tem sido demonstrado que mães infectadas com subtipo C desenvolvem mais mutações de re-sistência à nevirapina, quando tratadas com esta droga durante o pré-natal do que aquelas com outros subti-pos(18) . Os resultados dessa pesquisa poderão sugerir modificações no manejo das gestantes infectadas pelo HIV, dependendo do subtipo infectante. Além disso o estudo poderá indicar a necessidade de genotipagem em crianças nascidas de mães portando vírus com mutações de resistência. Finalmente a detecção de resistência em crianças, ainda que em proporções minoritárias da população viral, poderá ter impacto na modificação dos consensos terapêuticos para crianças, em especial quanto ao uso de terapia dupla nessa população. A publicação do protocolo PACTG 076 em 1994 mostrou que era possível prevenir-se a transmissão verti-cal (TV) do HIV atravéz do uso de zidovudina (AZT) antes, durante e após o parto no recém-nato (19). Ou-tros estudos mostraram que o uso de terapia anti-retroviral dupla ou tripla poderiam reduzir ainda mais as taxas de TV (20,21), e atualmente as recomendações do Ministério da Saúde para o tratamento de gestantes infectadas pelo HIV se baseia no uso de terapia tripla salvo nos casos em que a carga viral da gestante seja abaixo de 1.000 cópias/ml , quando o emprego da zidovudina isolada é recomendado (22). Com a possibili-dade de gerar um bebe saudável, observa-se um aumento nos casos de gestações em pacientes já em uso de anti-retrovirais (4) , muitas dos quais já foram tratadas com múltiplos esquemas terapêuticos e nem sempre com resposta virológica eficaz (isto é, uma carga viral indetectável). Além disso, a taxa de gravidez sucessi-va também é alta (23), o que aumenta o risco de nova exposição à um anti-retroviral que já tenha sido utili-zado em gestações anteriores, já que vários antiretrovirais não devem ser utilizados neste período como por exemplo, a associação de d4T+DDI, efavirenz, além da falta de dados para os anti-retrovirais mais recentes (24). Sabe-se que vários são os fatores envolvidos nos casos de transmissão vertical do HIV, como alta car-ga viral materna próxima ao parto, CD4 baixo, ruptura prolongada de membranas e DSTs associadas, mas ainda se conhece pouco sobre a transmissão de cepas com mutações de resistência aos anti-retrovirais nessas crianças. A maioria dos trabalhos sobre a presença de mutações de resistência aos anti-retrovirais empregam a geno-tipagem padrão, em que é necessária a presença de pelo menos 20% de cepas mutantes para que estas pos-sam ser detectadas. A utilização da tecnologia de PCR em tempo real permite a amplificação de até 1 cópia de vírus, sendo extremamente mais sensível que o PCR convencional, além de permitir quantificar a porcen-tagem de cepas mutantes numa amostra. Através da análise de amostras de pares mães-filhos em que ocorreu a transmissão vertical do HIV, nosso estudo pretende caracterizar as cepas que foram transmitidas em termos de mutações de resistência (qualita-tiva e quantitativamente) em uma área da região Sul do país que apresenta atualmente as maiores taxas de transmissão vertical do país. Transmissão vertical de cepas com mutações de resistência : O primeiro relato de transmissão vertical de HIV-1 resistente à zidovudina foi feito em 1995 (25). Neste relato 4 entre 16 gestantes que foram tratadas com zidovudina oral tinham cepas com mutações de resistên-cia e em uma delas ocorreu a transmissão de uma cepa altamente resistente ao azt para o recém-nascido. Estudos em gestantes têm associado o risco de desenvolvimento de mutações de resistência ao AZT à dura-ção da terapia, estágio da doença, baixa contagem de CD4 e alta carga viral (5,6). As estimativas da presen-ça de mutações nessa população mostram que a prevalência de alto grau de resistência (quando há a presen-ça da mutação no codon 215) varia entre 6% e 12%, enquanto que a taxa de qualquer mutação para esse anti-retroviral é de 11% a 25% (25). Estimativas da prevalência de mutações em gestantes brasileiras ainda não estão disponívies. A grande discussão em torno do desenvolvimento de mutações de resistência em gestantes é se esse fato se associaria com uma maior taxa de transmissão vertical. Dois grandes estudos mostraram resultados confli-tantes em relação ao risco de transmissão vertical de cepas resistentes. O primeiro deles foi feito com paci-entes arroladas para o Protocolo 076 (14), onde apenas 3 de 48 pacientes genotipadas antes do parto mostra-ram mutações de resistencia e não houve correlação entre a presença delas e maior risco de TV, apesar de que nesse estudo nenhuma mutação foi encontrada no codon 215. Por outro lado Welles et al estudaram 142 gestantes arroladas no projeto WITS e encontraram uma taxa de transmissão vertical de 24,4% (8/34) na-quelas com mutações de resistência em oposição à 18,8% (18/96) de transmissão em mães sem mutações de resistência (5). Na análise genotípica das cepas mutantes desenvolvidas pelas mães observou-se que naque-las com misturas de cepas mutantes e selvagens houve transmissão para o bebê de cepas selvagens (60% dos casos) ou exclusivamente de cepas com mutações (40% dos casos), mostrando pela primeira vez que apenas a caracterização de mutações de resistencia na mãe não prediz que cepa será transmitida caso haja infecção do recém-nascido. Um fato importante nesse relato foi o achado de que o uso prévio de zidovudina aumen-tou risco de transmissão de cepas resistentes em quase 4 vezes quando comparado com mães sem tratamento prévio. Uma descrição mais detalhada da transmissão de cepas mutantes nessa mesma população concluiu que cepas resistentes ao AZT, mas sem a presença da mutação do codon 215, não são transmitidas aos re-cém-nascidos mesmo que estas cepas sejam predominantes na população viral circulante (26). Estudos avaliando a presença de mutações de resistência ao AZT em recém-nascidos mostraram a presença de cepas mutantes entre 20% e 24,5%. Em alguns casos foi observado a correlação entre uma maior taxa de misturas de cepas selvagens com cepas mutantes naqueles com alta carga viral (27). Numa coorte francesa de neonatos descreveu-se 7 crianças com mutações de resistância a zidovudina, porém apenas 4 mães ti-nham mutações de resistência antes do parto. Esses dados sugerem que a genotipagem foi insensível para detectar cepas minoritárias mutantes nas mães ou então que as mutações nas crianças se desenvolveram durante o uso da profilaxia pós-parto com AZT, já que a média de dias de vida nessas crianças foi de 26 dias (28). O uso de dupla terapia (AZT+3TC) durante a gestação mostou que apesar do desenvolvimento de resistên-cia ao 3TC em um grande número de puérperas (entre 12% e 39%), não foi observado um maior risco de transmissão vertical (29). Com o abandono do uso de dupla terapia e uso restrito do AZT apenas nas gestantes com carga viral baixa, atualmente a grande maioria é tratada com esquemas triplos constituídos de 2 INTRs + um inibidor de pro-tease (preferencialmente nelfinavir) ou 1 inibidor nâo-nucleosídeo da TR (nevirapina). O impacto do uso desses 2 braços terapêuticos em relação ao desenvolvimento de mutações de resistência nas mães são enor-mes. Enquanto que o uso de tripla terapia com inibidores de protease (IP) mostra uma frequência muito pequena de aparecimento de mutações de resistência, com apenas 1 relato na literatura de transmissão para um recém-nascido de um vírus com resistência à inibidores de protease (10,30), o uso da nevirapina tem sido associado com altos níveis de mu-tação tanto nas mães como nos seus conceptos A nevirapina (NVP), assim com o inibidor da TR lamivudina (3TC), desenvolvem rápida resistência pelo desenvolvimento de uma única mutação que leva à alta resistência a esses anti-retrovirais. A NVP em dose única foi empregada amplamente em Uganda tanto para a mãe como para o recém-nascido. Esses estudos mostraram o aparecimento de mutações em 20% das mães (com predomínio da mutação K103N que leva a resistência a todos os anti-retrovirais dessa classe) e em 46% dos neonatos infectados. Posteriormente mos-trou-se que na ausência de pressão seletiva da nevirapina, a maioria dessas mutações desaparecia ao final de 1 ano (11,12,18). Recentemente, com a utilização do PCR em tempo real e de outras técnicas ultra-sensíveis de detecção de populações virais minoritárias, tem-se observado que algumas mutações de resistência po-dem persistir por tempos muito mais prolongados do que préviamente estimados e que o PCR convencional não detecta cepas minoritárias quando essa população compreende 10% da população total viral e detecta apenas 25% daquelas entre 10% e 30%, mostrando que o uso de técnicas mais sensíveis são necessárias para o estudo da resistência aos antiretrovirais (13,31). Ainda é completamente desconhecido se o impacto de cepas minoritárias é clinicamente relevante. Por último foi demonstrado que o desenvolvimento de mutações de resistência à NVP em mulheres é 5 ve-zes mais comum no subtipo C quando comparado aos subtipos A e D (18) Questões fundamentais a serem respondidas ou hipóteses 1. Qual a taxa de mutações de resistência em crianças infectadas pelo HIV nascidas de mães tratadas com ARV durante a gestação? 2. Qual a taxa de cepas com mutações de resistência em gestantes HIV positivas tratadas com ARV, discri-minando os diferentes regimes terapêuticos e duração da exposição aos ARV? 3. Quais mutações de resistência são preferencialmente transmitidas para o concepto? 4. Qual o limiar de frequência de cepas mutantes na população viral materna que permite a transmissão des-sa população ao concepto? 5. Qual a taxa de transmissão vertical de mães transmissoras com e sem resistência aos ARV? 6. Qual o papel do subtipo infectante na gestante na transmissão vertical do HIV? 7. Qual o tempo de persistência das diferentes mutações de resistência aos ARV em crianças infectadas por cepas resistentes e não submetidas a tratamento? 8. Qual a diferença de detecção de mutações de resistência utilizando-se a técnica de PCR normal em com-paração com o PCR de tempo real? 9. Existe diferença de transmissão de cepas com mutações de resistência em diferentes momentos da trans-missão vertical (intra-utero versus periparto)?

Objetivo: OBJETIVO GERAL: Análise da presença de mutações de resistência em crianças infectadas pelo HIV , nascidas de mães em uso de antiretrovirais. Delinear propostas de terapia anti-retrovirais nos casos em que houve transmissão de cepas resistentes OBJETIVOS ESPECÍFICOS: 1. Estimar a prevalência de mutações de resistência em crianças infectadas pelo HIV através da trans-missão vertical 2. Caracterizar as mutações de resistência que foram transmitidas através da quantificação da cepa mutante na criança e na mãe transmissora. 3. Estimar o tempo para o desaparecimento da cepa mutante na criança que não foi submetida à trata-mento antiretroviral. 4. Comparar a sensibilidade do PCR convencional com a técnica de real-time PCR na deteção de mu-tações de resistência. 5. Determinar o subtipo infectante e a prevalência de mutações de resistência em mães transmissoras e não-transmissoras 6. Determinar a taxa de transmissão vertical nas mães transmissoras com e sem mutações de resistên-cia 7. Determinar em que momento da gravidez (intra-útero vs intra-parto) ocorreu a transmissão vertical.

Metodologia: Para o estudo restrospectivo serão analisados todas as amostras estocadas no HURG de gestantes HIV positivas acom-panhadas no período entre 1998 e 2004. Só serão analisadas aquelas que fizeram uso de ARV antes do parto (93 amos-tras) assim como as amostras de 12 crianças que foram infectadas neste período. Nas crianças que estão em acompa-nhamento no Serviço de Pediatria do HURG, e têm amostras estocadas a cada 3 meses, será acompanhado a evolução das mutações de resistência temporalmente. Para as gestantes que comprovadamente foram diagnosticadas como HIV positivas (através de 2 ELISAs positivos e 1 Western Blot ou 1 Imunofluorescência) que serão acompanhadas prospec-tivamente será explicado os objetivos da pesquisa e será necessária a assinatura de um Termo de Consentimento Livre e Esclarecido. Será solicitado 1 amostra de sangue ao início do acompanhamento (antes da introdução dos ARV) e uma outra amostra perto do parto (ao redor da 34ª semana de gestação). Aos recém-nascidos será solicitado uma amostra de sangue nas primeiras 24-48hrs do parto e caso esta esteja negativa para HIV (medida através de PCR quantitativo), uma segunda amostra será coletada ao redor do 14º dia de nascimento. Essas crianças ainda colherão uma amostra ao redor do 30º dia e outro ao redor dos 4 meses de idade para estabelecimento do diagnóstico de infecção pelo HIV con-forme as normas estabelecidas pelo Ministério da Saúde. Genotipagem das amostras: As amostras serão genotipadas utilizando-se o PCR normal e a técnica de PCR.em tempo real ("real-time PCR"). PCR normal: O RNA viral será isolado como descrito previamente (32). Após a síntese do cDNA com iniciadores randômicos, P-CRs aninhados serão conduzidos para a amplificação individual dos genes da protease (PR) (região inteira) e da trans-criptase reversa (RT) (nts 105 a 651). Os iniciadores e as condições de PCR utilizadas serão como descrito anterior-mente (32). Os fragmentos de PCR serão sequenciados em um sequenciador automático ABI 3100 (Applied Biosys-tems), com os mesmos iniciadores utilizados no 2º round das amplificações. Todas as sequências obtidas serão subme-tidas a testes de controle de qualidade para garantir que não tenham havido misturas entre as amostras ou contamina-ções de outras fontes (33). Protease As sequencias de PR e RT de todas as amostras serão submetidas à análise filoge-nética para a determinação do subtipo do HIV-1. As sequências serão alinhadas utilizando-se o programa ClustalW (34) e manualmente editadas. O alinhamento então será realinhado contra um conjunto de seqüências-referência de subtipos do HIV-1 obtido no Banco de Dados de Los Alamos (http://hiv-web.lanl.gov/). As inferências filogenéticas serão conduzidas pelo método de "neighbor-joining" utilizanod o modelo F84 de substituição implementado no PAUP v. 4.0b2a (35). As sequências em que ambas as regiões genômicas agruparem claramente em um dos grupos de se-qüências-referência serão atribuídas àquele subtipo. As mutações de resistência aos anti-retrovirais nos genes da PR e da RT serão avaliadas segundo o consenso mais atualizado da Sociedade Internacional de AIDS (IAS-USA) (36). PCR em tempo real: Esta técnica de PCR permite, com a devida utilização de controles positivos apropriados (genes-referência), que a quantidade inicial do material a ser detectado seja estimada através de uma regressão semi-logarítmica da curva de amplificação. Na fase logarítmica da reação, a quantidade de produto detectado (por flourescência) é diretamente pro-porcional à concentração de DNA inicial. Em outras palavras, o PCR em tempo real é uma técnica quantitativa, o que não é possível pela técnica convencional de PCR. Além disso, com a utilização de inciadores ("primers") marcados com fluorocromos de cores diferentes, a técnica permite que duas populações genéticas diferentes sejam amplificadas simultaneamente, porém detectadas e quantificadas distintamente dentro do mesmo tubo de PCR. Isto ocorre quando se utilizam iniciadores que amplificam especificamente cada uma das populações. No nosso caso, utilizaremos iniciadores que amplifiquem variantes virais com mutações de resistência aos ARV espe-cíficas nos genes da protease ou da transcriptase reversa viral (INTRs: K70R, M41L, L210W, T215Y, T215F; M184V. INNTR: K103N, Y181C. IP: D30N, V82A, L90M) ou a versão tipo selvagem deste gene. Isto permitirá que possamos medir as freqüências destas mutações das populações virais que infectam as crianças com resistência, bem como a de suas mães. Todos os dados compilados serão armazenados em um banco de dados do pacote estatístico EPI Info v.6.04 e serão exportadas para o pacote estatístico SPSS 8.0 para análise. Determinação da taxa de transmissão vertical e fatores associados: Para todas as pacientes incluídas no estudo serão avaliados os seguintes fatores: Idade 2. Ano de entrada no estudo 3. Forma provável de aquisição do HIV (heterosexual, transfusional, uso de droga) 4. História deDoenças Oportunistas 5. CD4 e Carga viral no início do acompanhamento e antes do parto 6. Tempo de Gestação ao iniciar ARV 7. ARV usados durante a gestação. 8. ARV usados antes da gestação (caso já esteja em tratamento). 9. DST 10. Ano do parto 11. Tempo de gestação na época do parto 12. Tipo de Parto 13. Uso de AZT venoso durante o parto 14. Uso de xarope de AZT no bebê 15. Tempo de ruptura das membranas. 16. Idade do bebê em que foi constatado a primeira carga viral positiva.17. Descrição das mutações de resistência pelo PCR convencional e PCR em tempo real das gestantes e das crianças infectadas. A distribuicão das variáveis continuas serao estudadas, e todas as variáveis categóricas também terão sua frequência descrita. Posteriormente a análise bivariada das variáveis contínuas será realizada através do teste Wilcoxon, (optamos por um teste nao paramétrico, devido ao pequeno tamanho amostral). Para as variáveis categóricas, a análise bivariada sera realizada através do teste de Fisher. Para o ajuste de co-variáveis, utilizaremos a regressão logística. A variável dependente será a presenca ou não de transmissão materno-fetal. As variáveis independentes selecionadas para esta análise serão as variáveis que na análise bivariada apresentar p<=0.10. Para todas as hipóteses testadas faremos a análise bicaudal. p<.05 será considerado como estatísticamente significativo Caso seja demonstrado que há transmissão vertical de vírus resistentes ao azt, a outros INTRs e a nevi-rapina acreditamos que ele terá impacto nos seguintes aspectos: 1. A indicação da terapia adeqiada em crianças infectadas com cepas mutantes do HIV 2. Avaliar se o uso do PCR convencional é de utilidade para o diagnóstico dessas mutações ou se mé-todos mais sensíveis devem ser usados. 3. Avaliar a necessidade de implantação da carga viral nas primeiras 24-48hrs de nascimento ou ao fi-nal da primeira semana de vida para o diagnóstico precoce da infecção e genotipagem Em termos de Transmissão vertical acreditamos que os resultados servirão de estudo-piloto para avaliar: 1. O impacto do uso de antiretrovirais no desenvolvimento de mutações de resistência em gestantes HIV positivas. 2. A necessidade de estudos sobre o impacto de futuros tratamentos em mulheres que fizeram uso de ARV apenas para evitar a TV Como se trata de um estudo onde a maioria das amostras testadas encontram-se armazenadas , foi solicitado à Comissão de Ética em Pesquisa do Hospital Universitário do Rio Grande uma isenção do Termo de Con-sentimento Livre e Esclarecido, com o compromisso de que haverá total sigilo da identificação dos pacien-tes envolvidos na pesquisa e que as amostras só serão usadas para responder aos objetivos do presente proje-to (carta em anexo). Só se procederá à análise das amostras quando obtivermos a aceitação do Comitê de Ética do Hospital Aos casos novos que serão acompanhados prospecticamente, será exclarecido os propósitos da pesquisa. A coleta de dados informativos e os estudos genotípicos serão feitas somente após autorização dos voluntários que assinarem o TCLE . O presente estudo está em consonância com a Resolução no. 196/96 e suas complementares, assim co-mo com o Código de Ética Médica de 1988 (artigos 122 a 130). Será mantida a necessária confidenciabili-dade tanto quando da identificação de crianças assim como da identificação de suas mães. Todos os resulta-dos de exames, confidencialemente mantidos, serão arquivados nos prontuários das crianças e/ou de suas mães e no laboratório pelos pesquisadores por 5 anos. Conforme descrito na Metodologia deste projeto, todos as gestantes serão convidadas a participar do es-tudo, e em caso de aceitação serão devidamente esclarecidos dos objetivos do estudo. Também assinarão um Termo de Consentimento Livre e Esclarecido. Neste Termo, é esclarecido que os pacientes podem desistir de sua participação no estudo a qualquer momento, sem que isto interfira de qualquer forma em seu acom-panhamento e tratamento subsequente. Vale ressaltar que todos os resultados obtidos ao longo do estudo serão encaminhados aos médicos que acompanham cada paciente. No que diz respeito à Biossegurança, o Laboratório de Biologia Molecular do Depto de Patologia da FURG já foi avaliado e aprovado pelas Comissões Nacional e Local (da FURG) de Biossegurança. O Laboratório de Virologia Molecular (LVM) da UFRJ, conta com um laboratório de biossegurança de nível 3 (BL-3), com pressão negativa e com câmaras de fluxo laminar do tipo B2-L2. Todo o ar desta sala passa por um sistema de filtração do tipo Hepa-filtros, e é re-circulado em ambiente totalmente fechado. O laboratório conta ainda com uma autoclave de duas portas, em que o material potencialmente contaminado do BL-3 é autoclavado a partir daquela sala, e já sai não-infeccioso para o descarte no laboratório principal. Todas as medidas de biossegurança, incluindo portas com senhas controladas, vestimentas apropriadas para manipulação de material infeccioso, circuito fechado de TV para monitoramento, etc, estão instaladas no LVM.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Mulher - Criança (TV)

Natureza: ESTUDOS E PESQUISAS

Subnatureza: BÁSICA OU FUNDAMENTAL

Produção Científica


Projeto: Relação Parasita-Hospedeiro na co-infecção HIV x Leishmania sp e sua evolução para a Leishmaniose Tegumentar.
Coordenador: JACKSON MAURICIO LOPES COSTA
Resumo: No Brasil a LT apresenta-se em todas as regiões geográficas, caracterizando-se por três perfis epidemiológicos distintos: LT puramente silvestre; LT silvestre modificada; LT peri-urbana. Na area a ser estudada destaca-se o padrão LT silvestre modificado, onde salienta-se a importância da Lv braziliensis como parasita responsável pelos casos da doença, caracterizando-se clinicamente por apresentar lesões cutâneas, mucosas e cutâneo-mucosas. Alguns estudos, demonstraram que a diminuição na produção de micronutrientes, como zinco, cobre, ferro, funcionam como um dos fatores de risco associados ao desenvolvimento das formas cutâneas da LT - foi demonstrado ainda uma associação direta entre o risco de desenvolver a forma mucosa com o polimorfismo genético afetando a produção de TNF; Por outro lado, poliformismos nos recptores fcy já foram associados a susceptibilidade e evolução clínica de diversas patológias, póis os receptores Fcy constituem uma arma na defesa do hospedeiro contra danos extracelulares, funcionaria como interface entre as respostas imune humoral e celular. No momento da inoculação, o flebotomo injeta na presençaa de sua saliva, a qual contém numerosas substâncias com efeito anti-hemostáticos, antinflamatórios e que interferem na resposta imune. Nosso grupo mostrou que as crianças de uma área endemica de LV apresentam anticorpos anti-saliva de flebotomo. Observou-se ainda uma correlação positiva entre anticorpos, anti-saliva e uma IDRM anti - Leishmania (Brasil, et aI, 2000). No estudo poder-si-a especular que na associação da coinfecção Leishmania x HN não haveria a neutralizayao de produtos salivares pelos anticorpos permitindo o desenvolvimento mais eficiente da resposta imunocelular contra a Leishmania (Brodskin et aI, 2000).

Objetivo: OBJETIVO GERAL Avaliar se aspectos relacionados com a exposição humana aos flebótomos, variabilidade genética de moleculas chave e a resposta imune da população humana interferem na progressão da associação da infecção por Leishmania sp x HIV para doença na leishmaniose tegumentar. OBJETIVOS ESPECÍFICOS -Avaliar se a exposição humana aos flebótomos (medida pelo desenvolvimento de anticorpos anti-saliva do vetor, aqui usado como marcador epidemiológico de exposição ao flebótomo) interfere na progressão da associação da infecção por Leishmania sp x HIV para doença LT; "Avaliar se a variabilidade genética de moleculas chave (polimorfismos dos genes Fas e receptores Fc) interfere na progressão da associação da infecção por Leishmania sp x HIV para a doença LT; "Determinar se a resposta imune da população humana (avaliada pelos níveis de marcadores solúveis de resposta imunocelular, (neopterina, sICAM, sCD4, sCD8, sIL-2R, sCD4L e sRNF-RII) interfere na progressão infecção associada Leishmania sp x HIV para a doença na LT; "Determinar os títulos de anticorpos anti-Leishmania (como íindice de exposição ao parasita) e dos níveis de marcadores solúveis de resposta imunocelular da população; "Avaliar as características epidemiológicas, sócio-demográficas e clínicas da co-infecção Leishmania sp e o vírus da imunodeficiencia humana (HIV) em indivíduos residentes nas áreas de Florestal e Bom Jesus; "Determinar a prevalência e o perfil epidemiológico da co-infecção(Leishmania sp e HIV) na população residente nas áreas de estudo; "Contribuir com informações educativas sobre leishmaniose tegumentar, síndrome da imunodeficiência adquirida (AIDS) e a associação das duas doenças para a população da área a ser estudada.

Metodologia: Censo da população e das famílias, com mapeamento das casas existentes nas localidades. Levantamento de dados de identificação, demográficos, sócio-ambientais e epidemiológicos da habitação, do ambiente peridomiciliar e dos animais domésticos, utilizando o formulario já testado em 2000 com algumas reformulações. Cada indivíduo só deverá participar do estudo, após explicar a proposta de trabalho e o mesmo aceitar de livre e espontânea vontade - Período: Janeiro a Marco de 2006 Adotaremos algumas definições que serão consideradas importantes no desenvolvimento do cronograma de estudo: Definição de infecção por Leishmania sp: indivíduo residente nas áreas de estudo, sem história anterior ou atual de leishmaniose tegumentar, que apresentar positividade aos exames de IDRM/ e ou ELISA; Definição de infecção pelo vírus HIV: indivíduo residente nas áreas de estudo, sem história anterior ou atual AIDS, que apresentar positividade aos exames (ELISA-anti-HIV e ou Western blot); Definição de co-infecção par Leishmania sp x HIV: indivíduo residente nas áreas de estudo, sem história anterior ou atual de LT ou AIDS, que apresentar positividade aos exames de IDRM/ e ou ELISA (Leishmania sp e HIV); Definição de doença: indivíduo residente nas áreas de estudo, com história de lesão de pele (impetigóide, liquenóide, ectimatóide, úlcera franca, forma verrucosa, esporotricotica, tuberosa, nodular entre outras) e intradermorreação positiva para Leishmania; Definição de exposto: indivíduo que desenvolver anticorpos anti-saliva do vetor (Lutzomyia sp) pelo método ELISA e ou Western blot (BARRAL, et aI., 2000; GOMES, et aI., 2002); aquele que apresentar polimorfismo dos genes ligados a apoptose (Fas) e receptores Fc e aquele que apresentar marcadores séricos de imunidade celular positivos (neopterina, sICAM, sCD4, sCD8, sIL-2R, sCD4L e sRNF-RII);Definição de não exposto: indivíduo que não desenvolver anticorpos anti-saliva do vetor (Lutzomyia sp) pelo método ELISA e ou Westerns blot (BARRAL, et aI., 2000; GOMES, et aI., 2002), aquele que não apresentar polimorfismo dos genes ligados a apoptose (Fas) e receptores Fc e aquele que não apresentar marcadores séricos de imunidade celular positivos (neopterina, sICAM, sCD4, sCD8, sIL-2R, sCD4L e sRNF-RII). Procedimentos para identificação da Infecção por Leishmania sp x HIV: inquérito imunoalérgico - Dois procedimentos imunológicos serão utilizados para fins de diagnóstico da infecção por Leishmania sp. Intradermorreacao de Montenegro (IDRM) e teste sorológico (ELISA), os mesmos serão realizados obedecendo cronograma proposto para o estudo. A população que será avaliada constará de todos os indivíduos a partir da idade de 1 ano de vida, após preenchimento de termo de consentimento informado. Avaliação in vivo da imunidade celular - IDRM para sua realização, será utilizado antígeno fornecido pelo laboratório de imunoparasitologia (LIP) do CPQGM-FIOCRUZ-Bahia. O antigeno será produzido a partir de formas promastigotas de 1. l. amazonensis, em uma concentração de 250/lg/ml de antígeno, equivalente a 5xl06 promastigotas/ml, segundo técnica descrita por REED, et al., 1986. Será inoculado 0,1 ml do preparado antigênico na face anterior do antebraço esquerdo, de indivíduos a partir de um mês de vida, sendo a leitura realizada 48 a 72 horas após a realização do teste, utilizando régua milimetrada; marcando-se a borda da induração com caneta esferográfica de acordo com o que preconiza a O.M.S (SOKAL et al., 1975; WHO, 1990). A interpretação será baseada na área de induração apresentada, sendo adotados os seguintes valores de referencia: <5mm = negativo, >5mm + positivo (MARZO CHI et al., 1980) - Período de realização - Marco /Maio 2006. Avaliação da Imunidade humoral (ELISA - Leishmania sp e virus HIV) Colheita da amostra sanguinea venosa: Quando da realização do inquérito imunoalérgico, de 3 a 15ml (dependente da idade) de sangue venoso será colhido de uma das veias do antebraço, usando técnica padrão (tubos do tipo vacutainer sem heparina). o plasma será separado no laboratório do CERDEPS/PIEJ-SESAB em três alíquotas, de 200µ a 1,5ml., todas as aliquotas serão identificadas e conservadas a -20°C até o momento da realização do exame sorológico. Para o transporte do material, será utilizado isopôr com placas de gelo, hermeticamente fechado até a chegada no laboratório de Imunoparasitologia do CPQGM-FIOCRUZ, Bahia, onde serão novamente colocados em freezer a -20°C até a realização do exame. Enzime Linked immunosorbant Assay (ELISA): após coletados o sangue em tubos tipo "vacutainer" sem heparina, deixando-se coagular a temperatura ambiente. Realizar-se-a em seguida centrifugação da amostra e separação do soro com pipetas do tipo "Pasteur" de forma asséptica, sendo a amostra colocada em tubo NUNC estéreis, identificados e datados. Posteriormente, estes soros serão mantidos a uma temperatura de 4°C em refrigerador, para serem acondicionados em caixas térmicas e transportados para o laboratório do CPqGM-FIOCRUZ, onde serão submetidos à técnica de ELISA. Preparação do antigeno - Cepa de L. L. amazanensis e au braziliens is será cultivada em meio LIT (infusão de fígado e triptose) com 10% de soro bovino fetal. Parasitas recuperados na fase logarítmica, após três lavagens com tampão fósfato (PBS) pH 7,0 a 4°C por 10 minutos, serão ajustados a uma concentração de 5x 109 parasitas/ml para preparação de antígeno. Parasitas serão lisados em água destilada estéril por 10 cic10s de congelamento (nitrogênio líquido) e descongelamento rápido. O Material será então centrifugado à 16.000xg em centrífuga (Eppendorf 5402) por 20 minutos a 4°C). O sobrenadante (solução antigênica) será estocado em pequenas alíquotas, e a sua concentração proteíca verificada através do método de LOWRY et al., 1951.Diluição do soro - Em placas de microtitulação com fundo redondo serão preparadas as diluições do soro, adicionando-se 10µ de PBS pH 7,4 contendo 0,005% Tween 20 (PBS/Tween). Em seguida será transferido 20µ desta diluição de soro para a placa sensibilizada com o antígeno, a qual já contém 80µ, ficando uma diluição final de 1:100. Reação - Placas de microtitulação (NUNC-Intermed, Denmark) serão sensibilizadas com antigeno de L. amazanensis, na concentração de lOllg/ml (0,lm1lpoyo) em tampão carbonato-bicarbonato, pH 9,6 incubadas durante à noite a 4°C. Antes do início da reação, as placas serão lavadas 3 x com PBS Tween e incubadas com soros diluidos a 1: 1 00 por 1 hora à temperatura ambiente. Após lavagem com PBS/Tween como descrito acima será adicionado o conjugado anti-IgG humano (cadeia gama específico) ligado a fosfatase alcalina (Sigma Chemical Company). A titulação do conjugado utilizado neste estudo será considerada ótima para uso a partir da diluição em placa de 1: 1000 a 37°C. Novamente após esta incubação, as placas serão lavadas e adicionado 100µ/ poço de substrato. O substrato utilizado será o p-nitrofenilfosfato disódico (Sigma), diluído em tampão carbonato-bicarbonato pH 9.6, com 1 ml de MgC12 na concentração de 1mg/ml. Após 20 minutos à temperatura ambiente, estando os controles positivos com uma coloração esverdeada, a reação será interrompida com adição de NaOH a 3 M. A leitura será realizada em um espectrofotômetro multi canal para leitura de placas de microtitulação com filtro 405nm (Titesk-multiskan Spectrophotometer Flow-Laboratories Ayereshire Scotland). o resultado será expresso em absorbâncias e a reação será considerada positiva quando o valor de absorbância (cut off) for igual ou maior a 0.020, e como reação negativa quando o valor for menor ou igual a 0.019. A pesquisa de anticorpos anti-Leishmania será realizada, de forma cega, em duplicata pelo exame de ELISA conforme descrito (SCHIEFER, et al., 1995). Para manter o "cegamento" do estudo para cada amostra sérica de caso suspeito de LT de 3 a 5 amostras de indivíduos aparentemente sadios serão incluídas no lote para o exame sorológico. Para a realização da ELISA (anti-HIV) usaremos o kit Enzygnost HIV Integral da companhia DADE Behring, um ensaio imunoenzimático que permite a detecção qualitativa de antígeno HIV p24, de anticorpos contra os vírus HIV 1 e HIV 2 e de anticorpos contra o virus HIV 1 subtipo o no plasma o soro, seguindo as instruções do fabricante. As amostras positivas serão retestadas por ELISA e reconfirmadas por Western Blot. Para realizar o Western Blot utilizaremos o kit do mesmo fabricante - Periodo de realização - Marco IMaio 2006 Avaliação ex vivo da imunidade celular: quando da realização das colheitas de sangue para o exame ELISA, parte deste material será utilizado na avaliação ex vivo da imunidade celular (laboratório de imunoparasitologia do CPQGM/FIOCRUZ). Nós propomos a avaliar a imunidade celular ex vivo, através da avaliação de marcadores séricos, os quais, apresentam ampla vantagem de uso devido: 1) é capaz de avaliar o resultado da ação da resposta imune mesmo em compartimentos inacessíveis para obtenção de células para análise. Assim, não é necessário obter células da medula óssea, baço ou figado para realizar uma avaliação da resposta anti-Leishmania sp que aí se processa; 2) o método e de maior aceitação pelos pacientes, visto que exige volume de sangue reduzido, é de maior aceitabilidade etica, pois o volume necessário sendo reduzido não compromete indivíduos mesmo considerados anêmicos; 3)é possível de ser realizado em um maior número de indivíduos, tanto pela facilidade de realização quanta por seu custo. Realizaremos a dosagem de neopterina, sICAM, sCD4, sCD8, sIL-2R, sCD40L e sRNF-RII, obedecendo os critérios adotados por Schriefer et al., 1995 (SCHRIEFER, et al., 1995). Os niveis de sICAM, sCD4, sCD8, sIL-2R, sCD40L e sRNF-RII serão determinados em amostras de soros dos pacientes pela técnica ELISA (R&D systems), e os níveis de neopterina (NEOPTERIN ELISA) - Período de realização: Junho I Julho 2006 Estudo genético - Da mesma amostra sanguinea, após a centrifugação, será extraído o "creme leucocitario" sendo conservado em botijão de nitrogênio líquido até o momento do uso desse material, onde será extraído o DNA para análise genética. Todo o experimento será realizado no laboratório de imunoparasitologia do CPQGM/FIOCRUZ. Separação das células mononucleares do sangue periférico (PBMC): as células mononucleares do sangue periférico (PBMC) serão isoladas a partir do volume de 15mL de sangue heparinizado (10UI/mL), diluído 1: 1 com solução salina a 0,9%, adicionando-se em seguida o Ficoll-Hipaque na proporção de 2: 1. Os tubos serão centrifugados (400xg por 40 minutos) e o anel de células mononucleares será coletado. As células serão lavadas 2 vezes com solução salina a 0,9% a 1000rpm por 10 minutos e contadas, na última lavagem, em câmara de Newbauer. Após a contagem, as células serão acondicionadas a -20°C para posterior extração do DNA. Todos os experimentos serão realizados no laboratório de imunoparasitologia do CPQGM/FIOCRUZ. Extração do DNA: o DNA genômico das células mononucleares obtidas a partir do gradiente de FICOLLHypaque será extraído usando protocolo de tratamento com proteinase K e extração com FenolClorofórmio-Alcool Isoamilico. o "pellet" de células será res suspenso em uma solução de Tris - EDT A NaCI (10 mM- 10 mM- 0,15 mM), SDS 20% e proteinase K (10mg/mL). Essa solução será incubada a 65°C por 2 horas, adicionando-se em seguida uma outra solução de Tris - EDTA - NaCI (10 mM- 10 mM- 0,65 mM) e fenol-clorof6rmio-alcool isoamílico. Essa solução será então centrifugada para separação da fase aquosa e precipitação do DNA com Etanol Absoluto. As amostras de DNA serão quantificadas em gel de agarose e acondicionadas a - 20°C para posterior utilizayiio. Genotipagem por PCR para os genes Apo-l/Fas e Receptores Fey: As reações de PCR (Reação em Cadeia da Polimerase) serão realizadas para amplificação dos polimorfismos da região promotora do gene APO-l/Fas (CD95) e dos Receptores Fey como previamente descrito por HUANG et al., (1997) e Van de Winkel (1991). Cada reayção será composta de aproximadamente 60 ng de DNA, 0,5 U de Taq polimerase, 0,25 flM de cada primer, 200 flM de dNTPs, 1.0 mM de MgClz em tampão Tris-HCI 10 mM I KClz 50 mM (pH 8.5) num volume final de 20 flL. As reações serão amplificadas em termociclador Perkin Elmer com as seguintes condições de temperatura: 94°C por 5 minutos para desnaturação do DNA, 55°C por 1 minuto, para pareamento dos primers e noc por 1 minuto e 30 segundos para extensão do primer pela Taq DNA Polimerase por 35 ciclos. Os produtos das amplificações serão separados e visualizados por eletroforese em gel de agarose em tampão de TBE IX após coloração com Brometo de Etídio em luz UV.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: ESTUDOS E PESQUISAS

Produção Científica


Projeto: ESTUDO CLÍNICO-EPIDEMIOLÓGICO DA CO-INFECÇÃO HIV/TUBERCULOSE EM RECIFE.
Coordenador: MARIA DE FÁTIMA PESSOA MILITÃO DE ALBUQUERQUE
Resumo: A tuberculose alcançou o século XXI como um dos maiores desafios à saúde pública mundial, particularmente em regiões com alta prevalência da infecção pelo HIV (KAMRAN et aI., 2003), a qual, além de representar o maior fator de risco para o adoecimento por tuberculose entre indivíduos previamente infectados pelo Mycobacterium tuberculosis, torna o seu diagnostico mais difícil (SHIMAO, 1995; NARAIN et al., 1992). Segundo a Organiza9ao Mundial de Saúde existem cerca de trinta e oito milhões de pessoas vivendo com HIV e aids no mundo, das quais, 30% a 35% estão co-infectadas com o bacilo da tuberculose. Atualmente, estima-se que 12% dos pacientes com tuberculose são HIV positivos e 22,5% das mortes por tuberculose em todo mundo são atribuídas a co-infecção Em algumas regiões, como a África, estas taxas estão dramaticamente mais altas. Dos dois milh5es de casos de tuberculose na África em 1999, alguns pesquisadores estimam que dois terços sejam HIV positivos, sendo previsto um aumento de 10% ao ano no número de casos de tuberculose em decorn3ncia da infecção pelo HIV, atingindo 3.3 milhões no ano 2005 e ultrapassando quatro milh6es em um curto intervalo de tempo (UNAIDS, 2004) O Brasil ocupa o 15° lugar entre os 22 paises que concentram 80% do total de casos de tuberculose no mundo e estima-se em mais de 50 milhões o número de brasileiros infectados pelo bacilo da tuberculose, com 111.000 casos novos e 6.000 óbitos ocorrendo anualmente. Em 2002 foram notificados 81.436 casos novos e 5.159 óbitos, o que corresponde a um coeficiente de incidência de 46 / 100.000 hab. e um coeficiente de mortalidade de 2,95/100.000 hab., respectivamente (MINISTÉRIO DA SAÚDE, 2002). Segundo dados do Sistema de Informações e Agravos de Notificação (SINAN) da Secretaria de Saúde do Município do Recife, capital de Pernambuco, registrou-se em 2001, uma taxa de incidência de tuberculose superior a 100 casos por 100.000 habitantes (Dados da Coordenação de Tuberculose do Recife). Vários fatores têm contribuído para esta situação epidemiológica, além da infecção pelo HIV: o progressivo empobrecimento das populações; a dos sistemas de saúde que, em vários locais, se mostram insuficientes para captar e tratar os doentes com tuberculose, gerando problemas como abandono de tratamento, o qual tem intima implicação nos crescentes números de resistência do Mycobacterium tuberculosis aos medicamentos (HIJJAR et al., 2001; MINISTERIO DA SAÚDE, 2002; OLIVEIRA et aI., 2002). Esta situação epidemiológica da endemia, no Brasil, se expressa também na dificuldade que o Programa Nacional de Controle da tuberculose encontra para atingir as metas internacionais estabelecidas pela OMS e pactuadas pelo governo brasileiro, de curar 85% dos casos estimados (RELATORIO DO PNCT, 2002). No Brasil, Kritski & Ruffino-Netto (2000), estimaram que 150.000 brasileiros estivessem co-infectados pelo HIV/tuberculose correspondendo a um taxa de co-infecção em tome de 3% a 4%. No Estado de Pernambuco, segundo dados da Coordenação Estadual de DST/aids, a pravalência da co-infecção tuberculose/HlV, situou-se em torno de 7% em 2002, e até abril de 2005 haviam sido notificados 8.447 casos de aids. Em Recife, um inquérito epidemiológico conduzido pela equipe proponente, tendo como população alvo 1.500 pacientes que iniciaram tratamento para tuberculose nos serviços de saúde do Município encontrou que a prevalência de infecção pelo HIV entre os mesmos foi de 8%, no entanto, observou-se que um percentual importante de pacientes não realizou a sorologia para HIV apesar de esta ter sido indicada (dados não publicados). Paralelamente ao aumento da prevalência de infecção pelo HIV tem-se observado o aumento nas taxas de mortalidade por tuberculose, o que dá suporte a hipótese de que a infecção pelo HIV vem marcadamente associada a um aumento da mortalidade entre os co-infectados. Desse modo, torna-se importante conhecer a magnitude do problema tuberculose/HIV, na população de estudo, e identificar os principais fatores associados ao sucesso da profilaxia e do tratamento para tuberculose entre os co-infectados. Entende-se, que os fatores identificados são componentes do impacto negativo causado pela co-infecção na evolução destes pacientes. Conhecê-Ios é fundamental para a formulação de estratégias visando à minimização dos seus efeitos. A presente proposta compõe um projeto interinstitucional que congrega docentes, pesquisadores e médicos das Universidades Federal e Estadual de Pernambuco e das Secretarias Estadual e Municipal de Saúde visando estudar vários aspectos da infecção pelo HIV. Os projetos abordam co-infecções e complicações da terapia anti-retroviral e serão desenvolvidos de forma integrada com a finalidade de responder a diferentes objetivos propostos tendo como base a mesma população-alvo. A população-alvo deste estudo será constituída por dois grupos: Pacientes co-infetados com tuberculose/HIV atendidos nos três principais serviços de referência para HIV/aids na cidade do Recife: Hospital Universitário Oswaldo Cruz da Universidade de Pernambuco, Hospital das Clínicas da Universidade Federal de Pernambuco e Hospital Correia Picanço da Secretaria Estadual de Saúde que juntos são responsáveis por 90% do atendimento à pacientes com HIV/aids no Estado de Pernambuco. Pacientes co-infetados com tuberculose/HIV atendidos nos serviços de saúde que compõem a rede de assistência à tuberculose no Município do Recife, incluindo as unidades do Programa de Saúde da Família. Os pacientes em atendimento nos serviços de referencia para HIV/aids constituirão a população de estudo dos diferentes subprojetos em HIV/aids, possibilitando uma avaliação mais global dos mesmos, o que potencializa os benefícios em nível individual, além de otimizar os recursos para pesquisa.

Objetivo: OBJETIVO GERAL: Conhecer a prevalência da infecção por HIV em portadores de tuberculose e a prevalência da tuberculose em portadores do HIV, sua evolução clínica e os fatores preditores do sucesso das profilaxias e tratamentos em ambas as condições, em pacientes atendidos nos serviços de referência para tratamento de tuberculose e aids na cidade do Recife. OBJETIVOS ESPECÍFICOS: - Estimar a prevalência de infecção pelo HIV, em pacientes residentes em Recife, que iniciarem tratamento para tuberculose nos serviços de saúde que compõem a rede de assistência a tuberculose no município, incluindo as unidades do Programa de Saúde da Família, durante um período definido de três meses; - Estimar a prevalência de tuberculose em pacientes com HIV/aids residentes em Recife e nos demais municípios de Pernambuco, atendidos nos três principais centros de referencia para aids nesse estado, durante um período definido de um ano; - Identificar os fatores preditivos para o sucesso da quimioprofilaxia para tuberculose em indivíduos com infecção pelo HIV/aids: fatores biológicos, fatores sócio-demográficos, hábitos/estilo de vida, clínicos, diagnóstico/ laboratoriais: a. Biológicos: sexo e idade; b. Sócio-demográficos: Distrito Sanitário/Bairro/Município de residência, escolaridade, renda do chefe da família; c. Hábitos/estilo de vida: Tabagismo, etilismo e uso de drogas ilícitas; d. Clínicos: tempo decorrido desde a detecção da infecção pelo HIV até o início da quimioprofilaxia para tuberculose; reatividade ao teste tuberculinico, presença de lesões cicatriciais atribuídas a tuberculose ao exame radiológico do tórax, presença de outras infecções oportunistas; utilização de tratamento anti-retroviral; tipo de esquema anti-retroviral; tempo de tratamento anti-retroviral; e. Diagnósticos/laboratoriais: contagem de linfócitos CD4/CD8, quantificação de carga viral. - Identificar os fatores preditivos para o sucesso do tratamento para tuberculose em indivíduos com infecção pelo HIV/aids: fatores sócio-demográficos, hábitos/estilo de vida, fatores biológicos, clínicos, diagnóstico/ laboratoriais e de acompanhamento nos serviços de saúde: a. Biológicos: sexo e idade; b. Sócio-demográficos: Distrito Sanitário/Bairro/Município de residência, escolaridade, renda do chefe da família; c. Hábitos/estilo de vida: Tabagismo, etilismo e uso de drogas ilícitas; d. Clínicos: Em relacão à tuberculose: Serviço onde o tratamento para tuberculose foi iniciado (Rede de tuberculose ou no Serviço de referencia para HIV/aids); uso prévio de quimioprofilaxia para TB; tempo decorrido entre o início dos sintomas de tuberculose e o primeiro atendimento no serviço de saúde; tempo decorrido entre o primeiro atendimento no serviço de saúde e a instituição do tratamento para tuberculose; forma clínica da tuberculose, história de tratamento prévio, tipo de esquema terapêutico, reações adversas ao tratamento e resistência as drogas. Em relacão ao HIV/aids: tempo decorrido entre o diagnóstico da infecção pelo HIV e início do tratamento da tuberculose, tempo decorrido entre o diagnóstico de aids e início do tratamento da tuberculose, utilização de tratamento anti-retroviral, tempo de tratamento anti-retroviral, tipo de esquema anti-retroviral, número de esquemas anti-retroviralis, presença de outras infecções oportunistas e/ou doenças associadas; e. Diagnósticos/laboratoriais: Em relacão à tuberculose: positividade da baciloscopia, positividade da cultura, positividade do teste tuberculinico, positividade da Reação em Cadeia de Polimerase (PCR), presença de cepas resistentes as drogas anti-tuberculose; extensão da lesão pulmonar a radiologia de tórax. Em relacão ao HIV/aids: contagem de linfócitos CD4/CD8, quantificayao de carga viral para HIV; f. Acompanhamento dos serviços de saúde: o tratamento da tuberculose ser acompanhado pdo PSF.

Metodologia: A descrição da metodologia compreenderá duas partes: uma parte que é comum a todos os projetos em HIV/aids, resultado da interseção dos mesmos, e outra parte que e específica, atendendo à diversidade dos problemas abordados. Apresentam-se, abaixo, a metodologia comum e aquela relativa ao estudo da co-infecção TB/HIV/aids. Para estimar, em Recife, a prevalência de tuberculose em pacientes com HIV/aids, e a prevalência da infecção pelo HIV em pacientes com tuberculose, será realizado um corte transversal, nos serviços de referência para HIV/aids e nas unidades de atendimento à tuberculose e Programas de Saude da Família (PSF), respectivamente. Será estudada a prevalência de período, compreendendo um período de três meses para a prevalência de HIV/aids no grupo de pacientes com tuberculose, e de um ano para o outro grupo. A opção por um período menor para os pacientes com tuberculose deve-se à possibilidade de inferir essa estimativa para o conjunto de pacientes e, pelo trabalho intensivo, que e factível de ser desenvolvido em tempo mais curto em uma quantidade grande de unidades de atendimentos para tuberculose e PSF, à possibilidade de reduzir o viés de seleção devido à recusa ou perda. O número de indivíduos que inicia o tratamento para tuberculose em um período de três meses atinge o tamanho da amostra requerido para esse objetivo. Para identificação dos fatores preditores do desfecho da profilaxia para tuberculose será acompanhada uma coorte dos pacientes que iniciarem a profilaxia nos 12 meses subseqüentes ao início do trabalho. Como o tempo de acompanhamento será variável para os diferentes indivíduos, na análise se trabalhara com pessoa-tempo e taxa de incidência. Para atender as especificações do edital o maior período de acompanhamento será de um ano e seis meses; no entanto o projeto será submetido a outras fontes de financiamento para pesquisa, objetivando a obtenção de recursos adicionais para dilatação desse prazo. No que concerne aos fatores preditores do desfecho do tratamento da tuberculose em pacientes com HIV/aids, será acompanhada uma coorte de pacientes por um período de seis meses (duração do tratamento) quando considerados os desfechos abandono e falência, e por um período de até 18 meses quando tratar-se de óbito. Nessa última situação será utilizada, como medida de freqüência, a incidência densidade e, nas demais, incidência cumulativa. Trata-se de uma coorte bidirecional, com um componente prospectivo, onde serão selecionados todos os pacientes co-infectados que iniciarem o tratamento para tuberculose nos 12 meses subseqüentes ao início da pesquisa, e um componente retrospectivo, com a inclusão dos pacientes que iniciaram o tratamento nos quatro meses que antecederam o início da pesquisa. Os dois coortes, o de pacientes em profilaxia e o de pacientes em tratamento, possuem grupos de comparação internos, sendo possível estudar, simultaneamente, várias "exposições" e avaliar os "efeitos" a elas relacionados, bem como se obter informações sobre os potenciais fatores de confusão. Seleção, definição e categorização das variáveis: Os fatores de risco que estão sendo estudados foram selecionados a partir de ampla revisão de literatura, existindo, portanto um potencial de associação com os "efeitos" em questão. A definição de termos será limitada aquelas variáveis para as quais autores diferem quanto a sua conceituação operacional. Relativas à tuberculose: O conceito de caso de tuberculose, caso novo, sem tratamento, retratamento, falência e alta será aquele proposto pelo Manual de Normas para o Controle da tuberculose. Denomina-se caso de tuberculose todo indivíduo que tem esse diagnóstico confirmado por baciloscopia ou cultura e aquele em que o médico, com base em dados clínico-epidemiológicos e no resultado de exames complementares, firma o diagnóstico de tuberculose. Caso novo e o doente com tuberculose que nunca usou ou usou, por menos de um mês, drogas antituberculose. Considera-se sem tratamento os pacientes que nunca se submeteram a quimioterapia antituberculose ou o fizeram por menos de 30 dias. Define-se como retratamento o tratamento prescrito para o doente já tratado por 30 dias ou mais, que venha a necessitar de novo tratamento por falência, recidiva ou retorno após abandono. Entende-se por falência a persistência da positividade do escarro ao final do tratamento. Os doentes que, no início do tratamento, são fortemente positivos (++ ou +++) e mantém essa situação até o quarto mês, ou com positividade inicial seguida de negativação e nova positividade por 2 meses consecutivos, a partir do quarto mês de tratamento, são também classificados como casos de falência. O aparecimento de poucos bacilos (+) diretos no escarro, na altura do quinto ou sexto mês, isoladamente, não significa, necessariamente, falência de esquema e o paciente será acompanhado com exames bacteriológicos para melhor definição. Será considerada alta por cura comprovada quando, ao completar o tratamento, o paciente apresentar duas baciloscopias negativas e alta por cura não comprovada quando, ao completar o tratamento, o paciente não tiver realizado as baciloscopias para encerramento do caso. Para os pulmonares inicialmente negativos a alta por cura será definida com base em critérios clínicos e radiológicos, ao final do tratamento. Será conceituada alta por abandono de tratamento quando o doente deixar de comparecer a unidade, por mais de 30 dias consecutivos, após a data aprazada para o seu retorno. Será considerado desfecho desfavorável quando ocorrer abandono, falência ou morte. A análise será realizada de duas formas; primeiro considerando cada um desses três desfechos em separado e, posteriormente, agrupados. A análise com os três desfechos agrupados justifica-se por terem em comum o fato de serem danosos em nível individual, relacionando-se a uma maior gravidade da doença, e em nível do coletivo, geralmente associando-se a um maior período de transmissibilidade. Implicará, também, em um maior "power" do estudo. Reator a prova tuberculinica será aquele individuo que apresentar induração maior ou igual a 5mm e não reator aquele com induração de 0 a 4mm. Os achados radiológicos serão classificados sob 4 ângulos, de acordo com a proposta de Keane et al. (1997): a) Lesões "bilaterais" ou "unilaterais", entendendo-se por "bilaterais' quando as lesões estiverem presentes em ambos os hemitoraxes e "unilaterais" quando estiverem presentes em apenas um. b) "Grandes" ou "pequenas": grandes, quando a sua superfície, examinada em um negatoscópio for igual ou superior a 60cm2 e pequena, quando menor do que 60cm2. c) Presença ou ausência de cavitações. d) Presença ou ausência de desvio do mediastino. b) Relativas ao HIV/aids: Serão considerados soropositivos para o HIV aqueles indivíduos que apresentarem sorologia positiva quando utilizadas as técnicas de ELISA, imunofluorescência, Western-blot ou teste rápido, conforme fluxograma definido pelo Ministério da Saúde. Esses soropositivos serão classificados em subcategorias de acordo com a situação clínica, virológica e imunológica. c) Relativas às condições socioeconômicas: Renda, ocupação e escolaridade serão analisadas de acordo com as características do chefe da família por entender-se que as mesmas determinam a inserção social de todo o núcleo familiar. Quanto à escolaridade, será também considerada em nível do individuo, uma vez que poderá condicionar diferentes comportamentos com relação à adesão ao tratamento. A variável renda será categorizada de acordo com o número de salários mínimos; ocupação de acordo com o grau de especialização requerido para exercê-Ia e escolaridade tomando-se em consideração o número de anos de estudo e o grau concluído. O termo suporte social tem aqui um significado bastante limitado, sendo considerado com suporte social aqueles indivíduos que estão inseridos dentro de um núcleo familiar; sendo assim, os solteiros que vivem sozinhos, os viúvos, e os menores que não habitam com os pais, serão classificados como sem suporte social. Serão considerados alcoólatras ou usuários de drogas os indivíduos que referirem uso rotineiro dos mesmos, sendo possível caracterizar uma situação de dependência. Tamanho a amostra: Para estimativa do tamanho da amostra para determinada de soropositividade para o HIV em pacientes com tuberculose, tomou-se como base dados de estudo anterior da equipe proponente desse projeto, quando se observou uma prevalência de 8%. Para um nível de confiabilidade de 95%,e com um erro máximo tolerável de 3%, o tamanho a amostra seria de 314. De forma semelhante, para cálculo do tamanho da amostra para a prevalência de tuberculose em indivíduos soropositivos para HIV, assumiu-se uma prevalência esperada de 7% (de acordo com os dados da Secretaria Estadual de Saúde) e valores semelhantes dos demais parâmetros, obtendo-se um tamanho de amostra de 278 indivíduos soropositivos. O tamanho da amostra calculado para o estudo de coorte foi baseado em um: erro alfa de 5%, poder de amostra de 80% (erro beta = 20%) e na freqüência dos desfechos entre expostos e não-expostos, obtida em um estudo conduzido pela equipe proponente desse projeto (artigo em fase de elaboração), em pacientes em tratamento para tuberculose. Para as variáveis tratamento prévio para tuberculose e esquema terapêutico utilizado a freqüência do desfecho desfavorável entre os não expostos foi de, respectivamente, 18,8% e 19,8%, com valores do risco de 2,26 e 2,13 o que corresponde a um tamanho total de amostra de 274 para a primeira variável e de 312 indivíduos para a segunda. Considerou se uma razão de exposto para não exposto e 1; 1. Para as variáveis analfabetismo e consumo de álcool a freqüência de desfecho desfavorável entre os não expostos foi de 20,2 e 19,3, respectivamente, com valores de risco de 1,71 e 1,79, definindo um tamanho total e amostra de 628 e 652.

Concorrência: Chamada de Pesquisa 2005 - 322/2005

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: Experiências de formação e treinamento em pesquisas em AIDS.
Coordenador: CASSIA MARIA BUCHALLA
Resumo: O NEPAIDS, Grupo de Estudos para a Prevenção da AIDS da Universidade de São Paulo, tem desenvolvido várias iniciativas na formação de pesquisadores fomentando a qualidade ética e o rigor acadêmico de suas pesquisas. Estas atividades têm sido realizadas com o compromisso ético-político de contribuir para políticas públicas baseadas no referencial dos direitos humanos. Desde 1996, desenvolvemos cursos de metodologia de pesquisa em AIDS para profissionais de saúde e ativistas de organizações não-governamentais (Paiva et al. 2002a e 2002b) com pequena ou nenhuma experiência em pesquisa. Nesta modalidade, o processo de trabalho desenrola-se entre 3 a 4 anos. Nesse período de quase uma década realizamos 4 cursos com financiamento do Ministério da Saúde, da World AIDS Foundation e da Fogarty Foundation. Em 2004, convidados pelo Ministério da Saúde e pelo Professor Norman Hearst (University of Califórnia San Francisco - Family & Community Medicine Department), juntamo-nos a vários pesquisadores da Escola Nacional de Saúde Pública, Universidade de Brasília, e da Universidade da Califórnia, além de outras unidades da USP com o objetivo de realizar os "Seminários sobre como Escrever Artigos Científicos para Revistas de Impacto". Os participantes são pesquisadores que, financiados pelos programas nacionais e estaduais de AIDS, e de posse de dados já coletados, ainda não tinham tido a oportunidade de tornar público os resultados de suas pesquisas. As duas situações, tanto os cursos como os seminários de redação, resultam em artigos para publicação em periódicos indexados e de ampla circulação internacional. Diferem apenas em relação à trajetória anterior dos treinandos assim como a formação em pesquisa dos participantes. O Suplemento da Revista de Saúde Pública destina-se a tornar público a diversificada produção científica de vários pesquisadores que têm a AIDS como objeto de estudo e que participaram destas experiências de formação. Todos os artigos serão submetidos ao corpo editorial da Revista de Saúde Pública, no processo fundamental de revisão de pares. Esperamos que, se não todos, a maioria dos 18 artigos seja aprovada para integrar o Suplemento. Os recursos solicitados destinam-se, exclusivamente, a contribuir para o pagamento de 1.400 exemplares de um Suplemento da Revista de Saúde Pública (http://www.scielo.br/revistas/rsp/iaboutj.htm), periódico baseado na revisão de pares e classificado, pela CAPES-MEC, como publicação de qualidade internacional A. É importante informar que a Revista de Saúde Pública está disponível, gratuitamente, na web e em versão bilíngüe. Os recursos servirão para pagar os custos de revisão dos textos, tradução de português para o inglês, editoração (incluída a preparação de arquivos pdf and html), preparação online, impressão e distribuição por correio convencional para bibliotecas de saúde pública. Há menção de contratação de um consultor. Este refere-se a pessoa para coordenar o recebimento, distribuição dos artigos para os autores, recolhimento dos mesmos em tempo, envio a revista, controle das etapas de tradução e re-organização, controle de correspondência entre os autores e revisores, comunicação entre revista e autores, entre outras atividades.

Objetivo: Tornar público os resultados de pesquisas brasileiras, via publicação em periódico brasileiro bilingüe, de acesso gratuito, online, classificado pela CAPES como Qualis A-Internacional, como mais uma expressão do vigor da resposta brasileira à epidemia de AIDS.

Metodologia: Os artigos preparados quer durante o curso quer nos Seminários do Programa Nacional serão revistos em um Seminários de três dias , com o apoio da equipe dos professores que tiveram o papel de monitores, tanto no curso quanto nos Seminários. Serão revistos e preparados para submissão os seguintes artigos: 1. Mulheres vivendo com HIV/Aids parceiras de usuários de drogas injetáveis: percepção de risco, uso de drogas e estratégias de prevenção [Women sexual partners of injection drug-using men: risk perception, drug use and preventive strategies for HIV/STD] AF d' Oliveira, MT Couto, MA Cardoso 2. O tratamento do HIV entre usuários de drogas injetáveis ( UDI ) em dois serviços de saúde: o que facilita ou dificulta? [HIV treatment among injecting drug users( IDU) as verified in two public health services: facilitating factors and barriers to adherence] YMR Mendonça; RC Freitas; E Kohatsu; CGM Silva; V Paiva 3. Processos de estigmatização e discriminação no ambiente de trabalho vividos por homens com HIV/AIDS que fazem sexo com mulheres [Men living with HIV/AIDS who keep sexual relations with women: stigmatization and discrimination at workplace]. PB Garrido, V Paiva, VLV Nascimento, JB Sousa, N Santos, G Gomes 4. Vulnerabilidade de Mulheres Usuárias de Drogas Injetáveis ao HIV [Vulnerability to HIV among women using injectable drugs] VN Silva, F Mesquita, R Bueno 5. Consumo e uso abusivo de álcool e drogas em comunidades anfitriãs do ecoturismo da região do Vale do Ribeira, Brasil [Consumption and abusive alcohol and drug use in host communities in the ecotourism region of Vale do Ribeira, Brazil] AO Santos, V Paiva 6. Qualidade de vida de pessoas vivendo com HIV/Aids [Quality of life of people living with HIV/AIDS] ECM Santos, I França-Junior, F Lopes 7. Adesão à terapia anti-retroviral (ARV) dos usuários de drogas injetáveis (UDI): as percepções de equipes de farmácia [Adherence to antiretroviral treatment among intravenous drug users (IDU): the pharmacy teams perceptions] CM Yokaichiya, WS Figueiredo e LB Schraiber 8. Invisibilidade e silêncio: a questão do uso de drogas e os profissionais de saúde na atenção de pessoas vivendo com HIV/AIDS [Invisibility and silence: the question of the use of drugs and the health's professionals in care of people living with HIV/AIDS]. M Lima, JA Costa, WS Figueiredo e LB Schraiber 9. Soroprevalência para hepatite b e c e perfil dos usuários e ex-usuários de drogas injetáveis de três serviços de atendimento ao HIV/Aids na cidade de São Paulo, Brasil [Seroprevalence of hepatitis C, hepatitis B and profile among injectable drug users with HIV/AIDS of three public services in São Paulo city, Brazil] Â Marchesini, Z Prá-Baldi, F Mesquita, R Bueno 10. Infecção pelo HIV, hepatite b, hepatite c e sífilis, em moradores de rua da cidade de São Paulo [HIV, hepatitis B and C infection and syphilis in a homeless population in São Paulo - Brazil] V Brito; D Parra; R Facchini; CM Buchalla 11. Cenário sexual e prevenção ao HIV/Aids em uma favela do Rio de Janeiro [Vulnerability and HIV/Aids prevention in a Rio de Janeiro shantytown] K Edmundo, CM Souza, ML Carvalho, V Paiva 12. As dificuldades relacionadas à aderência à terapia anti-retroviral sob o ponto de vista das pessoas vivendo com HIV/Aids [Patient perspectives on challenges to ART adherence in Brazil] R Melchior, MIB Nemes, TMD Alencar, CM Buchalla 13- Implantação de ações de prevenção e assistência às DST/AIDS em serviços de atenção primária no Estado de São Paulo, Brasil. [Evaluation of implementation of interventions for the prevention and care of STD/Aids in primary healthcare facilities in São Paulo state, Brazil] EM Brito, IA Paula, MCS Monteiro, MPR Oliveira, PO Sousa, MIB Nemes 14- Práticas sexuais com homens e mulheres dos voluntários bissexuais acompanhados no projeto horizonte. Belo Horizonte - Brasil. [Risk-taking behavior of bisexual men differs in their homosexual and heterosexual relationships. Project Horizonte, Belo Horizonte, Brazil, 1994-2001] M Greco, AP Silva, E Merchán-Hamann, ML Jeronymo, JC Andrade, DB Greco 15- Identificando possíveis barreiras para testagem do HIV entre usuários de drogas injetáveis, utilizando a metodologia de testagem rápida [Perceptions of HIV rapid testing among injecting drug users in Brazil] PR Telles, S Westman, AE Fernandez, M Sanchez, Rapid test working group 16 - Taxas inesperadas de prevalência de marcadores sorológicos do VHB, VHC e VHD em pacientes com HIV/AIDS, em uma área hiperendêmica de infecção pelo VHB na Amazônia brasileira. [Unexpected low prevalence of HBV, HDV and HCV among HIV/Aids patients in the Brazilian amazon] WSM Braga, MC Castilho, ICV Santos, MAS Moura e AC Segurado 17- Comportamento sexual e soropositividade entre gestantes no pré-natal: utilizando um sistema de informação para a vigilância do HIV no Brasil [Sexual behavior and HIV-infection among pregnant women receiving prenatal care: an information system for HIV epidemiological surveillance in Brazil] AJC Cardoso, RH Griep, HB Carvalho, A Barros, SB Silva, RH Remien 18- Intervenções individuais, estruturais e programática voltadas ao controle de DST e AIDS: a experiência da região Amazônica, Brasil [Structural, programmatic and individual interventions aiming the control of STI/Aids: an experience at Amazon region, Brazil] AS Benzaken, EG Galbán, VL Pedrosa, JCG Sardinha, O Loblein, V Paiva. B- Após a submissão dos artigos, durante o processo de revisão dos pareceres enviados pelo editor, a equipe estará disponível para assessora cada grupo de autores de forma a concluir em tempo e da melhor forma, a versão final dos trabalhos. C- A equipe acompanhará também a fase de tradução e editoração dos textos, até sua publicação na rede internacional assim como em papel. Assim, este projeto deve arcar com os custos da tradução, editoração e divulgação, Como ocorre em todos os suplementos, o custo da distribuição para os assinantes é pago pelo grupo.

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: CAPACITAÇÃO E FORMAÇÃO EM PESQUISA

Produção Científica


Projeto: Proposta de Suplemento em Periódico Brasileiro sobre mudanças recentes no comportamento sexual e percepções sobre HIV/Aids - Brasil, 1998-2005.
Coordenador: ELZA BERQUO
Resumo: A presente proposta visa descrever e analisar os achados referentes à pesquisa "Comportamento Sexual e Percepções da População Brasileira sobre HIV/Aids-2005", comparando e contrastando os achados da referida pesquisa com os achados de pesquisa similar coordenada pelo CEBRAP/Ministério da Saúde, realizada em 1998. Ênfase será dada a eventuais mudanças no âmbito das representações, comportamento, atitudes e práticas sexuais da população brasileira, e conhecimento sobre HIV/Aids, ocorridas nos últimos anos, a contar de 1998. Propõe-se editar Suplemento inteiramente dedicado aos achados e respectivas análises supra-mencionados, a serem veiculados em periódico brasileiro, revisto por pares e indexado, bilíngüe, de acesso gratuito on-line, classificado pela CAPES como "Qualis A Internacional". Estas análises estarão a cargo principalmente dos pesquisadores que compuseram o Comitê Científico da pesquisa "Comportamento Sexual e Percepções da População Brasileira sobre HIV/Aids-2005". A comparação dos resultados obtidos em 2005 com aqueles registrados na 1a. edição da pesquisa, realizada em 1998, fornecerá subsídios à Coordenação para avaliar estratégias de intervenção e oferta de cuidado, suporte psicossocial e tratamento a pessoas sob o risco de se infectaram e vivendo com HIV/AIDS. Enquanto pesquisa de abrangência nacional e abordagem de grande escopo e diversidade (compreendendo diversos tópicos de interesse), tais dados e análise constituem elementos indispensáveis para balizar a discussão dos achados de estudos específicos e como linha de base para intervenções futuras. A epidemia de HIV/AIDS entra no século XXI e na sua terceira década como uma das mais complexas e desafiadoras pandemias já enfrentadas pela humanidade. O contexto brasileiro tem sido o de uma epidemia extremamente dinâmica, por conta da extensão e dos contrastes sociais e regionais do país, como também devido a uma resposta vigorosa do Estado e da sociedade brasileiras, que vêm determinando uma importante inflexão em um quadro que, a princípio, se mostrava especialmente preocupante. Não cabe aqui repisar o sucesso das ações implementadas pelo Brasil, ao longo dessas duas décadas de epidemia, mas cabe assinalar que a disseminação do HIV/AIDS constitui um desafio permanente e que em um quadro especialmente complexo e dinâmico como o do HIV/AIDS no Brasil e no mundo cabe monitorar tendências de forma acurada e contínua. A epidemia brasileira é, na verdade, um compósito de subepidemias regionais de caráter bastante distinta. Portanto, fazem-se necessários estudos de abrangência nacional, como os estudos enfeixados na presente proposta, não apenas como panorama de uma epidemia dinâmica e um país de contrastes, como também enquanto marco referencial para pesquisas locais, com populações específicas. O Brasil ocupa posição de destaque no âmbito internacional pelos esforços que vem realizando no combate à Aids em respeito aos direitos humanos, o que compreende um amplo e diversificado de intervenções preventiva e uma oferta de tratamento e cuidados para cerca de 180.000 pessoas vivendo com HIV/AIDS. Em que pese a existência de um volume considerável de estudos brasileiros focalizando aspectos específicos relacionados à prevenção do HIV/Aids, e suas interfaces com a sexualidade, até o momento não se dispõe de pesquisas de abrangência nacional que documentem mudanças no comportamento sexual da população brasileira. Não se dispõe, por outro lado, de análises de corte transversal, com abrangência nacional, de temas específicos que abordem sua relação com comportamentos associados à prevenção do HIV, como por exemplo, violência sexual. A Pesquisa "Comportamento Sexual e Percepções da População Brasileira sobre HIV/Aids", em suas edições 1998 e 2005 realizadas por iniciativa do Programa Nacional de DST/Aids, preenche essas lacunas quer pela possibilidade que oferece de comparações temporais quer pela introdução pela primeira vez de novos temas. Neste sentido, essa pesquisa teve como principal objetivo identificar conhecimentos, representações e práticas sexuais da população brasileira com o intuito de subsidiar a formulação de políticas públicas voltadas para a prevenção das DST/HIV/Aids. Além disso, o estudo proporcionou uma linha de base de informações sobre sexualidade e DST/HIV/Aids que se constituiu em parâmetro de referência para posteriores investigações e como traçador de tendências sobre esta área do conhecimento. Portanto, a produção de um suplemento em periódico brasileiro sobre as mudanças recentes no que se refere ao comportamento, práticas sexuais e percepções sobre HIV/Aids, possibilitará ampliar o diálogo entre instituições governamentais, não-governamentais e a comunidade acadêmica no que se refere às políticas voltadas para essa área.

Objetivo: 1. Difundir nacional e internacionalmente, via publicação em periódico brasileiro bilíngüe, análises sobre mudanças nos padrões de comportamento sexual e percepções sobre HIV/Aids da população brasileira, ocorridas entre 1998 e 2005. Mais especificamente, estas análises contemplam temas associados ao conhecimento e preconceito sobre HIV/Aids, ao uso de preservativos (masculino e feminino), acesso à testagem anti-HIV, uso de drogas, violência sexual, e suas interfaces com a sexualidade, incluindo orientação e práticas sexuais. Contemplam ainda recortes raciais/étnicos e regionais e características sócio-demográficas da população (idade, sexo, escolaridade, renda, religião, situação conjugal, etc). Neste sentido, vem fortalecer a posição internacional que o Brasil ocupa no que se refere aos seus esforços no combate à Aids. 2. Estimular junto à comunidade científica estudos voltados para o aprofundamento das questões relativas ao comportamento sexual da população brasileira e suas relações com o HIV/Aids, seus diferenciais e determinantes. 3. Atualizar os dados sobre a exposição de risco ao HIV, em diferentes regiões do país, segundo sexo, idade, raça/cor, escolaridade, renda e orientação sexual, dentre outras variáveis. Esta atualização permite, de um lado, avaliar as políticas adotadas pela Coordenação no sentido da prevenção das DST´s/Aids, e, de outro, subsidiar eventual reorientação de estratégias adotadas. O acesso gratuito e on-line ao periódico permitirá a difusão da produção brasileira nessa área a custo zero para a comunidade de pesquisadores, 5seja no âmbito nacional como internacional.

Metodologia: Para atender os objetivos mencionados, propõe-se produzir um Suplemento em periódico brasileiro, revisto por pares e indexado, bilíngüe, de acesso gratuito on-line, classificado pela CAPES como "Qualis A - Internacional", contendo artigos científicos relacionados às análises temáticas. Estas análises estarão a cargo principalmente dos pesquisadores que compuseram o Comitê Científico da edição 2004-2005 da Pesquisa "Comportamento Sexual e Percepções da População Brasileira sobre HIV/Aids", com o aporte de pesquisadores júnior, que trabalharão sob orientação direta dos colegas mais experientes, qualificando o pessoal envolvido no âmbito do HIV/AIDS, nos conceitos no âmbito da saúde sexual e reprodutiva, e na utilização apropriada de técnicas estatísticas, demográficas e epidemiológicas. Na análise estatística dos dados serão utilizados testes Qui-quadrado de Pearson para avaliar a associação entre duas variáveis categóricas. Medidas descritivas (média, desvio padrão, mediana e valores de máximo e mínimo) serão calculadas para as variáveis contínuas. Modelos de regressão logística serão ajustados com o objetivo de avaliar a associação de uma variável resposta de interesse com as demais variáveis explicativas, considerando possíveis variáveis de confusão. Serão utilizadas árvores de decisão baseadas nos métodos de CHAID e CHAID exaustivo. Segue estrutura preliminar do Suplemento com proposta de artigos temáticos e seus respectivos responsáveis: 1. Introdução - Elza Berquó e Pedro Chequer 2. Metodologia e Perfil sócio-demográfico - Wilton Bussab e Elza Berquó Bloco Comportamental 3. Práticas Sexuais e orientação sexual - Regina Barbosa 4. Uso do preservativo - Elza Berquó, Regina Barbosa, Vera Paiva, Francisco Bastos 5. Uso de Drogas - Francisco Bastos 6. Violência sexual - Lilia Schraiber e Ivan França Bloco Representações sociais 7. Preconceito e HIV/Aids - Sandra Garcia 8. Conhecimento sobre HIV/Aids - Vera Paiva 9. Opinião e Normas Sexuais - Vera Paiva Bloco Biomédico 10. DST - Francisco Bastos 11. Acesso e uso de testes anti-hiv - Ivan França 12. Reprodução - Elza Berquó, Sandra Garcia, Regina Barbosa

Concorrência: Estratégico

População Alvo: Outras populações-alvo

Natureza: SUPORTE A CIENCIA E TECNOLOGIA E CAPACITACÃO

Subnatureza: APOIO A EVENTOS, SEMINÁRIOS, CAPACITAÇÕES E FORMAÇÕES CIENT.

Produção Científica


Projeto: Análise das internações hospitalares de pessoas vivendo com HIV/Aids no Sistema Único de Saúde - SUS - no período de 1992 a 2005.
Coordenador: CARLOS DAVID NASSI
Resumo: Objetivo Geral: Analisar as informações de internação das pessoas vivendo com HIV e Aids contidas no SIH - Sistema de Informação Hospitalar objetivando conhecer os indicadores operacionais e o perfil de morbi-mortalidade, de modo a contribuir para o adequado gerenciamento da rede de assistência hospitalar. Objetivos Específicos: Extrair os dados das AIH de internação convencional e leito dia processadas no período de 1992 a 2005; Identificar os principais indicadores e construir outros que venham aprimorar a estimativa de leitos para internação de pessoas vivendo com HIV e Aids; Analisar os dados obtidos e sistematizados por regiões e Unidades da Federação; Identificar se há correlação entre estado imunológico e frequência de internações na tentativa de obter um indice que possa apoiar a estimativa de necessidade de leitos. Produto Final: Descrição e análise das internações hospitalares de pessoas vivendo com HIV e Aids com a finalidade de produzir indicadores que possam subsidiar os gestores no dimensionamento da necessidade de leitos e capacitação dos profissionais nas suas respectivas regiões, Estados e Municípios.

Objetivo: Ampliar o acesso e melhorar a qualidade de diagnóstico, tratamento e assistência em DST/HIV/Aids.

Metodologia: Levantamento de dados nos bancos de dados do DATASUS relativos ao período de 1992 a 2005 em conjunto com a COPPE; Elaboração de Planilhas contendo os dados; Verificação de consistência dos dados obtidos; Definição dos relatórios de saída com os dados sistematizados para análise; Identificar 4 doenças infecciosas crônicas com possibilidade de atendimento nos leitos-dia; Calcular o valor médio da AIH e média de permanência destas patologias; Comparar os valores médios da AIH destas patologias com os valores estimados para internação em leito-dia (média de permanência x valor da diária); Levantar os dados nos bancos de dados do DATASUS relativos ao período de 1992 a 2005 em conjunto com a COPPE; Analisar os dados do Sistema de Vigilância Epidemiológica para calcular o número de pessoas vivas a cada ano; Definir o perfil dos profissionais que devem participar da Oficina; Solicitar ao PN-DST-HIV e Aids a indicação de profissionais; Contar com a colaboração de 25 profissionais na análise das AIH de 27 UF e suas respectivas unidades hospitalares; Levantar os dados de CD4 no SISCEL e das internações no Estado do Rio de Janeiro - DSTASUS-COPPE; Calcular as frequências das internações de acordo com os níveis CD4; Correlacionar as internações hospitalares com os níveis de CD4 e verificar as frequências de internações por status imunológico.

Concorrência: Estratégico

População Alvo: Portadores do HIV/doentes de Aids

Natureza: ESTUDOS E PESQUISAS

Subnatureza: AVALIATIVA/OPERACIONAL

Produção Científica


Projeto: Infecção pelo HPV e Câncer Cervical: Correlação Clínico Epidemiológica e Fatores de Risco em Populações Distintas da Amazônia Brasileira.
Coordenador: JUAREZ ANTONIO SIMOES QUARESMA
Resumo: O câncer cervical uterino constitui uma das principais doenças neoplásicas que acomete mulheres na idade reprodutiva na Região Norte. Sua distribuição e incidência guardam íntima relação com a infecção pelo vírus papiloma humano (HPV) e conseqüentemente com as condições sociais e econômicas de uma dada população. As populações do presente estudo apresentam características distintas quanto aos fatores de risco de infecção pelo HPV, a Região Metropolitana de Belém, que inclui municípios como Belém, Ananindeua e Marituba, se caracteriza por ser região com cerca de 2 milhões de habitantes, uma das maiores concentrações populacionais da Região Norte, apresentando áreas onde as baixas condições sócio-econômicas, grandes aglomerações e desinformação possibilitam a disseminação do HPV e conseqüentemente a incidência de câncer cervical uterino. A região do Vale do Tapajós, que inclui o município de Itaituba, bem como as comunidades de garimpo Barreiras e São Luiz do Tapajós, se caracterizam pela forte influencia dos diversos garimpos existentes na região cujos fatores de risco a infecção pelo vírus HPV podem concorrer para a incidência aumentada de câncer cervical uterino. Finalmente, as comunidades ribeirinhas da região do município de Igarapé-Miri, as margens do rio Tocantins, tais como a Vila de Panacauera, cujos hábitos de vida sofrem forte influencia dos rios, nos fornecerá dados importantes sobre a situação de incidência e prevalência de infecção pelo HPV em comunidades ribeirinhas, que por sua vez representam uma considerável parcela da população da Amazônia Brasileira. Seja qual for a região considerada, dados referentes à incidência de câncer de colo uterino associado à infecção pelo HPV ainda não estão completamente caracterizados na literatura pertinente, ocorrendo lacunas importantes quanto a real situação da infecção pelo HPV na Região Norte. Dados mais recentes apontam para uma alta incidência desses tumores no Estado do Pará, porém os fatores de risco associados às diferentes condições sócio-econômicas nos fornecerão subsídios para caracterizar a distribuição do câncer uterino cervical associado ao HPV nas diferentes populações estudadas.

Objetivo: OBJETIVO GERAL: Considerando as lacunas existentes sobre a incidência e fatores de risco de infecção pelo HPV nas diversas regiões alvos de estudo no presente projeto, e conseqüentemente o risco a câncer cervical uterino associado, o objetivo geral deste projeto é identificar os principal fatores de risco à infecção, bem como os tipos de HPV circulantes e sua associação a lesões cervicais de baixo e alto grau, em diferentes populações da Amazônia brasileira, correlacionando as taxas de incidência e prevalência com as características sociais, pessoais e econômicas da população considerada. OBJETIVOS ESPECÍFICOS: 1. Identificar os subtipos de HPV nas populações estudadas. 2. Identificar os principais fatores de risco à infecção pelo HPV nas populações estudadas. 3. Identificar o subtipo mais freqüente nas populações estudadas. 4. Correlacionar os subtipos de HPV com a presença de lesão cervical uterina de caráter inflamatório, pré-neoplásico e neoplásico através de exames citológicos ou de biopsia em cada uma das populações estudadas. Correlacionar os achados de lesões cervicais uterinas de alto e baixo grau com a imunoexpressão in situ de p16, p53 e Ki67, BCL2, oncogenes envolvidos na patogenia do câncer de colo uterino

Metodologia: Coleta das amostras Das pacientes portadoras de lesões cervicais serão coletadas células cervicais com o auxílio da espátula de Ayre para as reações de PCR. A espátula será então partida com o intuito de diminu-ir seu tamanho para que seja armazenada em um tubo de ensaio contendo soro fisiológico. As a-mostras serão armazenadas em nitrogênio liquido até seu processamento. Também serão realizadas biopsias e coleta de material para a realização de exame citológico, sendo o material processado para exames histopatológicos, citológicos e de imunohistoquímica. Isolamento do DNA O isolamento de DNA das amostras será realizado através de um protocolo rápido, descrito em Souza et al. (2001), utilizando-se a resina quelante Chelex-100. Métodos Moleculares Para pesquisa de HPV serão utilizados 2 procedimentos de PCR: o primeiro para a detecção e o segundo para a genotipagem. Para controle da extração será utilizado um par de primers que am-plifica o gene da globina (a presença do amplicon da globina monitora a amplificação in vitro do DNA). As amostras positivas serão tipadas para os vírus dos tipos 6, 11, 16,18, 31, 33, 35, 52 e 58. Para cada tipo de HPV existe um par de primers. Para identificação dos HPVs 35, 52 e 58 serão utilizados primers universais E6/7F e E6/E7R, seguida da amplificação com os primers específicos HPV35F e HPV35R, HPV52F e HPV52R, HPV58F e HPV58R, de acordo com o protocolo utilizado por Hwang (1999). Para evitar contaminação com DNA estranho serão utilizadas salas independentes para cada uma das etapas: extração do DNA, preparação do mix, procedimento da PCR e eletroforese. A obtenção de amplicons que não forem possíveis de amplificar com os primers específicos 6, 11, 16, 18, 31, 33, 35, 52 e 58; sugerindo a possibilidade de uma nova cepa viral, será feita com auxílio dos oligos universaisE6/7F e E6E7/R segundo condições de PCR descritas em Silva (2000). Os fragmentos amplificados serão purificados através de eletroforese em matriz de agarose e purificados com au-xílio do kit GFX (GE Health Care). O produto de purificação será clonado em vetor tipo phagemid pGEM-T vector (Promega Corp.). O produto de ligação será transformado por eletroporação em linhagem DH5 alfa e os clones recombinantes isolados e crescidos em meio líquido em placas deep well. As minipreparações serão feitas com auxílio da lise alcalina e purificadas em membranas Multiscreen (Milipore). O seqüenciamento do DNA será realizado pelo método didesoxiterminal a partir da síntese de cadeias únicas marcadas fluorescentemente pela tecnologia de Dye Termina-tors. Os "templates" usados para o seqüenciamento serão obtidos de palsmídios recombinantes. A eletroforese será capilar em sistema de detecção automática MegaBace 1000 (GE Health Care).

Concorrência: Chamada de Pesquisa 2005 - 324/2005

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: Estudo Clínico-Epidemiológico da Co-infecção HIV/Candidíases Sistêmicas no Pará
Coordenador: ANDREA LUZIA VAZ PAES
Resumo: A população de estudo será de indivíduos com sorologia para o HIV positiva que estejam desenvolvendo candidiase oral e / ou candidemia que estejam internados no Hospital Universitário João de Barros Barreto (HUJBB). A população alvo a ser beneficiada será a do Estado do Pará, uma vez que o serviço de assistência de referência para o paciente portador do vírus HIV, fica localizado em Belém, atenderá pacientes oriundos de todo o Estado, e o HUJBB é o hospital de referência para a internação dos pacientes com HIV/ SIDA. O Hospital Universitário João de Barros Barreto é um hospital de referência para doenças infecciosas e parasitárias para todo o Estado, portanto internam pacientes de vários municípios do Estado do Pará, além da região metropolitana de Belém. No Pará observou-se 3.219 casos de SIDA registrados até 2003. Até o final de 2002 ocorreram 1.013 óbitos com uma taxa de mortalidade de 2,0 a 3,2 por 100/hab.em 1996 e 2002 respectivamente. Com maior número de casos de SIDA em 2003 nos seguintes municípios: Belém, Ananindeua, Parauapebas, Marabá e Redenção.

Objetivo: OBJETIVO GERAL: Avaliar a presença de candidemia na população com o vírus da imunodeficiência adquirida, internados no HUJBB. OBJETIVOS ESPECÍFICOS:1) Identificar as espécies de Candida mais encontradas em pacientes com HIV. 2) Observar se há associação de comprometimento mucoso por Candida com evolução para candidemia em pacientes com HIV. 3) Identificar a ocorrência de envolvimento visceral nos pacientes que desenvolveram candidemia. 4) Avaliar o perfil de sensibilidade das Candida isoladas, aos antifúngicos utilizados atualmente. 5)Comparar os fatores de risco observados na população estudada

Metodologia: Tipo de estudo : transversal, prospectivo. População de referência: pacientes HIV positivos no estado do Pará. População de estudo: pacientes HIV positivos atendidos no HUJBB. Ambiente de pesquisa: o estudo será desenvolvido em um hospital universitário HUJBB, que pertence ao sistema único de saúde que possui clínicas: doenças infecciosas e parasitárias (onde internam os pacientes HIV positivos), pneumologia, clínica médica, pediatria, clínica cirúrgica e unidade de tratamento intensivo, e com 6 isolamentos (distribuídos em três andares). Critérios de inclusão: pacientes com sorologia para HIV positiva, que internem com candidíase oral ou desenvolvam durante a internação. Critérios de exclusão: pacientes com sorologia para o HIV negativos. Procedimentos clínicos e laboratoriais: Coleta de dados clínicos em ficha protocolo: Sexo, idade, procedência, situação imunológica ( CD4, Carga viral), presença de co-morbidades, uso de cateres , nurição parenteral, antibioticoterapia Coleta de material : dos pacientes selecionados será colhido um swab do orofaringe no momento do aparecimento da Cândida Diagnóstico microbiológico, identificação de espécies e determinação do perfil de sensibilidade: as culturas serão semeadas em meio agar-Sabouraud, para identificar a espécie de Cândida e após identificadas através dos testes de tubo germinativo, em seguida será realizado o fungigrama para identificar o perfil de sensibilidade. Técnicas: Após a coleta, os swabs deverão ser semeados em tubos de ensaio com meio Sabouraud e colocados em estufa 37ºC por 24 horas para observação do crescimento da colônia. Após o semeio, os swabs deverão ser submetidos ao exame direto, que consiste em esfregaço entre lâmina e lamínula com Hidróxido de Potássio - 10%. As culturas, depois de crescidas serão submetidas ao teste do Tubo Germinativo, que consiste em cultivar uma pequena parte do inoculo em soro humano e incubar por duas horas, para observar a formação de tubos germinativos que caracterizam a espécie C. albicans. Após a identificação, o material deverá seguir para a realização do antifugigrama para avaliar o perfil de sensibilidade aos antifúgicos. Hemocultura - semeio em caldo tioglicolato, para enriquecimento da amostra e sub-culturas em agar sangue para crescimento e identificação do fungo. Os frascos coletados deverão ser incubados por 24horas a 37ºC. Após esse período deverão ser feitos sub-cultivos seriados em intervalos de 48 horas, até sete dias, semeando-se uma alíquota do caldo cultivado, em agar sangue e incubado por 24h a 37ºC. Após esse período, a placa deverá ser observada para o crescimento ou não de fungos. Se houver crescimento, uma pequena parte do inoculo deverá ser submetida ao exame direto, entre lâmina e lamínula e ao teste do Tubo Germinativo e posteriormente ao antifungigrama para avaliação do perfil de sensibilidade a antifúngicos. Se não houver crescimento, a placa deverá ser desprezada e o resultado considerado como negativo. Tratamento dos pacientes : Os pacientes serão tratatados segundo recomendações do programa DST/AIDS e protocolo clínico do HUJBB. Evolução clínica: serão colhidos dados de evolução clínica e co-relacionados com os fatores de risco e terapêutica instituída.

Concorrência: Chamada de Pesquisa 2005 - 324/2005

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: Sífilis: Análise Molecular de Tecido de Placenta e Cordão Umbilical, como método diagnóstico da infecção congênita.
Coordenador: ELIETE DA CUNHA ARAUJO
Resumo: Na prática clínica há uma grande problemática em relação ao diagnóstico laboratorial da sífilis congênita, pois o sorodiagnóstico disponível na rotina pode levar a resultados falso-positivos e falso-negativos em virtude de inúmeros fatores de ordem técnica (execução dos testes), até aqueles relacionados com a dinâmica de passagem de imunoglobulina da mãe para o feto (gera resultados falso-positivos) (1,4,10,16, 33). Em conseqüência desta realidade encontrada na rotina clínica, torna-se essencial buscar e testar novas técnicas, a exemplo da PCR, como método de confirmação do diagnóstico de infecção pelo Treponema pallidum dos neonatos com suspeita de sífilis, pois dessa forma os casos suspeitos serão confirmados ou não sendo tratados todos aqueles que possuírem realmente a infecção pelo agente, levando a diminuição dos gastos com medicamento e também não expondo os recém-nascidos sem infecção (suspeitos) a antibioticoterapia. Somando-se a esta necessidade, esta pesquisa propõe mostrar a reprodutibilidade do uso de amostra de tecido de placenta, cordão umbilical e sangue de cordão umbilical como material biológico alternativo para ser usado no diagnóstico molecular. Além da dificuldade que se encontra no diagnóstico sorológico, outro problema enfrentado é o problema da subnotificação dos casos de sífilis congênita. Este fator, em especial na Região Norte, dificulta a vigilância epidemiológica da doença e conseqüentemente o desenvolvimento de planos de intervenção no processo saúde-doença. Utilizar técnicas modernas e eficientes no diagnóstico da SC é um meio de melhorar a cobertura de tratamento dos casos de sífilis, tornar mais efetiva as ações de controle da doença (notificação dos casos, vigilância epidemiológica, criação de programas, etc). A população atendida pela F.S.C.M.PA é de baixa renda em sua grande, provenientes da periferia de Belém e de localidades do interior do Pará, vivendo muitas vezes em péssima condições de habitação, saneamento e de baixo nível sócio-cultural (1,8,19,26). Estudar esta população é importante para se conhecer os aspectos sócio-econômico-cultural, além de mostrar a reprodutibilidade da PCR como método diagnóstico, usando material de placenta, cordão umbilical e sangue de cordão umbilical. Conhecer fundamental importância como instrumento de intervenção do processo saúde-doença; além de auxiliar no desenvolvimento de programas assistenciais voltados para as reais necessidades dessa população que está sendo exposta à aquisição da infecção pelo T. pallidum. Puérperas que durante a triagem do pós-natal forem diagnosticadas como soropositivas para infecção pelo Treponema pallidum, atendidas na Fundação Santa Casa de Misericórdia do Pará (FSCMPA), provenientes da capital e do interior do Estado do Pará. Segundo a Organização Mundial de Saúde (OMS), mais de 12 milhões de novos casos de sífilis ocorrem a cada ano, com mais de 90% destes ocorrendo em países em desenvolvimento.(35) Em muitas regiões do país mais de 95% das grávidas freqüentam o serviço de pré-natal, e cerca de 91,5% têm os bebês na maternidade, no entanto, a morbidade e mortalidade materna e perinatal permanecem altas, refletindo deficiências importantes no atendimento (20,21,22). O coeficiente de mortalidade por sífilis no Brasil foi de 2,45/1.000.000 habitantes em 1980, diminuindo continuamente até níveis de 1,02/1.000.000 em 1995, um decréscimo de 58,2% em 15 anos. Houve uma tendência de queda destes coeficientes de 1980 a 1995, embora as regiões Norte e Nordeste tenham apresentado taxas ascendentes, nos primeiros 5 anos. A sífilis congênita apresentou coeficientes mais elevados, o máximo de 8,87/100.000 menores de um ano na região Norte, em 1985, e o mínimo de 1,33/100.000 menores de um ano na mesma região, em 1980. A região Nordeste apresentou elevação de coeficientes de 120% de 1980 a 1990, com queda discreta (11,5%), até 1995 (15) Melo e colaboradores (2001), realizaram um estudo epidemiológico retrospectivo de sífilis congênita na Fundação Santa Casa de Misericórdia - Pará (F.S.C.M. - PA), em um período de dez anos (1990-2000), foram detectados e analisados 152 prontuários de crianças com diagnóstico de SC, dos quais obtiveram as seguintes informações a cerca das mães: 34,3% da amostra eram mães solteiras; a ocupação dona de casa foi observada em 28,9 %, entre as mães estudadas a idade variou de 12 a 40 anos, com média de 22 anos. Apenas 13,2 % delas realizaram pré-natal. Foi observado ainda que 32,2% dos RN eram assintomáticos e 44% eram prematuros e de baixo peso. Outros sinais clínicos também observados foram: icterícia, hepatomegalia, esplenomegalia, lesões de pele e lesões ósseas. O VDRL foi reator em 137 recém-nascido (RN), com titulação variando de 1/2 a 1/512, vinte e seis RN evoluíram para óbito e destes, 50% de suas mães não realizaram pré-natal. Além desses trabalhos, outros mostram que a prevalência da sífilis congênita é alta e que inúmeros fatores de risco estão envolvidos como: promiscuidade sexual, uso de drogas ilícitas, pouco uso de preservativo e uso de bebidas alcoólicas. Além disso, reforçam a necessidade de melhorar o sistema de notificação dos casos de sífilis congênita, pois a subnotificação na Região Norte é um problema agravante que não revela a verdadeira magnitude da doença. (1,8,19,23, 26)

Objetivo: OBJETIVO GERAL: Estudar a prevalência de sífilis na interface materno-infantil do binômio triado para infecção pelo Treponema pallidum na Fundação Santa Casa de Misericórdia durante o pós-natal, os fatores de risco e o desempenho da Reação em Cadeia de Polimerase, como método diagnóstico na detecção da infecção congênita. " OBJETIVOS ESPECÍFICOS: Estimar a prevalência da sífilis adquirida e congênita na Fundação Santa Casa de Misericórdia do Pará; " Indicar os potenciais fatores de risco; " Aplicar a Reação em cadeia de Polimerase (PCR) como técnica diagnóstica da infecção pelo Treponema pallidum; " Analisar as alterações histopatológicas do tecido de cordão umbilical e placenta " Estabelecer a relação custo-benefício da técnica, visando a sua aplicação na rotina clínica.

Metodologia: CASUÍSTICA Esta pesquisa trata de um estudo coorte prospectivo em puérperas, triadas para sífilis pelo teste não-treponêmico VDRL e também através de informações clínicas e de outros testes laboratoriais específicos utilizados para a definição de caso sífilis. Dois grupos serão coletados para esta pesquisa, um grupo formado por puérperas que soropositivas e com histórico de sífilis e o outro grupo constituído por puérperas soronegativas e sem histórico de sífilis. Esta pesquisa terá um tamanho amostral estimado em 80 puérperas com suspeita de sífilis e 160 parturientes sem a doença, tomando-se como parâmetro um período de 12 meses a ser contado a partir da aprovação e liberação dos recursos. Na F.S.C.M., assim como preconizado pelo Ministério da Saúde, é rotina a triagem sorológica para infecção pelo Treponema pallidum durante o período pré-natal e o puerpério. A coleta de material de placenta e cordão umbilical não é rotina, porém são amostras abundantes e coletadas de forma não-invasiva e sem prejuízo a paciente; no caso de sangue de cordão umbilical, este também é abundante e coletado para algumas determinações e por isso de fácil acesso. Desta forma, estas amostras serão coletadas após os grupos estudados serem informados e esclarecidos sobre a abordagem da pesquisa e um Termo de Consentimento Livre e Esclarecido (anexo 1) assinado pela paciente como termo de permissão para a participação no estudo. Uma ficha protocolo com questões dirigidas à identificação pessoal, do pré-natal, das condições sócio-econômicas, higiênicas e sanitárias deverá ser respondido pelas puérperas dos dois grupos. CRITÉRIOS DE INCLUSÃO E EXCLUSÃO " A puérpera, quando menor de 18 anos, participará do estudo com o consentimento do responsável, o qual deverá assinar o Termo de Consentimento Livre e Esclarecido (TCLE), " A puérpera deverá apresentar bom estado geral de saúde, principalmente na hora do esclarecimento do estudo e da assinatura do TCLE, " Acesso às amostras Biológicas da puérpera, " A mãe deverá residir no estado do Pará, " A mãe não deverá ser portadora de deficiência mental, COLETA DAS AMOSTRAS a) Amostra de Placenta e Cordão Umbilical As espécies de placenta e cordão umbilical serão coletadas das parturientes que forem soropositivas para infecção pelo Treponema pallidum. Será coletado também uma amostra controle, isto é, o material de placenta e cordão umbiliacal será coletado de pacientes com sorologia negativa para sífilis, sendo que o número de amostras do controle será igual a da amostra estudo. As placentas serão submetidas a um estudo morfológico inicial. Elas serão medidas, pesadas e macroscopicamente examinadas de acordo com parâmetros descritos por Naey 1987. O cordão umbilical, por sua vez, será removido do corpo placentário e no mínimo dois fragmentos, incluindo a porção distal e proximal, serão selecionadas para exame histopatológico. Dois fragmentos de ambos os tecidos serão coletados e fixados em formalina tamponada a 10% por 24 horas e em seguidas processadas para análises histopatológicas e imunopatológica Aomesmo tempo, fragmentos de diversas áreas do tecido placentário e cordão umbilical serão acondicionados em tubos eppendorf estéril e congelados para posterior extração de DNA. b) Amostra de Sangue de Cordão Umbilical A coleta será realizada nos dois grupos estudados (grupo estudo e controle) utilizando-se material estéril, de uso individual e descartado segundo as normas de biossegurança. Serão utilizados 6 mL de sangue de cordão coletados em tubo com EDTA. As amostras serão encaminhadas e processadas no laboratório de imunogenética da Universidade Federal do Pará e terão o DNA extraído e armazenado a -20 ºC até a utilização. DESCRIÇÃO DAS TÉCNICAS REALIZADAS a) Detecção por PCR do Treponema pallidum PREPARAÇÃO DE DNA O DNA será extraído das amostras de sangue periférico e líquido cefalorraquidiano através de dois métodos diferentes: Fenol-Clorofórmio e Kit QIAamp da QIAGEN, sendo que a extração de DNA com este Kit será de acordo com as instruções do fabricante. EXTRAÇÃO DE DNA DE Treponema pallidum FENOL-CLOROFÓRMIO: - Amostras de Cordão Umbilical e placenta Vinte e cinco miligramas de cada amostra será colocada em tubo de microcentrífuga e 500 l de solução de lise alcalina será adicionada. As amostras serão misturadas vigorosamente em vortex e em seguida adicionado 20 l de proteinase K, sendo incubadas a 58 ºC por 12 horas. Após incubação será adicionado 250 l de fenol saturado e 250 l de clorofórmio em cada tubo eppendorf. Homogeneizar em agitação perpendicular por 10 minutos e centrifugar por 5 minutos a 14.000 rpm. Retirar o sobrenadante, transferindo para um tubo limpo repetir o procedimeto e em seguida adicionar 500 l de solução clorofórmio - isopropanol (proporção 24:1). Homogeneizar em agitação perpendicular por 10 minutos e centrifugar por 5 minutos a 14.000 rpm. Repetir esse procedimento por mais uma vez. Adicionar 900 l de álcool isopropílico, agitar cuidadosamente para formação do pellet. As amostras que não apresentarem a formação do pellet serão congeladas por 12 horas. Centrifugar por 10 minutos a 14000 rpm, para sedimentação do pellet, desprezar o álcool isopropílico, lavar o tubo com 200 l de Etanol a 70%, esperar o etanol evaporar e adicionar 200 l de água estéril, para hidratar o DNA. Após hidratação o DNA foi congelado a -20°C, para posterior análise. - Amostras de sangue de cordão umbilical O sangue coletado será centrifugado por 5 minutos a 3000rpm para separação dos componentes sanguíneos. Em seguida será pipetado para um tubo de microcentrífuga, 200 l da camada de leucócitos e 200 l do pacote de hemácias de cada indivíduo e adicionar 1 mL de solução de lise de hemácias. Homogeneizar em agitação perpendicular por 15 minutos e centrifugar por 5 minutos a 14.000 rpm. Depois da centrifugação observar a formação do precipitado e descartar o sobrenadante. Repetir esse procedimento por mais duas vezes. Adicionar 500 l de solução de lise alcalina (0.5 M Tris-HCl [pH 7.0], 5 M NaCl, 5 M NaOH, 10% dodecil-sulfato de sódio-SDS), agitar levemente no agitador vortex e incubar no banho - maria a 58°c por 3 horas. Após incubação será adicionado 250 l de fenol saturado e 250 l de clorofórmio em cada tubo eppendorf. Homogeneizar em agitação perpendicular por 10 minutos e centrifugar por 5 minutos a 14.000 rpm. Retirar o sobrenadante, transferindo para um tubo limpo e adicionar 500 l de solução clorofórmio - isopropanol (proporção 24:1). Homogeneizar em agitação perpendicular por 10 minutos e centrifugar por 5 minutos a 14.000 rpm. Repetir esse procedimento por mais uma vez. Adicionar 900 l de álcool isopropílico, agitar cuidadosamente para formação do pellet. As amostras que não apresentarem a formação do pellet serão congeladas por 12 horas. Centrifugar por 10 minutos a 14000 rpm, para sedimentação do pellet, desprezar o álcool isopropílico, lavar o tubo com 200 l de Etanol a 70%, esperar o etanol evaporar e adicionar 200 l de água estéril, para hidratar o DNA. Após hidratação o DNA foi congelado a -20°C, para posterior análise. AMPLIFICAÇÃO PELO PCR A amplificação pela reação em cadeia da polimerase - PCR será realizada em um termociclador da marca EPPENDORF. O par de oligodesoxinucleotídeos iniciadores (primers) e o tamanho do fragmento amplificado a ser usado neste estudo está listado abaixo. As misturas de PCR terão um volume final de 50 l, contendo 0,5 mM de cada primer, 1 X PCR tampão, 1,5 mM de MgCl2, 0,2 mM de cada base nitrogenada (dATP, dTTP, dGTP dCTP), 1,25 U de Taq. Polimerase, 2 l de amostra de DNA e água estéril. As condições de PCR utilizadas serão as seguintes: 94oC - 5 minutos; 35 ciclos (repetições) com as três seguintes temperaturas, 94oC - 1 minuto (desnaturação), 60oC - 1 minuto (anelamento), 72oC - 1 minuto (extensão); e por fim, 72oC - 10 minutos. Os produtos da PCR são separados por eletroforese em gel de agarose a 1%, colorido com brometo de etidium para a visualização do DNA. Primer utilizado na amplificação dos fragmentos de DNA, para detecção do Treponema pallidum. Região amplificada: Pol A Seqüência: 5'-TGCGCGTGTGCGAATGGTGTGGTC-3' 5'-CACAGTGCTCAAAAACGCCTGCACG-3' Tamanho do produto esperado: 377 pb AVALIAÇÃO HISTOLÓGICA DA PLACENTA E CORDÃO UMBILICAL As amostras representativas de placenta, cordão umbilical e membranas oriundas das parturientes com sorologia positiva será coletada em tamanho igual aquelas com sorologia negativa para estudo morfológico. O exame macroscópico incluirá observação de alteração de cor, tamanho, vasculatura, espessamentos e morfologia da placenta, cordão umbilical e membranas. Após o exame macroscópico serão retiradas as membranas confeccionando-se rolinhos e incluindo-as em formol tamponado a 10%. O cordão umbilical após medido e examinado será seccionado da placenta a cerca de 1 cm de sua inserção, então, dois segmentos (proximal e distal) de aproximadamente 2 cm será incluído em formalina. A placenta será pesada, medida em diâmetro e expessura e examinada considerando: a face fetal recoberta para a membrana e a face materna. Três segmentos incluindo a espessura de duas extremidades e um envolvendo a inserção do cordão serão obtidos fixados em formol tamponada. Após o proceso de fixação e obtenção de blocos de parafina do material serão submetidos a cortes de 3 a 4 mm de espessura e serão submetidos a coloração de rotina (HE) para a avaliação dos aspectos histopatológicos gerais e na coloração especial de Whatin-Starry para identificação das espiroquetas. As amostras de tecido placentário e de cordão umbilical fixadas em tampão formalina serão processadas para uso histológico, usando um processador automático, mediante banho seqüenciais de álcoois 70%, 80%, 90% e 100% durante uma hora em cada e incluídos em parafina. Em cada bloco serão feitos cortes seriados de aproximadamente 4 -5 m de espessura e dispostos em lâminas e corados pelo métodos da hematoxilina-eosina (HE) e Warthin-Starry e analisados em microscopia óptica para diagnóstico das lesões patológicas. a) Placenta As placentas coradas serão avaliadas para as seguintes características histológicas: 1. Vilosidades alargadas e hipercelularidade aumentada, ou seja, vilos aparentemente imaturos com fibroblastos estromais proeminentes ou células Hofbauer. 2. Alterações na proliferação vascular fetal, com espessamento de capilares, arteríolas e vênulas fetais com um proeminente aumento de tecido conjuntivo perivascular ou do músculo liso vascular. 3. Vilites ou perivilites que varia de linfocítica à granulomatosa marcadas por numerosas células plasmáticas As espécimes com esta tríade histológica serão categorizadas como histologicamente positivas para sífilis congênita, e aquelas com duas destas três características serão consideradas como histologicamente suspeita. A demonstração dos espiroquetas na placenta nem sempre é fácil, especialmente se a gestante for tratada. Pela coloração de Steiner modificada serão identificadas histoquimicamente os espiroquetas. Lâmina de tecido testicular de coelho infectado com T. pallidum será incluída como controle positivo. b) Cordão Umbilical O cordão umbilical será considerado microscopicamente normal, quando não forem evidenciadas anormalidades estruturais como necroses, ou células inflamatórias nas paredes vasculares umbilicais, mesenquimais ou superfícies amnióticas. Existem três tipos de funisite: - A funisite aguda consiste de infiltrado inflamatório predominantemente de neutrófilo nas paredes dos vasos e mesenquimas, sem destruição da integridade do vaso sangüíneo. - A funisite necrotizante será diagnosticada quando predominar uma população de células inflamatórias mononucleadas, usualmente composta de linfócitos e macrófagos com a presença de células de características nucleares nodulares acompanhada pela necrose e ruptura das paredes dos vasos sangüíneos. - A funisite mononuclear e de células plasmáticas, consiste de infiltrado inflamatório composto predominantemente de células mononucleares (linfócitos e macrófagos) e células plasmáticas perspectivamente dentro das paredes umbilicais ou mesenquimais, e ausência de necroses ou ruptura das paredes dos vasos. Geralmente para todos os casos de funisite observa-se o envolvimento de inflamação de artéria e veia umbilical. Foi notada em todos os casos de funisite, inflamação envolvendo artérias e vasos umbilicais. O número de espiroquetas vistos pela coloração de Steiner foi estimado usando uma escala semiquantitativa: 1= pouco (média de um espiroqueta por campo); 2 = moderado (média de dois espiroquetas por campo); 3 = numeroso (média de seis ou mais espiroquetas por campo).

Concorrência: Chamada de Pesquisa 2005 - 324/2005

População Alvo: Mulher - Criança (TV)

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICA

Produção Científica


Projeto: Contribuição ao Estudo Clínico Epidemiológico da co-infecção HIV/Hanseníase em populações de alta endemicidade para Hanseníase na Amazônia.
Coordenador: MARILIA BRASIL XAVIER
Resumo: A infecção humana pelo vírus HIV (Vírus da Imunodeficiência Humana), constitui um problema de saúde pública mundial onde as células CD4+, principalmente linfócitos T infectados são destruí-dos.Posteriormente há alterações de linfócitos B, macrófagos e citocinas, com imunodeficiência gradativa. A infecção culmina com a SIDA ou AIDS (Síndrome da Imunodeficiência Adquirida) que constitui a fase caracterizada por severa supressão do sistema imune celular e humoral com diversas manifestações clinicas incluindo infecções oportunistas, neoplasias e degeneração do sistema nervoso central. A pandemia apre-senta-se em ascensão na região Norte e no Estado do Pará que está vivendo o fenômeno da interiorização. Enquanto na capital os números de casos se mostram estabilizados nos últimos três anos, as notificações no interior do Estado aumentam ano a ano. Sabe-se que depois da área metropolina - Belém, Ananindeua e Marituba , o município de Parauapebas, no sul paraense, é destaque no mapa do controle estadual de AIDS. Itaituba, município do vale do tapajós possui áreas de intensa atividade garimpeira e madereira, onde a instalação recente do CTA certamente permitirá melhorar a detecção da infecção pelo HIV nessa popula-ção. Pelos dados da Sespa, atualmente há no Estado mais de três mil casos notificados de AIDS e outras 4.300 pessoas portadoras do HIV, nas quais a doença ainda não se manifestou. As internações hospitalares de portadores do vírus da aids ocorridas em 2003 são indicadores de que a AIDS está aumentando no inte-rior do Estado. Das 412 internações, nos cinco hospitais credenciados pelo Ministério da Saúde, para trata-mento em soropositivos de Belém, 294 foram de pacientes residentes na capital e 118 vindos do interior. A Hanseníase é doença infecciosa, causada pelo Mycobacterium leprae, de alta prevalência no Estado do Pará, em média 11 a 13 casos por 10.000 hab. Parauapebas e Itaituba constituem áreas de hiperendemi-cidade no Estado. É doença crônica, infecciosa, porém com períodos de agudização de fenômenos inflama-tórios relacionados á mecanismos auto-imunes, chamadas rações hansênicas, podendo causar dano neural e incapacidades. O tratamento é prolongado e por vezes, mesmo após o tratamento microbicida, torna-se ne-cessário manter outras drogas para o tratamento das reações. No ambulatório do NMT-UFPA, que realiza atendimento de apoio e pesquisa em dermatologia Tropi-cal às PVHA, foram diagnosticados 27 pacientes de co-infecção HIV/Hanseníase e estão em acompanha-mento no serviço. Torna-se necessário ampliar ações de busca de casos e melhorias para diagnóstico, acom-panhamento clínico e terapêutico, pelo que justifica-se continuar e ampliar as pesquisas e o atendimento já iniciado. Este projeto tem por objetivo descrever aspectos clínicos de pacientes com co-infecção hanseníase e AIDS, tais como como forma clínica , ocorrência de quadro reacional, presença de neurites, concomitância com outras doenças, estabelecer correlações com imunodeficiência clínica e laboratorial (carga viral e con-tagem de CD4), observar e descrever aspectos histológicos e imunohistoquímicos de tecido lesional (pele), utilizando citocinas indicadoras de resposta Th1 (TNF alfa) e TH2 (TGF-beta), quantificar os níveis de anticorpos anti PGL-1, anti-gangliosídeos e anti-NGF em pacientes acometidos de hanseníase e AIDS si-multaneamente, avaliar a sua funcionalidade e possível correlação com a evolução desta doença e descrever aspectos terapêuticos para a co-infecção, como manejo das reações, verificar adesão ao tratamento, substitu-ição de drogas. Para tal, será realizado estudo de prevalência em PVHA matriculados nas unidades de refe-rencia especializada no atendimento de portadores do Vírus HIV dos municípios de Belém ( URE-DIPE e Casa Dia) e municípios de Parauapebas (CTA) e Itaituba (CTA) e de seguimento dos casos portadores de co-infecção HIV no Ambulatório do Núcleo de Medicina Tropical - NMT / UFPA. Os controles para ava-liação de modificações na tipologia da evolução da co-infecção, serão casos de hanseníase não portadores de HIV atendidos no mesmo serviço. A detecção dos níveis de anticorpos anti PGL-1 em doentes e controles através do método de ELISA indireto padronizado no laboratório do Instituto Evandro Chagas.A quantifica-ção dos títulos séricos dos anticorpos antiganglíosídeos será feito por ELISA no laboratório de Neuroquí-mica do centro de ciências biológicas da UFPA e a quantificação dos títulos séricos do anticorpo NGF será feita por ELISA no laboratório de Neuroquímica do centro de ciências biológicas da UFPA.A realização das técnicas histológicas será feita no laboratório de imunopatologia do Núcleo de medicina Tropical e as técnicas imuno-histoquímicas para observação de citocinas TNF-alfa e TGF-beta serão realizadas no labora-tório de imunopatologia da USP- S. Paulo. Os resultados serão encaminhados através de relatórios ao Minis-tério da Saúde divulgados em congressos de hansenologia e medicina tropical, encaminhados ao Ministério da Saúde/ DST/AIDS e publicados em revista internacional da área.

Objetivo: OBJETIVO GERAL: Conhecer a prevalência da coinfecção HIV/Hanseníase entre pacientes portadores do HIV matriculados nas unidades de referência de tratamento e diagnóstico para o HIV oriundas de diferentes populaçãoes do Estado do Pará, em áreas endêmicas para hanseníase e descrever aspectos clínicos relacionados à co-infecção. OBJETIVO ESPECÍFICO: Diagnosticar casos de co-infecção de HIV/Hanseníase em pacientes HIV/AIDS, frequentadores das unidades de referencia para diagnóstico e tratamento da infecção pelo HIV no município de Belém, Itaituba e Parauapebas Determinar a prevalência da co-infecção na população estudada Tratar os casos Descrever prevalência das formas clínicas de hanseníase Descrever ocorrência de reações hansênicas e neurites Descrever e co-relacionar com co-morbidades Verificar possíveis alterações na evolução clínica da hanseníase na concomitância com a infecção pelo HIV, através de grupo controle Verificar dificuldades de adesão ao tratamento poliquimiterápico para hanseníase na vigência da medicação ARV Descrever mudanças na evolução clínica da hanseníase de acordo com a situação imunológica do paciente.

Metodologia: Tipo de estudo : Estudo de prevalência e caso controle. População de referência: pacientes HIV positivos no estado do Pará. População de estudo: pacientes apresentando co-infecção HIV/Hanseníase oriundos da Unidades de referencia de atendimento especializado para PVHA de Belém, Parauapebas e Itaituba. Ambiente de pesquisa: o estudo será desenvolvido nas Unidades de referência de atendimento especializado para PVHA de Belém, Parauapebas e Itaituba e no Ambulatório e Laboratórios do Núcleo de Medicina Tropical da Universidade Federal do Pará. No referido ambulatório já existe atendimento de rotina em dermatologia Tropical para PVHA encaminhadas de todo o Estado. Médicos especialistas em infectologia e dermatologia são responsáveis pelo atendimento. Critérios de inclusão de caso de co-infecção HIV/Hanseníase : será considerado caso para determinação de prevalência e seguimento clínico, indivíduos HIV positivos em testes sorológicos de triagem (ELISA) e confirmatórios (Wersten Blott), também apresentando sinais e sintomas para Hanseníase recomendados pelo Ministério da Saúde e complementados por exames complementares (BAAR, PGL1,PCR,histopatologia). O número da amostra de conveniência será vinculada ao número de casos encontrados. Critério para controles do estudo de seguimento clínico: pacientes com diagnóstico de hanseníase segundo sinais e sintomas para Hanseníase recomendados pelo Ministério da Saúde e complementados por exames complementares (BAAR, PGL1,PCR,histopatologia), apresentando Determine Imunocromatografia (Abbott) negativos. Serão incluídos 30 casos de Hanseníase das diversas formas clínicas, oriundos da área de abrangência do projeto. Procedimentos clínicos e laboratoriais; Serão submetidos à exame dermato-neurológicos todos os pacientes portadores de HIV matriculados na URE DIPE, Casa Dia e CTA de Parauapebas e Itaituba, que comparecerem nos serviços no período de meses após iniciada a pesquisa. Os casos considerados suspeitos oriundos de Belém serão encaminhados ao serviço do Núcleo de Medicina tropical onde serão examinados por dermatologistas e submetidos aos testes de diagnósticos PCR, PGL1, BAAR e histopatologia. Os casos dos Municípios de Parauapebas e Itaituba serão examinados por dermatologista no local e o material colhido será enviado ao NMT - Belém. Os casos confirmados de co-infeccção HIV/Hanseníase serão tratados segundo esquema terapêutico OMS/MS com poliquimioterapia (PQT). História da doença atual e pregressa registrada em ficha protocolo Exame físico e dermato-neurológico por ocasião do diagnóstico e freqüência bi-mensal registrado na ficha protocolo Serão registrados: número de lesões, tronco nervosos afetados, presença de reações, grau de incapacidade, forma clínica segundo Ridley Jopling e co-morbidades Realização do teste de Mitsuda ( medidas em mm) Todos realizarão PCR e PGL-1 Biópsia e histopatologia por ocasião do diagnóstico realização posterior de estudo imuno histoquímico Realização da carga viral e contagem de células CD4 no intervalo de 3 meses do diagnóstico da hanseníase e acompanhamento segundo o preconizado no protocolo do tratamento ARV) Os pacientes comparecerão mensalmente para consulta, recebimento da PQT e atualização dos dados clínico-terapêuticos, considerando ocorrencia de reações com ou sem neurites, adesão ao tratamento, efeitos colaterais. Após a alta medicamentosa para PQT, os pacientes comparecerão ao serviço de 3/3m, exceto em casos em que houver reações hânsenicas, quando o agendamento será conforme necessário. Coleta de soro: Serão coletadas 10 ml de sangue venoso , centrifugadas e estocadas a 20 graus C , para serem descongeladas no momento da utilização. As biópsias de pele serão colhidas após anestesia no local das lesões selecionadas com punch no. 3 e emblocadas em parafina. O material será submetido ao estudo morfológico com a coloração HE , PCR e à marcação com TGF-? e TNF-? pela técnica de imunohistoquímica . Técnicas: Detecção dos níveis de anticorpos anti PGL-1 em doentes e controles através do método de ELISA indireto padronizado no laboratório do Instituto Evandro Chagas. A Reação em Cadeia da Polimerase (PCR) será realizada a partir de biópsias colhidas de pacientes. Inicialmente, serão extraídas o DNA utilizando-se fenol-clorofórmio e precipitação por etanol. O programa de amplificação constará de 35 ciclos nas seguintes temperaturas: 94 C por 1 minuto (desnaturação), 61,5 C por 1 minuto (associação dos oligonucleotídeo) e 72 C por 2 minutos (extensão). Após os 35 ciclos usaremos uma etapa de extensão final de 72 C por 10 minutos. O produto de PCR será fracionado em eletroforese horizontal em gel de agarose a 1% em tampão TBE. O DNA será corado com brometo de etídio (concentração final de 0,5 g/ml) e as bandas visualizadas em transluminador de UV e fotografadas com filme Polaroid 665. A dosagem de anticorpos antigangliosídeos e antiNGF no soro será feita por ELISA no laboratório de neuroquímica da Universidade Federal do Pará. Técnica de Imunohistoquímica Protocolo himunohistoquímico: primeiro os blocos serão desparafinizados (através de xilol quente e frio), depois os cortes serão hidratados, e será feita a recuperação antigênica e bloqueio para coração inespecífica (peroxidase endógena). No próximo passo ocorre a incubação com anticorpo primário (TGF-? anti-humano e TNF-? humano). Após lavagens os cortes serão incubados em anticorpo secundário (LSAB, Biotina-Streptavidina), lavados e incubados em estreptavidina-peroxidase e por fim revelados, contra-corados e desidratados. Medida dos níveis de NGF por ELISA Para quantificar os níveis de NGF utilizaremos o método de ELISA direto, que confere em uma técnica imunoenzimática capaz de quantificar a presença de proteína específicas (antígenos), após a impregnação do anticorpo específico ao antígeno em uma placa de 96 poços (fase sólida). Após a captura do antígeno específico pelo anticorpo impregnado na placa, este é novamente reconhecido por uma nova incubação com o mesmo anticorpo que é por fim visualizado após reação enzimática e colorimétrica, dependente da ligação de um anticorpo secundário (anti-anticorpo), ligado a uma enzima. Dessa forma, a intensidade de cor, no final da técnica, é dependente da quantidade de antígeno ligado ao anticorpo da fase sólida. Para padronização da técnica, tomaremos como base o protocolo sugerido pela Boehringer Mannheim, um dos fornecedores de kits de ELISA para determinação de níveis de NGF. A concentração dos anticorpos a serem usados serão determinados conforme a melhor eficácia demonstrada na padronização da técnica. Como primeiro passo, o anticorpo anti-NGF, é fixado nos poços da microplaca e incubado por 2hs a 37ºC. Subseqüentemente à lavagem da placa, sítios de ligações não específicas são saturados com uma solução de bloqueio (TBS com 0,5% de albumina bovina). Durante a segunda incubação a amostra (meio de cultura ou o plasma do paciente) e o padrão (diluições seriadas de NGF de 0,1 - 1 l para formação de uma curva padrão de concentração de NGF) são adicionados nos poços, e o NGF é ligado pelo anticorpo. Na terceira incubação o anti-NGF é inserido para ligar-se no NGF ligado anteriormente. Por fim o anti-anticorpo conjugado a peroxidase é inserido nos poços. Dessa forma a placa será novamente encubada por 2 horas à 37ºC. Após a incubação, os poços serão novamente lavados para assim ser colocada uma solução de ortofenildietanolamida (OPD), substrato da peroxidase, que após a ultima incubação de 30 minutos à 37ºC, em um ambiente desprovido de luz, os poços que conterão o NGF, apresentará uma coloração laranja, que irá ser intensificada após inibição da enzima peroxidase pela acidificação do conteúdo dos poços com uma solução de 3M de HCl. A coloração obtida em cada poço será quantificada em espectrofotômetro com o comprimento de onde de 492 nm. Quantificação de anticorpo anti-NGF por ELISA indireto Para quantificar o autoanticorpo anti - NGF utilizaremos o método de ELISA indireto, que confere em uma técnica imunoenzimática capaz de quantificar a presença de anticorpos após a impregnação do antígeno em uma placa de 96 poços (fase sólida), sensibilizando-a para capturar de anticorpos contra o antígeno em questão (anticorpo primário), que será visualizado após reação enzimática colorimétrica dependente da ligação de um anticorpo secundário (anti-anticorpo), ligado a uma enzima. Dessa forma, a intensidade de cor, no final da técnica, é dependente da quantidade de anticorpos anti-NGF ligados ao antígeno da placa. Detecção e quantificação de anticorpos anti-gangliosídeos : será feita pelo método ELISA, consideradas positivas as amostras de soro cuja densidade óptica for igual ou superior à 0,20. Plano de Coletas de Dados Serão coletados dados gerais das unidades de atendimento envolvidas: Número total de paciente com HIV cadastrados em tratamento, número total de pacientes que forem atendidos e examinados no período da pesquisa Os dados dos pacientes de co-infecção HIV/Hanseníase serão colhidos através de fichas protocolos que constarão de Parte I : Dados epidemiológicos: idade, sexo, procedência, estado civil, história de contato com hanseníase Parte II: Dados clínicos do período do diagnóstico: tempo de diagnóstico da infeccção pelo HIV, situação clínica por ocasião do diagnóstico de hanseníase, co-morbidades, dosagem de CD4 e carga viral, BAAR PCR e anti PGL1 para M. leprae, anti-NGF, R. de Mitsuda, histopatologia forma clínica, grau de incapacidade, presença e tipo de reações. Parte III: Dados clínicos e laboratoriais de evolução: adesão ao tratamento, interação entre drogas ou mudanças de esquema, ocorrência de reações hansênicas, mudanças no perfil clínico laboratorial da imunodeficiência (restauração imunológica) e correlação com o quadro clínico de hanseníase. Os dados serão coletados durante o período estabelecido para pesquisa e encaminhados em relatório final, porém os autores seguirão o estudo da população selecionada pelo período mínimo de 2 anos. Plano de Análise de Dados Os dados coletados serão armazenados banco de dados eletrônicos usando o programa EXCEL e analisadas usando os programas EPI-INFO e BIOSTAT 3,0 sendo apresentados sob forma de tabelas e/ou gráficos. As variáveis serão analisadas pelo estudo de medidas de tendência central como média e mediana, bem como por medidas de variabilidade como coeficiente de variança e desvio-padrão (Kramer & Feinstein, 1981). As hipóteses serão avaliadas pelos seguintes testes: qui-quadrado, exato de Fisher e/ou t de Student de acordo com os valores obtidos (Cochran, 1953; Fisher & Yates, 1948).

Concorrência: Chamada de Pesquisa 2005 - 324/2005

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: Avaliação Clínico Epidemiológica e Laboratorial da Co-infecção HIV - Leishmaniose, Tegumentar e Visceral, no Estado do Pará.
Coordenador: RITA CATARINA MEDEIROS SOUSA
Resumo: A importância das leishmanioses no contexto de saúde pública tem aumentado em função do cres-cente número de casos que vem ocorrendo não só em zona rural, como também na periferia de grandes centros urbanos. A leishmaniose visceral é uma doença infecciosa não contagiosa de evo-lução crônica, com altos índices de mortalidade, sendo que o Brasil notifica cerca de 90% dos ca-sos do continente Americano. A leishmaniose tegumentar americana é uma enzootia de animais silvestres. A transmissão ao homem acontece quando este adentra em áreas de matas primárias passando a ter um caráter zoonótico. No Brasil, sua importância deve-se tanto pela ampla expansão geográfica quanto pela magnitude da doença, uma vez que é capaz de produzir deformidades físi-cas. No Pará, tanto a leishmaniose visceral quanto a tegumentar, são endêmicas. Tem sido relatado a ocorrência de LTA em pacientes portadores do vírus HIV. Nos casos publica-dos, tem-se observado uma diversidade clínica, quadros mais graves, dissemina-ção,comprometimento de órgãos internos e refratariedade aos tratamentos habituais. A leishmanio-se visceral vem emergindo como uma importante infecção oportunista entre os indivíduos portado-res de HIV, sendo que pode apresentar-se com uma apresentação atípica e alta mortalidade, apesar do tratamento (+50%). As espécies de Leishmania envolvidas em doença tegumentar e visceral em nossa região são espe-cíficas do continente Americano. A L. (L.) chagasi é responsável pela leishmaniose visceral. As espécies responsáveis por leishmaniose tegumentar na Amazônia são: Leishmania (Viannia) brazi-liensis, Leishmania (Viannia) guyanensis, Leishmania (Viannia) lainsoni, Leishmania (Viannia) naiffi, Leishmania (Viannia) shawi, Leishmania (Leishmania) amazonensis e Leishmania (Viannia) lindenbergi. Pouco se sabe sobre o comportamento dessas espécies em pacientes imunodeprimidos pelo HIV. Assim, este estudo é de fundamental importância para a avaliação das características clínico-epidemiológicas da co-infecção HIV/Leishmania, o que permitirá manejo clínico, diagnóstico e terapêutico mais adequado aos indivíduos co-infectados.

Objetivo: OBJETIVO GERAL: Descrever a prevalência do HIV em indivíduos com leishmaniose tegumentar ou visceral no Estado do Pará. OBJETIVOS ESPECÍFICOS: 1) Determinar a prevalência de HIV em indivíduos com leishmaniose tegumentar ou visceral habitantes dos municípios de Belém, Barcarena, Itaituba e Almerim. 2) Verificar infecção por Leishmania em pacientes portadores de HIV que habitem em áreas endêmicas para leishmanioses. 3) Identificar e caracterizar através de marcadores moleculares as diferentes espécies de Leishmania envolvidas nas co-infecções com HIV. 4) Correlacionar a doença por leishmanias com a carga viral para HIV e níveis de CD4 em pacientes co-infectados por esses dois agentes. 5) Descrever as manifestações clínicas da leishmaniose tegumentar e visceral em pacientes portadores do HIV. 6) Observar a resposta terapêutica convencional contra leishmania em pacientes co-infectados com HIV.

Metodologia: Trata-se de um estudo de prevalência, que abrangerá 4 municípios do Estado do Pará: Belém, Barcarena, Itaituba, Almerim. Nos municípios de Itaituba e Almerim, farão parte da amostragem, pacientes internados ou acompanhados ambulatorialmente nos hospitais municipais (Hospital Municipal de Itaituba e Fundação Hospitalar Vale do Jari, respectivamente). Em Barcarena, os casos de leishmaniose serão acompanhados pela 6ª regional de Saúde da SESPA. Em Belém, serão estudados pacientes internados no Hospital Universitário João de Barros Barreto com diagnóstico de leishmanioses, ou de SIDA. A sorologia anti-HIV será realizada em todo paciente com leishmaniose, utilizando o determine anti-HIV (Abbott) seguindo orientações do fabricante. O teste será realizado no Hospital Universitário João de Barros Barreto -UFPA. As amostras que se revelarem positivas serão encaminhadas ao laboratório de retrovirus do Instituto Evandro Chagas para confirmação. A sorologia anti-leishmaniose visceral será realizada no laboratório de Leishmanioses do Instituto Evandro Chagas, da SVS. Nos casos de indivíduos com lesões suspeitas de leishmaniose tegumentar, o exame parasitológico de exsudato coletado das bordas das lesões será realizado no laboratório de Leishmanioses do Instituto Evandro Chagas, da SVS. O teste de Montenegro, será utilizado na tentativa de esclarecer a prevalência de reatividade nos casos de co-infecção com HIV. Isolamento das cepas de leishmania: no caso de leishmaniose tegumentar, o material proveniente de escarificação da borda da úlcera será inoculado por via intradérmica em hamster, enquanto que no caso de leishmaniose visceral, o material será proveniente de aspirado de medula óssea para ser inoculado por via intraperitoneal em hamster. ABORDAGEM CLÍNICA E LABORATORIAL Diagnóstico Clínico: Todos os indivíduos suspeitos passarão por avaliação clínica especializada, que constará de informações sobre a identidade de cada paciente (nome, idade, sexo e residência) e sobre a história atual da doença: provável localidade onde contraiu a doença, tempo de incubação, característica morfológica, número e localização das lesões cutâneas e ou mucosas, sinais e sintomas em caso de envolvimento visceral. Diagnóstico laboratorial: Nos casos suspeitos de LTA, constará de exame parasitológico direto em esfregaço de exsudato de lesão cutânea e ou mucosa, corado por Giemsa, e da reação intradérmica de Montenegro. Além disso, serão realizadas biópsias de lesões cutâneas, com as seguintes finalidades: 1) para isolamento do parasito em meio de cultura Difco B45 (Walton et. al., 1977) e em animal de laboratório (hamster); 2) para estudo histopatológico e imunopatológico. Nos casos de leishmaniose visceral será colhido aspirado de medula para isolamento do parasito. ABORDAGEM MOLECULAR Extração de DNA: As amostras de biópsias das lesões cutâneas serão trituradas e em seguida será realizada a extração do DNA utilizando-se fenol-clorofórmio e precipitação por etanol. Reação em cadeia da polimerase (PCR). O programa de amplificação constará de um ciclo inicial de desnaturação a 95 C por 6 minutos, seguido de 35 ciclos nas seguintes temperaturas: 94 C por 1 minuto (desnaturação), 61,5 C por 1 minuto (associação dos oligonucleotídeo) e 72 C por 2 minutos (extensão). Após os 35 ciclos usaremos uma etapa de extensão final de 72 C por 10 minutos. Serão utilizados oligonucleotídeos de kDNA e de núcleo. Eletroforese do produto de PCR O produto de PCR será fracionado em eletroforese horizontal em gel de agarose a 1% em tampão TBE. O DNA será corado com brometo de etídio (concentração final de 0,5 g/ml) e as bandas visualizadas em transluminador de UV e fotografadas com filme Polaroid 665. ABORDAGEM IMUNOPATOLÓGICA Pacientes: Os pacientes com LTA serão divididos segundo suas formas clínicas anteriormente apresentadas. Biopsias de pele: As biópsias de pele serão colhidas após anestesia no local das lesões colhidas com punch no.3 e emblocadas em parafina. O material será submetido ao estudo morfológico com a coloração HE e à marcação pela técnica de imunohistoquímica para o anticorpo específico. Técnica de Imunohistoquímica: Protocolo himunohistoquímico seguirá as recomendações descritas por Hsu et al.: primeiro os blocos serão desparafinizados (através de xilol quente e frio), depois os cortes serão hidratados, e será feita a recuperação antigênica e bloqueio para coração inespecífica (peroxidase endógena). No próximo passo ocorre a incubação com anticorpo primário. Após lavagens os cortes serão incubados em anticorpo secundário (LSAB, Biotina-Streptavidina), lavados e incubados em estreptavidina-peroxidase e por fim revelados, contra-corados e desidratados. ANÁLISE DOS DADOS Os dados coletados serão armazenados em Programa Bioestat 3.0 para futuras análises. Serão coletados dados gerais das unidades de atendimento envolvidas: Número total de paciente com HIV e/ou com leishmaniose cadastrados, em tratamento ou não, número total de pacientes que forem atendidos e examinados no período da pesquisa Os dados dos pacientes de co-infecção HIV/Leishmaniose serão colhidos através de fichas protocolos que constarão de 1) Dados epidemiológicos: idade, sexo, procedência, estado civil, história de doença por Leishmania. 2) Dados clínicos do período do diagnóstico: tempo de diagnóstico da infeccção pelo HIV, situação clínica por ocasião do diagnóstico de leishmaniose, co-morbidades, dosagem de CD4 e carga viral, exames laboratoriais inespecíficos, sorologia para Leishmaniose (visceral), aspirado de medula (visceral), raspado de lesão cutânea (LTA), reação de Montenegro (LTA), espécie de Leishmania isolada. 3) Dados clínicos e laboratoriais de evolução: resposta ao tratamento anti-leishmania, tempo de tratamento, recidivas. Os dados serão coletados durante o período estabelecido para pesquisa (um ano) e encaminhados em relatórios parcial e final, porém os autores seguirão o estudo da população selecionada pelo período mínimo de 2 anos. Os resultados obtidos durante o presente estudo serão armazenados em planilhas eletrônicas usando o programa EXCEL e analisadas usando os programas EPI-INFO e/ou SPSS, sendo apresentados sob forma de tabelas e/ou histogramas, curvas de tendência, etc (SPSS, 1989). As variáveis contínuas serão analisadas pelo estudo de medidas de tendência central como média e mediana, bem como por medidas de variabilidade como coeficiente de variança e desvio-padrão (Kramer & Feinstein, 1981). As hipóteses serão avaliadas pelos seguintes testes: qui-quadrado, exato de Fisher e/ou t de Student de acordo com os valores obtidos (Cochran, 1953; Fisher & Yates, 1948). Outros testes estatísticos, se necessários, serão também usados para aferir a significância estatística das mesmas.

Concorrência: Chamada de Pesquisa 2005 - 324/2005

População Alvo: Pessoas vivendo com HIV co-infectadas

Natureza: ESTUDOS E PESQUISAS

Subnatureza: CLINICO-EPIDEMIOLÓGICA

Produção Científica


Projeto: Sífilis: Perfil Epidemiológico e Aplicação de Técnicas Moleculares para o Diagnóstico e Controle da Infeccção Congênita
Coordenador: Tereza Cristina de Oliveira Corvelo
Resumo: Segundo informações da Organização Mundial da Saúde, a sífilis ainda é um grave problema de saúde pública, principalmente em se tratando da sífilis congênita. A erradicação da sífilis adqui-rida é remota mesmo nos países desenvolvidos em virtude dos fatores de risco envolvidos (promis-cuidade sexual, uso de drogas ilícitas, co-infecção com o vírus da imunodeficiência adquirida e o pouco uso de preservativos pela população sexualmente ativa). No entanto, a eliminação da sífilis congênita é possível, devido o diagnóstico e tratamento no período pré-natal. Em virtude da importância epidemiológica da sífilis congênita (SC), desde 1986 ela é de no-tificação compulsória no Brasil; porém, devido à ausência de uniformidade no diagnóstico e con-duta, bem como, as falhas no mecanismo de notificação, sabe-se que a freqüência da doença é bem maior do que a demonstrada pelos números oficiais, principalmente em se tratando da Região Nor-te e Nordeste do país. Apesar dos esforços conjuntos entre as três esferas de governo (Governo Federal, Estadual e Municipal) ainda persiste a problemática da subnotificação dos casos de sífilis congênita (9, 24, 25, 26, 27, 32) Foram notificados à Secretaria de Estado de Saúde Pública do Pará, no período de 1990 a 1996, um total de 151 casos de SC. Já no período de 1998 a 2000, apenas cento e cinco casos de SC foram registrados no Estado do Pará (27, 29). Em 2000, dos 27.451 nascidos vivos na região me-tropolitana de Belém, apenas 8 casos de SC foram notificados ao SINAN. Ainda a exemplo desta situação, consoante dados oficiais, no ano 2000 foram notificados apenas vinte e nove casos de SC em toda região norte do país. (25, 28) Damasceno (2005), mostrou que no período de fevereiro a dezembro de 2004, do total das pacientes internadas na maternidade da F.S.C.M.PA, em trabalho de parto, 1,27% (75/5.902) ti-nham sífilis, sendo que estas mães deram a luz a 76 crianças com sífilis congênita. Estudos mos-tram que a prevalência de sífilis entre as mulheres grávidas variou de 0,6% na Korea à 6,3% no Paraguai. No Brasil, estudos sentinela mostram prevalência de sífilis em 1,7% das gestantes27, sendo estes dados ratificados pelos trabalhos de Guimarães (2000)(27) com 1,7% e Rassy (2003), que estudando um período de dois anos e meio, encontrou 1,73% de puérperas com sífilis na F.S.C.M.PA. A população atendida pela F.S.C.M.PA, Hospital das Clínicas Gaspar Viana e pela Unidade de Saúde do Telégrafo é geralmente de classe sócio-econômica baixa (13), provenientes da periferia de Belém e de localidades do interior do Pará, vivendo muitas vezes em péssima condições de ha-bitação, saneamento e de baixo nível sócio-cultural1,10. Estudar esta população para se traçar o per-fil sócio-econômico-cultural mais abrangente é de fundamental importância como instrumento de intervenção do processo saúde-doença; além de auxiliar no desenvolvimento de programas assis-tenciais voltados para as reais necessidades dessa população que está sendo exposta à aquisição da infecção pelo T. pallidum. A importância de se estudar a infecção pelo T. pallidum, reside no fato de que uma mulher grávida com sífilis pode transmitir a doença para o feto, se esta não for adequadamente diagnosti-cada e tratada. Isto é, a sífilis não tratada ou com tratamento incompleto durante a gestação pode afetar profundamente o concepto, resultando em aborto espontâneo, nascimento prematuro, morte perinatal, baixo peso, alterações ósseas entre outras manifestações de caráter prejudicial para o desenvolvimento do bebê, contribuindo assim para elevação nos índices de morbi-mortalidade in-fantil (2, 8, 28, 39, 40). Em virtude da gravidade desta doença e dos estudos soroepidemiológicos rea lizados em Belém, os quais mostram elevada prevalência da SC e a dificuldade do sorodiagnóstico disponível na rotina em detectar os casos de infecção nos recém-nascido, é de fundamental impor-tância estudar técnicas não convencionais, assim como, Western Blot IgM e Reação em Cadeia de Polimerase (PCR) na detecção da infecção pelo T. pallidum, na triagem de rotina de espécimes clínicas, pois poderão contribuir para o diagnóstico mais acurado da sífilis congênita e melhorar o sistema de notificação dos casos. Assim, na interface materno-infantil existe a necessidade de investigar a eficiência e a dispo-nibilidade de modernas técnicas de diagnóstico molecular, visto que a precisão dos resultados é essencial para aplicação das medidas terapêuticas, avaliação do prognóstico, erradicação e/ou con-trole epidemiológico da doença.

Objetivo: OBJETIVO GERAL Investigar a prevalência de sífilis no binômio mãe/filho, seus aspectos epidemiológicos e o desempenho de métodos de diagnóstico molecular, na rotina do atendimento a mulher durante a gravidez e o puerpério, que são triadas para infecção pelo Treponema pallidum na Fundação Santa Casa de Misericórdia do Pará, Hospital das Clínicas Gaspar Viana e Unidade de Saúde do Telégrafo. OBJETIVOS ESPECÍFICOS: " Estimar a prevalência de sífilis adquirida e congênita na Fundação Santa Casa de Misericórdia do Pará, Hospital das Clínicas Gaspar Viana e Unidade de Saúde do Telégrafo. " Indicar os potenciais fatores de risco que esta população está exposta para a aquisição da sífilis; " Conhecer o perfil sócio-econômico-cultural das mulheres que são atendidas nestas unidades de saúde; " Comparar os métodos laboratoriais (sorológicos e moleculares) que revelam melhor sensibilidade e especificidade na detecção do Treponema pallidum na prática clínica, principalmente na sífilis congênita; " Estabelecer a relação custo-benefício dos métodos visando a sua aplicação na rotina clínica; " Promover a educação e conscientização continuada sobre as doenças sexualmente transmissíveis (DST) na população estudada. " Avaliar como a intervenção poderá ser incorporada na prática médica.

Metodologia: Esta pesquisa trata de um estudo coorte prospectivo em gestantes e puérperas, triadas para sífilis pelo teste não-treponêmico VDRL e também através de informações clínicas e de outros testes laboratoriais específicos utilizados para a definição de caso de sífilis adquirida e congênita. Três grupos serão coletados para esta pesquisa, um grupo formado por gestantes que realizarem pré-natal nas Unidades de Saúde onde o estudo será desenvolvido, sendo estas acompanhadas até o pós-natal; o outro grupo será constituído por puérperas atendidas nestas unidades durante o puerpério, as quais não realizaram o acompanhamento pré-natal ou que abandonaram o mesmo. O terceiro e último grupo será um controle formado por mulheres soronegativas no pré-natal e no puerpério e sem histórico anterior de sífilis. Este estudo terá um tamanho amostral relativo à demanda de mulheres e recém-nascidos com teste do VDRL positivo atendidas na FSMPA e Hospital das Clínicas Gaspar Viana durante o período de outubro de 2005 a agosto de 2006 e/ou em conformidade com o cronograma de execução a partir da aprovação e liberação dos recursos. Para o grupo controle se coletará as informações e o material biológico de duas pessoas soronegativa para cada caso de sífilis estudado. Então, em termos gerais, tomando como base os estudos de prevalência nos anos anteriores, poder-se-ia estimar que o tamanho amostral a ser estudado, deverá atingir aproximadamente 150 mulheres e seus conceptos com suspeita de sífilis. Do mesmo modo, o grupo controle será constituído de cerca de 300 pares de indivíduos (mãe/recém-nascido). Na F.S.C.M.PA, Hospital das Clínicas Gaspar Viana e a Unidade de Saúde do Telégrafo, assim como preconizado pelo Ministério da Saúde, é rotina a triagem sorológica para infecção pelo Treponema pallidum durante o período pré-natal e o acompanhamento do tratamento das pacientes soropositivas para estas doenças, e também, a triagem para sífilis no puerpério de todas as parturientes e seus respectivos recém-nascidos através do teste VDRL. Além da coleta de líquido cefalorraquidiano (LCR) dos recém-nascidos suspeitos de sífilis congênita para análise de alterações liquórica (dosagem de proteínas, contagem celular e VDRL-LCR). Desta forma, as amostras de sangue periférico e LCR serão coletadas após os grupos estudados serem informados e esclarecidos sobre a abordagem da pesquisa e um Termo de Consentimento Livre e Esclarecido (anexo 1) assinado pela paciente como termo de permissão para a participação no estudo. Um questionário epidemiológico (anexo 2) com questões dirigidas à identificação pessoal, do pré-natal, das condições sócio-econômicas, higiênicas e sanitárias deverá ser respondido pelas mães dos dois grupos. O grupo controle terá também suas informações epidemiológicas coletadas, bem como o sangue periférico de gestantes e puérperas soronegativas. Critérios de Inclusão e Exclusão " A gestante, quando menor de 18 anos, participará do estudo com o consentimento do responsável, o qual deverá assinar o Termo de Consentimento Livre e Esclarecido (TCLE), " A puérpera deverá apresentar bom estado geral de saúde, principalmente na hora do esclarecimento do estudo e da assinatura do TCLE, " Acesso às amostras Biológicas do binômio mãe-recém-nascido, " A mãe deverá residir no estado do Pará, " A mãe não deverá ser portadora de deficiência mental. Coleta das amostras a) Amostra de Sangue Periférico A coleta de sangue periférico das mulheres com suspeita de sífilis será realizada em dois momentos: 1) durante o pré-natal, as grávidas que na primeira requisição dos exames nestas unidades de saúde forem reativas ao VDRL terão uma amostra de sangue coletada antes do início do tratamento; 2) no puerpério, tanto as parturientes que realizaram o pré-natal, quanto aquelas que não realizaram ou que abandonaram o acompanhamento pré-natal, porém que mostraram-se reativas ao VDRL no pós-natal terão uma amostra de sangue coletada antes do início da terapia com penicilina. Já a coleta de sangue periférico dos recém-nascidos será realizada se a quantidade de amostra fornecida pelos laboratórios de Análises Clínicas da FSCMPA e do Hospital das Clínicas Gaspar Viana não for suficiente. Neste caso, será coletada uma amostra de sangue pelos próprios profissionais dessas Unidades de Saúde. A coleta será realizada utilizando-se material estéril, de uso individual, descartado segundo as normas de biossegurança. Serão utilizados 6 ml de sangue da mãe, sendo que 4 ml será colocado em tubo com EDTA e os outros 2 ml em tubo sem anticoagulante. Em relação aos recém-nascidos, 2,0 ml de sangue será usado, sendo 1 ml com EDTA e 1 ml sem anticoagulante. As amostras de sangue total serão encaminhadas e processadas no laboratório de imunogenética da Universidade Federal do Pará e terão o DNA extraído e armazenado a -20 ºC até a utilização; já as amostras de sangue sem anticoagulante serão centrifugadas a 3.000 rpm durante 20 minutos e o soro separado em duas alíquotas e estocado à -20oC. Uma das alíquotas será encaminhada ao laboratório de Microbiologia do Instituto Evandro Chagas (IEC) para confirmação sorológica convencional da infecção por sífilis, utilizando-se um teste não-treponêmico (VDRL) e outro treponêmico (FTA-ABS-IgM); e a outra alíquota permanecerá no laboratório de Imunogenética para ser feita a pesquisa de anticorpos IgM através do Western Blot. b) Amostra de LCR Já as amostras de líquido cefalorraquidiano